il21 Search Results


ggacctcaacactaccttttgt eurofins il21 cns 49 rv  (Eurofins)
86
Eurofins ggacctcaacactaccttttgt eurofins il21 cns 49 rv
Figure 3. KMT2DTCD mice have reduced GC and antibody responses WT and KMT2DTCD mice were infected with LCMV-Armstrong. GC-TFH cells, TFH effector function, and GC-B cells were analyzed in the spleen by flow cytometry and/or scRNA-seq at day 8–9 post-infection. LCMV-specific IgG was quantified in sera at days 8 and 15 post-infection. (A) Flow plots show GP66-tetramer+ CD4+ T cells expressing CXCR5 and PD1 (programmed cell death protein-1), with gates drawn on GC-TFH cells (CXCR5hiPD1hi). Graphs show the percentage of GP66+ GC-TFH cells among CD4+ T cells and their number per spleen at 8–9 dpi. (B) Flow plots show endogenous GP66+ cells expressing CXCR5 and CD40L, with quadrant gates drawn to distinguish CXCR5−and CXCR5+ cells that produce CD40L. The graphs show the percentage of GP66+ TFH cells (CXCR5+) that express CD40L and the gMFI of CD40L among CD40L+ GP66+ TFH cells at 8–9 dpi. (C) The UMAP plot shows the expression of <t>Il21</t> among all tetramer+ CD4+ T cells. The dotted area outlines cluster 1 (TFH cluster) The violin plot of Il21 for cluster 1 is shown on the right, which indicates the false discovery rate (FDR)-adjusted p value for Il21 from pseudobulk differential expression analysis comparing WT and KMT2DTCD cluster 1. (D) Flow plots show B220+ cells expressing FAS and GL7, with gates drawn on GC-B cells (FAShiGL7hi). The graphs depict the percentage of B cells (B220+) that are GC-B cells and the number of GC-B cells per spleen at 8–9 dpi. (E) Flow plots show GC-B cell expression of CXCR4 and CD86, with gates identifying light zone (LZ; CXCR4loCD86hi) and dark zone (DZ; CXCR4hiCD86lo) GC-B cells. Graphs show the percentage of GC-B cells with an LZ or DZ phenotype and the ratio of LZ/DZ GC-B per spleen. (F) Virus-specific IgG was quantified by ELISA. The left graph shows the OD490 for serial dilutions of sera at 15 dpi; hyper-immune serum from a rechallenged LCMV-Armstrong immune WT mouse and serum from an LCMV-naive WT mouse are used for reference. Based on the dilution series, the area under the curve (AUC) was calculated for the indicated mice at 8–9 and 14–15 dpi. scRNA-seq data in (C) are from two mice per group. All other data were pooled from 1–3 independent experiments with 3–6 mice per group per experiment. Error bars are mean ± SEM. Significance was determined using an unpaired Student’s t test (*p < 0.05 and **p < 0.01).
Ggacctcaacactaccttttgt Eurofins Il21 Cns 49 Rv, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/il21/49+cns+eurofins+ggacctcaacactaccttttgt+il21+rv/pm40460200-785-188-189
Average 86 stars, based on 1 article reviews
ggacctcaacactaccttttgt eurofins il21 cns 49 rv - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
mouse il 21 duoset assay  (R&D Systems)
94
R&D Systems mouse il 21 duoset assay
Figure 3. KMT2DTCD mice have reduced GC and antibody responses WT and KMT2DTCD mice were infected with LCMV-Armstrong. GC-TFH cells, TFH effector function, and GC-B cells were analyzed in the spleen by flow cytometry and/or scRNA-seq at day 8–9 post-infection. LCMV-specific IgG was quantified in sera at days 8 and 15 post-infection. (A) Flow plots show GP66-tetramer+ CD4+ T cells expressing CXCR5 and PD1 (programmed cell death protein-1), with gates drawn on GC-TFH cells (CXCR5hiPD1hi). Graphs show the percentage of GP66+ GC-TFH cells among CD4+ T cells and their number per spleen at 8–9 dpi. (B) Flow plots show endogenous GP66+ cells expressing CXCR5 and CD40L, with quadrant gates drawn to distinguish CXCR5−and CXCR5+ cells that produce CD40L. The graphs show the percentage of GP66+ TFH cells (CXCR5+) that express CD40L and the gMFI of CD40L among CD40L+ GP66+ TFH cells at 8–9 dpi. (C) The UMAP plot shows the expression of <t>Il21</t> among all tetramer+ CD4+ T cells. The dotted area outlines cluster 1 (TFH cluster) The violin plot of Il21 for cluster 1 is shown on the right, which indicates the false discovery rate (FDR)-adjusted p value for Il21 from pseudobulk differential expression analysis comparing WT and KMT2DTCD cluster 1. (D) Flow plots show B220+ cells expressing FAS and GL7, with gates drawn on GC-B cells (FAShiGL7hi). The graphs depict the percentage of B cells (B220+) that are GC-B cells and the number of GC-B cells per spleen at 8–9 dpi. (E) Flow plots show GC-B cell expression of CXCR4 and CD86, with gates identifying light zone (LZ; CXCR4loCD86hi) and dark zone (DZ; CXCR4hiCD86lo) GC-B cells. Graphs show the percentage of GC-B cells with an LZ or DZ phenotype and the ratio of LZ/DZ GC-B per spleen. (F) Virus-specific IgG was quantified by ELISA. The left graph shows the OD490 for serial dilutions of sera at 15 dpi; hyper-immune serum from a rechallenged LCMV-Armstrong immune WT mouse and serum from an LCMV-naive WT mouse are used for reference. Based on the dilution series, the area under the curve (AUC) was calculated for the indicated mice at 8–9 and 14–15 dpi. scRNA-seq data in (C) are from two mice per group. All other data were pooled from 1–3 independent experiments with 3–6 mice per group per experiment. Error bars are mean ± SEM. Significance was determined using an unpaired Student’s t test (*p < 0.05 and **p < 0.01).
Mouse Il 21 Duoset Assay, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/il21/Mouse+IL-21+DuoSet+ELISA/pmc02634912-266-9-13
Average 94 stars, based on 1 article reviews
mouse il 21 duoset assay - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier
r2625 recombinant human il 21 r d systems  (R&D Systems)
94
R&D Systems r2625 recombinant human il 21 r d systems
Figure 3. KMT2DTCD mice have reduced GC and antibody responses WT and KMT2DTCD mice were infected with LCMV-Armstrong. GC-TFH cells, TFH effector function, and GC-B cells were analyzed in the spleen by flow cytometry and/or scRNA-seq at day 8–9 post-infection. LCMV-specific IgG was quantified in sera at days 8 and 15 post-infection. (A) Flow plots show GP66-tetramer+ CD4+ T cells expressing CXCR5 and PD1 (programmed cell death protein-1), with gates drawn on GC-TFH cells (CXCR5hiPD1hi). Graphs show the percentage of GP66+ GC-TFH cells among CD4+ T cells and their number per spleen at 8–9 dpi. (B) Flow plots show endogenous GP66+ cells expressing CXCR5 and CD40L, with quadrant gates drawn to distinguish CXCR5−and CXCR5+ cells that produce CD40L. The graphs show the percentage of GP66+ TFH cells (CXCR5+) that express CD40L and the gMFI of CD40L among CD40L+ GP66+ TFH cells at 8–9 dpi. (C) The UMAP plot shows the expression of <t>Il21</t> among all tetramer+ CD4+ T cells. The dotted area outlines cluster 1 (TFH cluster) The violin plot of Il21 for cluster 1 is shown on the right, which indicates the false discovery rate (FDR)-adjusted p value for Il21 from pseudobulk differential expression analysis comparing WT and KMT2DTCD cluster 1. (D) Flow plots show B220+ cells expressing FAS and GL7, with gates drawn on GC-B cells (FAShiGL7hi). The graphs depict the percentage of B cells (B220+) that are GC-B cells and the number of GC-B cells per spleen at 8–9 dpi. (E) Flow plots show GC-B cell expression of CXCR4 and CD86, with gates identifying light zone (LZ; CXCR4loCD86hi) and dark zone (DZ; CXCR4hiCD86lo) GC-B cells. Graphs show the percentage of GC-B cells with an LZ or DZ phenotype and the ratio of LZ/DZ GC-B per spleen. (F) Virus-specific IgG was quantified by ELISA. The left graph shows the OD490 for serial dilutions of sera at 15 dpi; hyper-immune serum from a rechallenged LCMV-Armstrong immune WT mouse and serum from an LCMV-naive WT mouse are used for reference. Based on the dilution series, the area under the curve (AUC) was calculated for the indicated mice at 8–9 and 14–15 dpi. scRNA-seq data in (C) are from two mice per group. All other data were pooled from 1–3 independent experiments with 3–6 mice per group per experiment. Error bars are mean ± SEM. Significance was determined using an unpaired Student’s t test (*p < 0.05 and **p < 0.01).
R2625 Recombinant Human Il 21 R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/il21/Recombinant+Human+IL-21+Protein/pm38578826-191-155-159
Average 94 stars, based on 1 article reviews
r2625 recombinant human il 21 r d systems - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier
il 21  (R&D Systems)
93
R&D Systems il 21
Figure 3. KMT2DTCD mice have reduced GC and antibody responses WT and KMT2DTCD mice were infected with LCMV-Armstrong. GC-TFH cells, TFH effector function, and GC-B cells were analyzed in the spleen by flow cytometry and/or scRNA-seq at day 8–9 post-infection. LCMV-specific IgG was quantified in sera at days 8 and 15 post-infection. (A) Flow plots show GP66-tetramer+ CD4+ T cells expressing CXCR5 and PD1 (programmed cell death protein-1), with gates drawn on GC-TFH cells (CXCR5hiPD1hi). Graphs show the percentage of GP66+ GC-TFH cells among CD4+ T cells and their number per spleen at 8–9 dpi. (B) Flow plots show endogenous GP66+ cells expressing CXCR5 and CD40L, with quadrant gates drawn to distinguish CXCR5−and CXCR5+ cells that produce CD40L. The graphs show the percentage of GP66+ TFH cells (CXCR5+) that express CD40L and the gMFI of CD40L among CD40L+ GP66+ TFH cells at 8–9 dpi. (C) The UMAP plot shows the expression of <t>Il21</t> among all tetramer+ CD4+ T cells. The dotted area outlines cluster 1 (TFH cluster) The violin plot of Il21 for cluster 1 is shown on the right, which indicates the false discovery rate (FDR)-adjusted p value for Il21 from pseudobulk differential expression analysis comparing WT and KMT2DTCD cluster 1. (D) Flow plots show B220+ cells expressing FAS and GL7, with gates drawn on GC-B cells (FAShiGL7hi). The graphs depict the percentage of B cells (B220+) that are GC-B cells and the number of GC-B cells per spleen at 8–9 dpi. (E) Flow plots show GC-B cell expression of CXCR4 and CD86, with gates identifying light zone (LZ; CXCR4loCD86hi) and dark zone (DZ; CXCR4hiCD86lo) GC-B cells. Graphs show the percentage of GC-B cells with an LZ or DZ phenotype and the ratio of LZ/DZ GC-B per spleen. (F) Virus-specific IgG was quantified by ELISA. The left graph shows the OD490 for serial dilutions of sera at 15 dpi; hyper-immune serum from a rechallenged LCMV-Armstrong immune WT mouse and serum from an LCMV-naive WT mouse are used for reference. Based on the dilution series, the area under the curve (AUC) was calculated for the indicated mice at 8–9 and 14–15 dpi. scRNA-seq data in (C) are from two mice per group. All other data were pooled from 1–3 independent experiments with 3–6 mice per group per experiment. Error bars are mean ± SEM. Significance was determined using an unpaired Student’s t test (*p < 0.05 and **p < 0.01).
Il 21, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/il21/Recombinant+Mouse+IL-21+Protein/pm28550197-43-15-26
Average 93 stars, based on 1 article reviews
il 21 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
elisa duo set  (R&D Systems)
94
R&D Systems elisa duo set
Figure 3. KMT2DTCD mice have reduced GC and antibody responses WT and KMT2DTCD mice were infected with LCMV-Armstrong. GC-TFH cells, TFH effector function, and GC-B cells were analyzed in the spleen by flow cytometry and/or scRNA-seq at day 8–9 post-infection. LCMV-specific IgG was quantified in sera at days 8 and 15 post-infection. (A) Flow plots show GP66-tetramer+ CD4+ T cells expressing CXCR5 and PD1 (programmed cell death protein-1), with gates drawn on GC-TFH cells (CXCR5hiPD1hi). Graphs show the percentage of GP66+ GC-TFH cells among CD4+ T cells and their number per spleen at 8–9 dpi. (B) Flow plots show endogenous GP66+ cells expressing CXCR5 and CD40L, with quadrant gates drawn to distinguish CXCR5−and CXCR5+ cells that produce CD40L. The graphs show the percentage of GP66+ TFH cells (CXCR5+) that express CD40L and the gMFI of CD40L among CD40L+ GP66+ TFH cells at 8–9 dpi. (C) The UMAP plot shows the expression of <t>Il21</t> among all tetramer+ CD4+ T cells. The dotted area outlines cluster 1 (TFH cluster) The violin plot of Il21 for cluster 1 is shown on the right, which indicates the false discovery rate (FDR)-adjusted p value for Il21 from pseudobulk differential expression analysis comparing WT and KMT2DTCD cluster 1. (D) Flow plots show B220+ cells expressing FAS and GL7, with gates drawn on GC-B cells (FAShiGL7hi). The graphs depict the percentage of B cells (B220+) that are GC-B cells and the number of GC-B cells per spleen at 8–9 dpi. (E) Flow plots show GC-B cell expression of CXCR4 and CD86, with gates identifying light zone (LZ; CXCR4loCD86hi) and dark zone (DZ; CXCR4hiCD86lo) GC-B cells. Graphs show the percentage of GC-B cells with an LZ or DZ phenotype and the ratio of LZ/DZ GC-B per spleen. (F) Virus-specific IgG was quantified by ELISA. The left graph shows the OD490 for serial dilutions of sera at 15 dpi; hyper-immune serum from a rechallenged LCMV-Armstrong immune WT mouse and serum from an LCMV-naive WT mouse are used for reference. Based on the dilution series, the area under the curve (AUC) was calculated for the indicated mice at 8–9 and 14–15 dpi. scRNA-seq data in (C) are from two mice per group. All other data were pooled from 1–3 independent experiments with 3–6 mice per group per experiment. Error bars are mean ± SEM. Significance was determined using an unpaired Student’s t test (*p < 0.05 and **p < 0.01).
Elisa Duo Set, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/il21/Mouse+IL-21+DuoSet+ELISA/10__1158_slash_2326___6066__cir___13___0121-69-19-22
Average 94 stars, based on 1 article reviews
elisa duo set - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier
il 21  (Elabscience Biotechnology)
93
Elabscience Biotechnology il 21
Figure 3. KMT2DTCD mice have reduced GC and antibody responses WT and KMT2DTCD mice were infected with LCMV-Armstrong. GC-TFH cells, TFH effector function, and GC-B cells were analyzed in the spleen by flow cytometry and/or scRNA-seq at day 8–9 post-infection. LCMV-specific IgG was quantified in sera at days 8 and 15 post-infection. (A) Flow plots show GP66-tetramer+ CD4+ T cells expressing CXCR5 and PD1 (programmed cell death protein-1), with gates drawn on GC-TFH cells (CXCR5hiPD1hi). Graphs show the percentage of GP66+ GC-TFH cells among CD4+ T cells and their number per spleen at 8–9 dpi. (B) Flow plots show endogenous GP66+ cells expressing CXCR5 and CD40L, with quadrant gates drawn to distinguish CXCR5−and CXCR5+ cells that produce CD40L. The graphs show the percentage of GP66+ TFH cells (CXCR5+) that express CD40L and the gMFI of CD40L among CD40L+ GP66+ TFH cells at 8–9 dpi. (C) The UMAP plot shows the expression of <t>Il21</t> among all tetramer+ CD4+ T cells. The dotted area outlines cluster 1 (TFH cluster) The violin plot of Il21 for cluster 1 is shown on the right, which indicates the false discovery rate (FDR)-adjusted p value for Il21 from pseudobulk differential expression analysis comparing WT and KMT2DTCD cluster 1. (D) Flow plots show B220+ cells expressing FAS and GL7, with gates drawn on GC-B cells (FAShiGL7hi). The graphs depict the percentage of B cells (B220+) that are GC-B cells and the number of GC-B cells per spleen at 8–9 dpi. (E) Flow plots show GC-B cell expression of CXCR4 and CD86, with gates identifying light zone (LZ; CXCR4loCD86hi) and dark zone (DZ; CXCR4hiCD86lo) GC-B cells. Graphs show the percentage of GC-B cells with an LZ or DZ phenotype and the ratio of LZ/DZ GC-B per spleen. (F) Virus-specific IgG was quantified by ELISA. The left graph shows the OD490 for serial dilutions of sera at 15 dpi; hyper-immune serum from a rechallenged LCMV-Armstrong immune WT mouse and serum from an LCMV-naive WT mouse are used for reference. Based on the dilution series, the area under the curve (AUC) was calculated for the indicated mice at 8–9 and 14–15 dpi. scRNA-seq data in (C) are from two mice per group. All other data were pooled from 1–3 independent experiments with 3–6 mice per group per experiment. Error bars are mean ± SEM. Significance was determined using an unpaired Student’s t test (*p < 0.05 and **p < 0.01).
Il 21, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/il21/Mouse+IL-21+(Interleukin+21)+ELISA+Kit/10__1096_slash_fj__201902910rrr-59-8-9
Average 93 stars, based on 1 article reviews
il 21 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
il 21 staining  (R&D Systems)
94
R&D Systems il 21 staining
Figure 3. KMT2DTCD mice have reduced GC and antibody responses WT and KMT2DTCD mice were infected with LCMV-Armstrong. GC-TFH cells, TFH effector function, and GC-B cells were analyzed in the spleen by flow cytometry and/or scRNA-seq at day 8–9 post-infection. LCMV-specific IgG was quantified in sera at days 8 and 15 post-infection. (A) Flow plots show GP66-tetramer+ CD4+ T cells expressing CXCR5 and PD1 (programmed cell death protein-1), with gates drawn on GC-TFH cells (CXCR5hiPD1hi). Graphs show the percentage of GP66+ GC-TFH cells among CD4+ T cells and their number per spleen at 8–9 dpi. (B) Flow plots show endogenous GP66+ cells expressing CXCR5 and CD40L, with quadrant gates drawn to distinguish CXCR5−and CXCR5+ cells that produce CD40L. The graphs show the percentage of GP66+ TFH cells (CXCR5+) that express CD40L and the gMFI of CD40L among CD40L+ GP66+ TFH cells at 8–9 dpi. (C) The UMAP plot shows the expression of <t>Il21</t> among all tetramer+ CD4+ T cells. The dotted area outlines cluster 1 (TFH cluster) The violin plot of Il21 for cluster 1 is shown on the right, which indicates the false discovery rate (FDR)-adjusted p value for Il21 from pseudobulk differential expression analysis comparing WT and KMT2DTCD cluster 1. (D) Flow plots show B220+ cells expressing FAS and GL7, with gates drawn on GC-B cells (FAShiGL7hi). The graphs depict the percentage of B cells (B220+) that are GC-B cells and the number of GC-B cells per spleen at 8–9 dpi. (E) Flow plots show GC-B cell expression of CXCR4 and CD86, with gates identifying light zone (LZ; CXCR4loCD86hi) and dark zone (DZ; CXCR4hiCD86lo) GC-B cells. Graphs show the percentage of GC-B cells with an LZ or DZ phenotype and the ratio of LZ/DZ GC-B per spleen. (F) Virus-specific IgG was quantified by ELISA. The left graph shows the OD490 for serial dilutions of sera at 15 dpi; hyper-immune serum from a rechallenged LCMV-Armstrong immune WT mouse and serum from an LCMV-naive WT mouse are used for reference. Based on the dilution series, the area under the curve (AUC) was calculated for the indicated mice at 8–9 and 14–15 dpi. scRNA-seq data in (C) are from two mice per group. All other data were pooled from 1–3 independent experiments with 3–6 mice per group per experiment. Error bars are mean ± SEM. Significance was determined using an unpaired Student’s t test (*p < 0.05 and **p < 0.01).
Il 21 Staining, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/il21/Recombinant+Human+IL-21+Protein/pmc10424726-47-0-21
Average 94 stars, based on 1 article reviews
il 21 staining - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier
il 21  (Miltenyi Biotec)
94
Miltenyi Biotec il 21
Figure 3. KMT2DTCD mice have reduced GC and antibody responses WT and KMT2DTCD mice were infected with LCMV-Armstrong. GC-TFH cells, TFH effector function, and GC-B cells were analyzed in the spleen by flow cytometry and/or scRNA-seq at day 8–9 post-infection. LCMV-specific IgG was quantified in sera at days 8 and 15 post-infection. (A) Flow plots show GP66-tetramer+ CD4+ T cells expressing CXCR5 and PD1 (programmed cell death protein-1), with gates drawn on GC-TFH cells (CXCR5hiPD1hi). Graphs show the percentage of GP66+ GC-TFH cells among CD4+ T cells and their number per spleen at 8–9 dpi. (B) Flow plots show endogenous GP66+ cells expressing CXCR5 and CD40L, with quadrant gates drawn to distinguish CXCR5−and CXCR5+ cells that produce CD40L. The graphs show the percentage of GP66+ TFH cells (CXCR5+) that express CD40L and the gMFI of CD40L among CD40L+ GP66+ TFH cells at 8–9 dpi. (C) The UMAP plot shows the expression of <t>Il21</t> among all tetramer+ CD4+ T cells. The dotted area outlines cluster 1 (TFH cluster) The violin plot of Il21 for cluster 1 is shown on the right, which indicates the false discovery rate (FDR)-adjusted p value for Il21 from pseudobulk differential expression analysis comparing WT and KMT2DTCD cluster 1. (D) Flow plots show B220+ cells expressing FAS and GL7, with gates drawn on GC-B cells (FAShiGL7hi). The graphs depict the percentage of B cells (B220+) that are GC-B cells and the number of GC-B cells per spleen at 8–9 dpi. (E) Flow plots show GC-B cell expression of CXCR4 and CD86, with gates identifying light zone (LZ; CXCR4loCD86hi) and dark zone (DZ; CXCR4hiCD86lo) GC-B cells. Graphs show the percentage of GC-B cells with an LZ or DZ phenotype and the ratio of LZ/DZ GC-B per spleen. (F) Virus-specific IgG was quantified by ELISA. The left graph shows the OD490 for serial dilutions of sera at 15 dpi; hyper-immune serum from a rechallenged LCMV-Armstrong immune WT mouse and serum from an LCMV-naive WT mouse are used for reference. Based on the dilution series, the area under the curve (AUC) was calculated for the indicated mice at 8–9 and 14–15 dpi. scRNA-seq data in (C) are from two mice per group. All other data were pooled from 1–3 independent experiments with 3–6 mice per group per experiment. Error bars are mean ± SEM. Significance was determined using an unpaired Student’s t test (*p < 0.05 and **p < 0.01).
Il 21, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/il21/Human+IL-21%2C+premium+grade/pm37161048-353-37-40
Average 94 stars, based on 1 article reviews
il 21 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier
anti il 21 apc  (R&D Systems)
94
R&D Systems anti il 21 apc
Figure 3. KMT2DTCD mice have reduced GC and antibody responses WT and KMT2DTCD mice were infected with LCMV-Armstrong. GC-TFH cells, TFH effector function, and GC-B cells were analyzed in the spleen by flow cytometry and/or scRNA-seq at day 8–9 post-infection. LCMV-specific IgG was quantified in sera at days 8 and 15 post-infection. (A) Flow plots show GP66-tetramer+ CD4+ T cells expressing CXCR5 and PD1 (programmed cell death protein-1), with gates drawn on GC-TFH cells (CXCR5hiPD1hi). Graphs show the percentage of GP66+ GC-TFH cells among CD4+ T cells and their number per spleen at 8–9 dpi. (B) Flow plots show endogenous GP66+ cells expressing CXCR5 and CD40L, with quadrant gates drawn to distinguish CXCR5−and CXCR5+ cells that produce CD40L. The graphs show the percentage of GP66+ TFH cells (CXCR5+) that express CD40L and the gMFI of CD40L among CD40L+ GP66+ TFH cells at 8–9 dpi. (C) The UMAP plot shows the expression of <t>Il21</t> among all tetramer+ CD4+ T cells. The dotted area outlines cluster 1 (TFH cluster) The violin plot of Il21 for cluster 1 is shown on the right, which indicates the false discovery rate (FDR)-adjusted p value for Il21 from pseudobulk differential expression analysis comparing WT and KMT2DTCD cluster 1. (D) Flow plots show B220+ cells expressing FAS and GL7, with gates drawn on GC-B cells (FAShiGL7hi). The graphs depict the percentage of B cells (B220+) that are GC-B cells and the number of GC-B cells per spleen at 8–9 dpi. (E) Flow plots show GC-B cell expression of CXCR4 and CD86, with gates identifying light zone (LZ; CXCR4loCD86hi) and dark zone (DZ; CXCR4hiCD86lo) GC-B cells. Graphs show the percentage of GC-B cells with an LZ or DZ phenotype and the ratio of LZ/DZ GC-B per spleen. (F) Virus-specific IgG was quantified by ELISA. The left graph shows the OD490 for serial dilutions of sera at 15 dpi; hyper-immune serum from a rechallenged LCMV-Armstrong immune WT mouse and serum from an LCMV-naive WT mouse are used for reference. Based on the dilution series, the area under the curve (AUC) was calculated for the indicated mice at 8–9 and 14–15 dpi. scRNA-seq data in (C) are from two mice per group. All other data were pooled from 1–3 independent experiments with 3–6 mice per group per experiment. Error bars are mean ± SEM. Significance was determined using an unpaired Student’s t test (*p < 0.05 and **p < 0.01).
Anti Il 21 Apc, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/il21/IL-21+Antibody+(227)+%5BAllophycocyanin%5D/pmc03457559-124-30-34
Average 94 stars, based on 1 article reviews
anti il 21 apc - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier
anti il21  (R&D Systems)
93
R&D Systems anti il21
Figure 3. KMT2DTCD mice have reduced GC and antibody responses WT and KMT2DTCD mice were infected with LCMV-Armstrong. GC-TFH cells, TFH effector function, and GC-B cells were analyzed in the spleen by flow cytometry and/or scRNA-seq at day 8–9 post-infection. LCMV-specific IgG was quantified in sera at days 8 and 15 post-infection. (A) Flow plots show GP66-tetramer+ CD4+ T cells expressing CXCR5 and PD1 (programmed cell death protein-1), with gates drawn on GC-TFH cells (CXCR5hiPD1hi). Graphs show the percentage of GP66+ GC-TFH cells among CD4+ T cells and their number per spleen at 8–9 dpi. (B) Flow plots show endogenous GP66+ cells expressing CXCR5 and CD40L, with quadrant gates drawn to distinguish CXCR5−and CXCR5+ cells that produce CD40L. The graphs show the percentage of GP66+ TFH cells (CXCR5+) that express CD40L and the gMFI of CD40L among CD40L+ GP66+ TFH cells at 8–9 dpi. (C) The UMAP plot shows the expression of <t>Il21</t> among all tetramer+ CD4+ T cells. The dotted area outlines cluster 1 (TFH cluster) The violin plot of Il21 for cluster 1 is shown on the right, which indicates the false discovery rate (FDR)-adjusted p value for Il21 from pseudobulk differential expression analysis comparing WT and KMT2DTCD cluster 1. (D) Flow plots show B220+ cells expressing FAS and GL7, with gates drawn on GC-B cells (FAShiGL7hi). The graphs depict the percentage of B cells (B220+) that are GC-B cells and the number of GC-B cells per spleen at 8–9 dpi. (E) Flow plots show GC-B cell expression of CXCR4 and CD86, with gates identifying light zone (LZ; CXCR4loCD86hi) and dark zone (DZ; CXCR4hiCD86lo) GC-B cells. Graphs show the percentage of GC-B cells with an LZ or DZ phenotype and the ratio of LZ/DZ GC-B per spleen. (F) Virus-specific IgG was quantified by ELISA. The left graph shows the OD490 for serial dilutions of sera at 15 dpi; hyper-immune serum from a rechallenged LCMV-Armstrong immune WT mouse and serum from an LCMV-naive WT mouse are used for reference. Based on the dilution series, the area under the curve (AUC) was calculated for the indicated mice at 8–9 and 14–15 dpi. scRNA-seq data in (C) are from two mice per group. All other data were pooled from 1–3 independent experiments with 3–6 mice per group per experiment. Error bars are mean ± SEM. Significance was determined using an unpaired Student’s t test (*p < 0.05 and **p < 0.01).
Anti Il21, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/il21/Mouse+IL-21+Antibody/pm35612500-73-12-14
Average 93 stars, based on 1 article reviews
anti il21 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

Image Search Results


Figure 3. KMT2DTCD mice have reduced GC and antibody responses WT and KMT2DTCD mice were infected with LCMV-Armstrong. GC-TFH cells, TFH effector function, and GC-B cells were analyzed in the spleen by flow cytometry and/or scRNA-seq at day 8–9 post-infection. LCMV-specific IgG was quantified in sera at days 8 and 15 post-infection. (A) Flow plots show GP66-tetramer+ CD4+ T cells expressing CXCR5 and PD1 (programmed cell death protein-1), with gates drawn on GC-TFH cells (CXCR5hiPD1hi). Graphs show the percentage of GP66+ GC-TFH cells among CD4+ T cells and their number per spleen at 8–9 dpi. (B) Flow plots show endogenous GP66+ cells expressing CXCR5 and CD40L, with quadrant gates drawn to distinguish CXCR5−and CXCR5+ cells that produce CD40L. The graphs show the percentage of GP66+ TFH cells (CXCR5+) that express CD40L and the gMFI of CD40L among CD40L+ GP66+ TFH cells at 8–9 dpi. (C) The UMAP plot shows the expression of Il21 among all tetramer+ CD4+ T cells. The dotted area outlines cluster 1 (TFH cluster) The violin plot of Il21 for cluster 1 is shown on the right, which indicates the false discovery rate (FDR)-adjusted p value for Il21 from pseudobulk differential expression analysis comparing WT and KMT2DTCD cluster 1. (D) Flow plots show B220+ cells expressing FAS and GL7, with gates drawn on GC-B cells (FAShiGL7hi). The graphs depict the percentage of B cells (B220+) that are GC-B cells and the number of GC-B cells per spleen at 8–9 dpi. (E) Flow plots show GC-B cell expression of CXCR4 and CD86, with gates identifying light zone (LZ; CXCR4loCD86hi) and dark zone (DZ; CXCR4hiCD86lo) GC-B cells. Graphs show the percentage of GC-B cells with an LZ or DZ phenotype and the ratio of LZ/DZ GC-B per spleen. (F) Virus-specific IgG was quantified by ELISA. The left graph shows the OD490 for serial dilutions of sera at 15 dpi; hyper-immune serum from a rechallenged LCMV-Armstrong immune WT mouse and serum from an LCMV-naive WT mouse are used for reference. Based on the dilution series, the area under the curve (AUC) was calculated for the indicated mice at 8–9 and 14–15 dpi. scRNA-seq data in (C) are from two mice per group. All other data were pooled from 1–3 independent experiments with 3–6 mice per group per experiment. Error bars are mean ± SEM. Significance was determined using an unpaired Student’s t test (*p < 0.05 and **p < 0.01).

Journal: Cell reports

Article Title: KMT2D coordinates antiviral CD4 + T cell responses through opposing effects on T follicular helper and cytotoxic gene expression.

doi: 10.1016/j.celrep.2025.115775

Figure Lengend Snippet: Figure 3. KMT2DTCD mice have reduced GC and antibody responses WT and KMT2DTCD mice were infected with LCMV-Armstrong. GC-TFH cells, TFH effector function, and GC-B cells were analyzed in the spleen by flow cytometry and/or scRNA-seq at day 8–9 post-infection. LCMV-specific IgG was quantified in sera at days 8 and 15 post-infection. (A) Flow plots show GP66-tetramer+ CD4+ T cells expressing CXCR5 and PD1 (programmed cell death protein-1), with gates drawn on GC-TFH cells (CXCR5hiPD1hi). Graphs show the percentage of GP66+ GC-TFH cells among CD4+ T cells and their number per spleen at 8–9 dpi. (B) Flow plots show endogenous GP66+ cells expressing CXCR5 and CD40L, with quadrant gates drawn to distinguish CXCR5−and CXCR5+ cells that produce CD40L. The graphs show the percentage of GP66+ TFH cells (CXCR5+) that express CD40L and the gMFI of CD40L among CD40L+ GP66+ TFH cells at 8–9 dpi. (C) The UMAP plot shows the expression of Il21 among all tetramer+ CD4+ T cells. The dotted area outlines cluster 1 (TFH cluster) The violin plot of Il21 for cluster 1 is shown on the right, which indicates the false discovery rate (FDR)-adjusted p value for Il21 from pseudobulk differential expression analysis comparing WT and KMT2DTCD cluster 1. (D) Flow plots show B220+ cells expressing FAS and GL7, with gates drawn on GC-B cells (FAShiGL7hi). The graphs depict the percentage of B cells (B220+) that are GC-B cells and the number of GC-B cells per spleen at 8–9 dpi. (E) Flow plots show GC-B cell expression of CXCR4 and CD86, with gates identifying light zone (LZ; CXCR4loCD86hi) and dark zone (DZ; CXCR4hiCD86lo) GC-B cells. Graphs show the percentage of GC-B cells with an LZ or DZ phenotype and the ratio of LZ/DZ GC-B per spleen. (F) Virus-specific IgG was quantified by ELISA. The left graph shows the OD490 for serial dilutions of sera at 15 dpi; hyper-immune serum from a rechallenged LCMV-Armstrong immune WT mouse and serum from an LCMV-naive WT mouse are used for reference. Based on the dilution series, the area under the curve (AUC) was calculated for the indicated mice at 8–9 and 14–15 dpi. scRNA-seq data in (C) are from two mice per group. All other data were pooled from 1–3 independent experiments with 3–6 mice per group per experiment. Error bars are mean ± SEM. Significance was determined using an unpaired Student’s t test (*p < 0.05 and **p < 0.01).

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pAG-Tn5 Epicypher Cat# 15-1017 Concanavalin A magnetic beads Cell Signaling Cat# 93569S Deposited data scRNA-seq: CD4+ T cells; Spleen This paper GEO: GSE282033 Experimental models: Cell lines Vero-E6 Michael Buchmeier The Scripps Research Institute, La Jolla, CA BHK-21 American Type Culture Collection Cat# CCL-10 Plat-E Cells CellBioLabs (kindly provided by Dr. Milner, UNC) Cat# RV-101 Experimental models: Organisms/strains Mouse: C57BL/6J Jackson Laboratory (bred at UNC) Cat# 000664 Mouse: B6.Ly5a Jackson Laboratory (bred at UNC) Cat# 002014 Mouse: LckCre Jackson Laboratory (bred at UNC) Cat# 003802 Mouse: Kmt2dfl/fl Bred in house Jang et al.49 Mouse: SMARTA TCR-Tg (B6.CD45.1) Backcrossed in Whitmire Lab Oxenius et al.81 Mouse: P14 TCR-Tg (B6.CD45.1) Backcrossed in Whitmire Lab Pircher et al.82 Oligonucleotides Genotyping for Lck-Cre (FW) TGCAACGAGTGATGAGGTTC Eurofins Genotyping for Lck-Cre (RV) ACAGCATTGCTGTCACTTGG Eurofins Genotyping for KMT2Dfl/fl (FW1) ATAAACGGTGAGCTTGTGCG Eurofins Genotyping for KMT2Dfl/fl (FW2) AAGTTCCATAGCCATTGCTC Eurofins Genotyping for KMT2Dfl/fl (RV) TTTCACCACTGTCGACCAAG Eurofins Thpok GTE (FW) AGCCCTGGGTTCTTCTCTTC Eurofins Thpok GTE (RV) CCTCCTTTCTTTCCCCTTTG Eurofins Thpok Proximal Enhancer (FW) TGAGCCACATGTCACTAGAG Eurofins Thpok Proximal Enhancer (RV) GAAGTTTAGAGGACCTGGAG Eurofins Thpok Site A (FW) CCAGCCACCAAAAGTTCATC Eurofins Thpok Site A (RV) TGTGAGGGTACAGGAAGTAC Eurofins Il21 CNS-49 (FW) GGACCTCAACACTACCTTTTGT Eurofins Il21 CNS-49 (RV) CCTTCCCATCACTGCTCATG Eurofins Hoxb1 (FW) AGTCGGAAGGAGATGGAAGC Eurofins Hoxb1 (RV) CTGTCTTAGGTGGGTTTCTC Eurofins Gene desert region (FW) TTTCCTGCCTCTGCCTTTTA Eurofins Gene desert region (RV) AGGTGGCACAGTGGGTAAAG Eurofins Kmt2d exon 50–51 (FW) GGGTGGAGAGCTGTCAGAATTATT Eurofins Kmt2d exon 50–51 (RV) CATGAGCGGTAACTCCATCAGA Eurofins Recombinant DNA MSCV-IRES-eGFP Addgene Cat# 20672 MSCV-ThPok-t2a-eGFP Kindly provided by Dr. Justin Milner N/A MSCV-Tcf1 (p33) - t2a-eGFP Kindly provided by Dr. Justin Milner N/A Software and algorithms Cell Ranger 10x Genomics Zheng et al.83 FlowJo v10 Treestar https://www.flowjo.com GraphPad Prism v10 Dotmatics https://www.graphpad.com IGV v2.18.2 Robinson et al.84 http://www.igv.org/ Loupe Browser v8.0.0 10x Genomics https://www.10xgenomics.com R Studio N/A Seurat v5.1.0 Stuart et al.85 http://www.satijalab.org/seurat; RRID: SCR_016341 20 Cell Reports 44, 115775, June 24, 2025

Techniques: Infection, Flow Cytometry, Expressing, Quantitative Proteomics, Virus, Enzyme-linked Immunosorbent Assay

Figure 4. CD4+ T cell-intrinsic expression of KMT2D is needed for TFH responses WT or KMT2D-deficient SMARTA cells were introduced into congenic (CD45.2+) mice followed by LCMV-Armstrong infection 1 day later. At days 7–8 post- infection, SMARTA cells were identified in the spleens of host mice by flow cytometry, along with their expression of cytokines, TFH and TH1 differentiation, critical surface receptor ligands, and transcription factors. (A) Illustration of the experimental setup. (B) Flow plots of CD4+ cells showing CD4 and CD45.1 expression, with gates set on CD4+CD45.1+ donor SMARTA cells. The graphs show the number of donor cells per spleen and their percentage among total splenic CD4+ cells. (C) Splenocytes were stimulated ex vivo with GP61-80 peptide, and donor cells were analyzed for cytokine expression. The left graph shows the frequency of donor cells expressing IFN-γ, TNF, and IL-2. The middle graph shows the gMFI of IFN-γ, TNF, and IL-2 among IFN-γ+, TNF+, and IL-2+ donor cells, respectively. The right graph shows the percentage of donor cells that co-express IFN-γ, TNF, and IL-2. (D) The flow plots show donor cell expression of CXCR5 and CXCR6 with quadrant gates set to discriminate TFH (CXCR5+CXCR6−) and TH1 (CXCR5−CXCR6+) subsets. Using this gating strategy, the graphs show the percentage of donor cells that are TFH or TH1. (E) Graphs show the percentage of donor cells that are TFH (CXCR5+PSGL1lo). (F) Graphs show the percentage of donor TFH cells (CXCR5+) that express CD40L and the gMFI of CD40L among CD40L+ donor TFH cells. (G) Splenocytes were stimulated ex vivo with GP61-80 peptide and analyzed for cytokine expression. Flow plots show donor TFH (CXCR5+) expression of IL-21 and CD4, with gates set on IL-21+ donor TFH cells. The graphs show the percentage of donor TFH cells expressing IL-21 and the gMFI of IL-21 among IL-21+ donor TFH cells. (H) Graphs show the gMFI of TCF1, ICOS, and BCL6 among donor TFH cells (CXCR5+). Data in (A)–(F) and (H) were pooled from 2 independent experiments with 3–4 mice per group per experiment. Data in (G) are from 1 experiment with 3–4 mice per group. Error bars depict mean ± SEM. Significance was determined using an unpaired Student’s t test (*p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001). See also Figure S4.

Journal: Cell reports

Article Title: KMT2D coordinates antiviral CD4 + T cell responses through opposing effects on T follicular helper and cytotoxic gene expression.

doi: 10.1016/j.celrep.2025.115775

Figure Lengend Snippet: Figure 4. CD4+ T cell-intrinsic expression of KMT2D is needed for TFH responses WT or KMT2D-deficient SMARTA cells were introduced into congenic (CD45.2+) mice followed by LCMV-Armstrong infection 1 day later. At days 7–8 post- infection, SMARTA cells were identified in the spleens of host mice by flow cytometry, along with their expression of cytokines, TFH and TH1 differentiation, critical surface receptor ligands, and transcription factors. (A) Illustration of the experimental setup. (B) Flow plots of CD4+ cells showing CD4 and CD45.1 expression, with gates set on CD4+CD45.1+ donor SMARTA cells. The graphs show the number of donor cells per spleen and their percentage among total splenic CD4+ cells. (C) Splenocytes were stimulated ex vivo with GP61-80 peptide, and donor cells were analyzed for cytokine expression. The left graph shows the frequency of donor cells expressing IFN-γ, TNF, and IL-2. The middle graph shows the gMFI of IFN-γ, TNF, and IL-2 among IFN-γ+, TNF+, and IL-2+ donor cells, respectively. The right graph shows the percentage of donor cells that co-express IFN-γ, TNF, and IL-2. (D) The flow plots show donor cell expression of CXCR5 and CXCR6 with quadrant gates set to discriminate TFH (CXCR5+CXCR6−) and TH1 (CXCR5−CXCR6+) subsets. Using this gating strategy, the graphs show the percentage of donor cells that are TFH or TH1. (E) Graphs show the percentage of donor cells that are TFH (CXCR5+PSGL1lo). (F) Graphs show the percentage of donor TFH cells (CXCR5+) that express CD40L and the gMFI of CD40L among CD40L+ donor TFH cells. (G) Splenocytes were stimulated ex vivo with GP61-80 peptide and analyzed for cytokine expression. Flow plots show donor TFH (CXCR5+) expression of IL-21 and CD4, with gates set on IL-21+ donor TFH cells. The graphs show the percentage of donor TFH cells expressing IL-21 and the gMFI of IL-21 among IL-21+ donor TFH cells. (H) Graphs show the gMFI of TCF1, ICOS, and BCL6 among donor TFH cells (CXCR5+). Data in (A)–(F) and (H) were pooled from 2 independent experiments with 3–4 mice per group per experiment. Data in (G) are from 1 experiment with 3–4 mice per group. Error bars depict mean ± SEM. Significance was determined using an unpaired Student’s t test (*p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001). See also Figure S4.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pAG-Tn5 Epicypher Cat# 15-1017 Concanavalin A magnetic beads Cell Signaling Cat# 93569S Deposited data scRNA-seq: CD4+ T cells; Spleen This paper GEO: GSE282033 Experimental models: Cell lines Vero-E6 Michael Buchmeier The Scripps Research Institute, La Jolla, CA BHK-21 American Type Culture Collection Cat# CCL-10 Plat-E Cells CellBioLabs (kindly provided by Dr. Milner, UNC) Cat# RV-101 Experimental models: Organisms/strains Mouse: C57BL/6J Jackson Laboratory (bred at UNC) Cat# 000664 Mouse: B6.Ly5a Jackson Laboratory (bred at UNC) Cat# 002014 Mouse: LckCre Jackson Laboratory (bred at UNC) Cat# 003802 Mouse: Kmt2dfl/fl Bred in house Jang et al.49 Mouse: SMARTA TCR-Tg (B6.CD45.1) Backcrossed in Whitmire Lab Oxenius et al.81 Mouse: P14 TCR-Tg (B6.CD45.1) Backcrossed in Whitmire Lab Pircher et al.82 Oligonucleotides Genotyping for Lck-Cre (FW) TGCAACGAGTGATGAGGTTC Eurofins Genotyping for Lck-Cre (RV) ACAGCATTGCTGTCACTTGG Eurofins Genotyping for KMT2Dfl/fl (FW1) ATAAACGGTGAGCTTGTGCG Eurofins Genotyping for KMT2Dfl/fl (FW2) AAGTTCCATAGCCATTGCTC Eurofins Genotyping for KMT2Dfl/fl (RV) TTTCACCACTGTCGACCAAG Eurofins Thpok GTE (FW) AGCCCTGGGTTCTTCTCTTC Eurofins Thpok GTE (RV) CCTCCTTTCTTTCCCCTTTG Eurofins Thpok Proximal Enhancer (FW) TGAGCCACATGTCACTAGAG Eurofins Thpok Proximal Enhancer (RV) GAAGTTTAGAGGACCTGGAG Eurofins Thpok Site A (FW) CCAGCCACCAAAAGTTCATC Eurofins Thpok Site A (RV) TGTGAGGGTACAGGAAGTAC Eurofins Il21 CNS-49 (FW) GGACCTCAACACTACCTTTTGT Eurofins Il21 CNS-49 (RV) CCTTCCCATCACTGCTCATG Eurofins Hoxb1 (FW) AGTCGGAAGGAGATGGAAGC Eurofins Hoxb1 (RV) CTGTCTTAGGTGGGTTTCTC Eurofins Gene desert region (FW) TTTCCTGCCTCTGCCTTTTA Eurofins Gene desert region (RV) AGGTGGCACAGTGGGTAAAG Eurofins Kmt2d exon 50–51 (FW) GGGTGGAGAGCTGTCAGAATTATT Eurofins Kmt2d exon 50–51 (RV) CATGAGCGGTAACTCCATCAGA Eurofins Recombinant DNA MSCV-IRES-eGFP Addgene Cat# 20672 MSCV-ThPok-t2a-eGFP Kindly provided by Dr. Justin Milner N/A MSCV-Tcf1 (p33) - t2a-eGFP Kindly provided by Dr. Justin Milner N/A Software and algorithms Cell Ranger 10x Genomics Zheng et al.83 FlowJo v10 Treestar https://www.flowjo.com GraphPad Prism v10 Dotmatics https://www.graphpad.com IGV v2.18.2 Robinson et al.84 http://www.igv.org/ Loupe Browser v8.0.0 10x Genomics https://www.10xgenomics.com R Studio N/A Seurat v5.1.0 Stuart et al.85 http://www.satijalab.org/seurat; RRID: SCR_016341 20 Cell Reports 44, 115775, June 24, 2025

Techniques: Expressing, Infection, Flow Cytometry, Ex Vivo