|
Sangon Biotech
accttccaggatgaggacatga sangon biotech n a il1b primer Accttccaggatgaggacatga Sangon Biotech N A Il1b Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il1b/a+accttccaggatgaggacatga+biotech+il1b+n+primer+sangon/pm38159573-806-200-201 Average 86 stars, based on 1 article reviews
accttccaggatgaggacatga sangon biotech n a il1b primer - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Boster Bio
rabbit anti il 1β Rabbit Anti Il 1β, supplied by Boster Bio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il1b/Anti-IL-1+beta%2FIL1B+Antibody+Picoband/pmc12812623-87-43-48 Average 93 stars, based on 1 article reviews
rabbit anti il 1β - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Boster Bio
il 1b Il 1b, supplied by Boster Bio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il1b/Anti-IL1+beta+Antibody/10__1016_slash_j__jksus__2022__102392-61-11-28 Average 93 stars, based on 1 article reviews
il 1b - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Beijing Solarbio Science
recombinant human il1b Recombinant Human Il1b, supplied by Beijing Solarbio Science, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il1b/Recombinant+Human+IL1B/pmc12497865-54-33-36 Average 93 stars, based on 1 article reviews
recombinant human il1b - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp il1b hs00174097 m1 Gene Exp Il1b Hs00174097 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il1b/Gene+Exp%2E+IL1B%2C+Hs00174097_m1/pm41898728-261-47-72 Average 99 stars, based on 1 article reviews
gene exp il1b hs00174097 m1 - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp il1b mm01336189 m1 Gene Exp Il1b Mm01336189 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il1b/Gene+Exp%2E+Il1b%2C+Mm01336189_m1/bio_rxiv__64898__2026__03__02__709037-38-22-10 Average 99 stars, based on 1 article reviews
gene exp il1b mm01336189 m1 - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp il1b mm00434228 m1 Gene Exp Il1b Mm00434228 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il1b/Gene+Exp%2E+Il1b%2C+Mm00434228_m1/pm34591647-107-21--1 Average 99 stars, based on 1 article reviews
gene exp il1b mm00434228 m1 - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Miltenyi Biotec
apc anti il 1b Apc Anti Il 1b, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il1b/IL-1%CE%B2+Antibody%2C+anti-human%2C+REAfinity/pm37822935-234-42-46 Average 93 stars, based on 1 article reviews
apc anti il 1b - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
OriGene
primers Primers, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il1b/IL1+beta+(IL1B)+(NM_000576)+Human+Untagged+Clone/pm23226286-134-43-37 Average 90 stars, based on 1 article reviews
primers - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
OriGene
interleukin 1β antibody ta506440 Interleukin 1β Antibody Ta506440, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il1b/IL1+beta+(IL1B)+Mouse+Monoclonal+Antibody/pmc12080364-54-81-84 Average 93 stars, based on 1 article reviews
interleukin 1β antibody ta506440 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
OriGene
unique 27mer sirna duplex targeting il1b transcripts ![]() Unique 27mer Sirna Duplex Targeting Il1b Transcripts, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il1b/IL1+beta+(IL1B)+Human+siRNA+Oligo+Duplex/10__1158_slash_1541___7786__mcr___19___0540-134-49-56 Average 90 stars, based on 1 article reviews
unique 27mer sirna duplex targeting il1b transcripts - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Kingfisher Biotech
recombinant bovine il 1β ![]() Recombinant Bovine Il 1β, supplied by Kingfisher Biotech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il1b/Bovine+IL-1+beta+Recombinant+Protein/pmc12580949-76-41-44 Average 94 stars, based on 1 article reviews
recombinant bovine il 1β - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Molecular Cancer Research
Article Title: Prostate Tumor Cell–Derived IL1β Induces an Inflammatory Phenotype in Bone Marrow Adipocytes and Reduces Sensitivity to Docetaxel via Lipolysis-Dependent Mechanisms
doi: 10.1158/1541-7786.mcr-19-0540
Figure Lengend Snippet: Figure 3. Adipocyte–tumor cell cross-talk: IL1b expression and secretion by prostate carcinoma cells augments COX-2 signaling in adipocytes. PC3 (A–C) and ARCaP(M) cells (D–F) were grown alone or in Transwell coculture with bone marrow adipocytes. TaqMan RT-PCR results show highly induced mRNA levels of IL1b in PC3 (A) and ARCaP(M) cells (D); graph representative of multiple experiments. Immunoblot analyses depicting increased levels of IL1b (1:1,000) protein in PC3 (B) and ARCaP(M) cells (E). Tubulin (1:2000) shown for equal loading control. C and F, ELISA assay results depicting levels of IL1b secreted by PC3 cells (C) or ARCaP(M) cells (F) grown alone or in Transwell with adipocytes. G, COX-2 protein levels in the absence or presence of recombinant IL1RA (200 ng/mL). H, Densitometry of COX-2 bands normalized to actin bands; data represent the mean of three experiments I, COX-2 gene expression in bone marrow adipocytes grown alone or in Transwell with ARCaP(M) cells in the absence or presence of IL1RA; J, siRNA-mediated IL1b knockdown in ARCaP(M) cells reduces COX-2 gene-expression levels in marrow adipocytes grown in Transwell cultures with ARCaP(M) cells as compared with cells transfected with scrambled control; K, mPGES mRNA levels in marrow adipocytes treated with IL1RA; L, mPGES gene expression in adipocytes upon siRNA-mediated knockdown of IL1b in tumor cells; mRNA levels of COX-2 (M) and mPEGS (N) in marrow adipocytes treated with recombinant IL1b. O, p65(NFkB) immunofluorescence in bone marrow adipocytes grown under control conditions or treated with recombinant IL1b. NFkB activation is demonstrated by the nuclear p65 staining in response to IL1b. P, Marrow adipocytes grown in Transwell with ARCaP(M) cells. Reduced nuclear p65 upon treatment with NFkB inhibitor BAY 11-0782. , P < 0.05; , P < 0.01; , P < 0.0001.
Article Snippet: Adipocyte cultures werefixedwith 3.7% formaldehyde, stained with NFkB (p65) antibody (Cell Signaling Technology; #8242), and imaged on a Zeiss LSM 780 confocal microscope with a 40 water immersion objective. siRNA approaches For gene-expression analyses, PC3 or ARCaP(M) cells were plated in 6-well plates or onTranswellfilters and grownovernight, then a
Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot, Control, Enzyme-linked Immunosorbent Assay, Recombinant, Gene Expression, Knockdown, Transfection, Activation Assay, Staining
Journal: Molecular Cancer Research
Article Title: Prostate Tumor Cell–Derived IL1β Induces an Inflammatory Phenotype in Bone Marrow Adipocytes and Reduces Sensitivity to Docetaxel via Lipolysis-Dependent Mechanisms
doi: 10.1158/1541-7786.mcr-19-0540
Figure Lengend Snippet: Figure 4. IL1b expression in PC3 cells and COX-2 levels in adipocytes are modulated by lipolysis. A, Protein levels of IL1b in PC3 cells cultured alone or in Transwell with adipocytes in the absence or presence of lipolysis-inducing agent isoproterenol; representative blot is shown; B, IL1b densitometry normalized to b-actin; data represent the mean from 3 experiments; C, IL1b gene expression in PC3 cells upon treatment with isoproterenol; D, Protein levels of IL1b in PC3 cells cultured alone or in Transwell with adipocytes in the absence or presence of lipolysis-inducing agent Forskolin; representative blot is shown; E, IL1b densitometry normalized to tubulin; data represent the mean from three experiments; F, IL1b gene expression in PC3 cells upon treatment with Forskolin; G, IL1b gene expression in PC3 cells grown in Transwell cocultures with adipocytes in the absence or presence of 5 mmol/L inhibitor of hormone-sensitive lipase BAY59-9435 (BAY). H, COX-2 mRNA levels in marrow adipocytes cultured alone or in Transwell with PC3 cells in the absence or presence of Forskolin; three individual experiments are shown. I, COX-2 mRNA levels in marrow adipocytes grown in Transwell with PC3 cells and in the absence or presence of 5 mmol/L BAY. J, Gene expression of HSL and ATGL and free glycerol release (K) by adipocytes upon treatment with recombinant IL1b. , P < 0.05; , P < 0.01; , P < 0.001.
Article Snippet: Adipocyte cultures werefixedwith 3.7% formaldehyde, stained with NFkB (p65) antibody (Cell Signaling Technology; #8242), and imaged on a Zeiss LSM 780 confocal microscope with a 40 water immersion objective. siRNA approaches For gene-expression analyses, PC3 or ARCaP(M) cells were plated in 6-well plates or onTranswellfilters and grownovernight, then a
Techniques: Expressing, Cell Culture, Gene Expression, Recombinant
Journal: Molecular Cancer Research
Article Title: Prostate Tumor Cell–Derived IL1β Induces an Inflammatory Phenotype in Bone Marrow Adipocytes and Reduces Sensitivity to Docetaxel via Lipolysis-Dependent Mechanisms
doi: 10.1158/1541-7786.mcr-19-0540
Figure Lengend Snippet: Figure 5. IL1b silencing and inhibition of lipolysis sensitize ARCaP(M) spheroids to docetaxel treatment. A, IL1b mRNA levels in ARCaP(M) cells upon treatment with two nonoverlapping siRNAs. B–G, DIC tile images of 3D ARCaP(M) spheroids treated with scrambled control or IL1b siRNA A and C and grown in the absence (B, D, F) or presence (C, E, G) of 10 nmol/L DCTx. IL1b siRNA A and C have a visibly significant effect on spheroid size in the presence of DCTx. H–M, Live/Dead assay of control and IL1b silenced 3D cultures treated with vehicle (H, J, L) or 10 nmol/L DCTx (I, K, M). Green: Calcein AM–positive live cells; red: ethidium homodimer– positive dead cells; N, Quantification of spheroid volume in ARCaP(M) cells treated with scrambled control or IL1b siRNA in the absence or presence of DCTx O, Quantification of ethidium–positive (dead) cells/total spheroid volume shown as percent control; P, 3D images from Live/Dead assay on 3D cultures of ARCaP (M) cells grown in culture with adipocytes and exposed to HSL and ATGL inhibitors; R, Quantification of spheroid volume upon treatment with HSL inhibitor BAY59-9435 and ATGL inhibitor, Atglistatin; S, Quantification of ethidium–positive (dead) cells/total spheroid volume shown as percent control; T, 3D images from Live/Dead assay on 3D cultures of ARCaP(M) cells grown in culture with adipocytes and exposed to 10 nmol/L DCTx in the absence or presence of HSL and ATGL inhibitors; U, Quantification of total 3D spheroid volume in response to treatment. , P < 0.05; , P < 0.01; , P < 0.001.
Article Snippet: Adipocyte cultures werefixedwith 3.7% formaldehyde, stained with NFkB (p65) antibody (Cell Signaling Technology; #8242), and imaged on a Zeiss LSM 780 confocal microscope with a 40 water immersion objective. siRNA approaches For gene-expression analyses, PC3 or ARCaP(M) cells were plated in 6-well plates or onTranswellfilters and grownovernight, then a
Techniques: Inhibition, Control, Live Dead Assay
Journal: Molecular Cancer Research
Article Title: Prostate Tumor Cell–Derived IL1β Induces an Inflammatory Phenotype in Bone Marrow Adipocytes and Reduces Sensitivity to Docetaxel via Lipolysis-Dependent Mechanisms
doi: 10.1158/1541-7786.mcr-19-0540
Figure Lengend Snippet: Figure 6. COX-2 levels in adipocytes and IL1b levels in prostate cancer cells are sensitive to hypoxia. A, Gene expression of IL1b in PC3 cells cultured alone or in Transwell with adipocytes under normoxic or hypoxic conditions; B, IL1b protein levels in PC3 cells cultured alone or in Transwell and in the absence or presence of 5 mmol/L HIF1a inhibitor CAY10585; representative blot is shown; C, IL1b densitometry normalized to tubulin; data represent the mean SD from 3 separate experiments; D, IL1b gene expression in PC3 cells grown in Transwell cultures in the absence or presence of 5 mmol/L CAY10585. Gene expression of GLUT1 (E), HIF1a (F), and COX-2 (G) in bone marrow adipocytes cultured alone or in Transwell with PC3 cells under normoxic (21% O2) or hypoxic (1% O2) conditions. Data are shown as the mean of three biological replicate experiments. Gene expression of GLUT1 (H) and HIF1a (I) of adipocytes upon treatment with recombinant IL1b. Gene expression of GLUT1 (J) and HIF1a (K) of adipocytes upon treatment with media conditioned by prostate cancer cells; SD. , P < 0.05; , P < 0.01; n.s., not significant.
Article Snippet: Adipocyte cultures werefixedwith 3.7% formaldehyde, stained with NFkB (p65) antibody (Cell Signaling Technology; #8242), and imaged on a Zeiss LSM 780 confocal microscope with a 40 water immersion objective. siRNA approaches For gene-expression analyses, PC3 or ARCaP(M) cells were plated in 6-well plates or onTranswellfilters and grownovernight, then a
Techniques: Gene Expression, Cell Culture, Recombinant
Journal: Molecular Cancer Research
Article Title: Prostate Tumor Cell–Derived IL1β Induces an Inflammatory Phenotype in Bone Marrow Adipocytes and Reduces Sensitivity to Docetaxel via Lipolysis-Dependent Mechanisms
doi: 10.1158/1541-7786.mcr-19-0540
Figure Lengend Snippet: Figure 7. Downstream targets of PGE2 signaling are induced upon prostate cancer–marrow adipocyte cross-talk. A, Gene-expression analysis of VEGF, Cyclin D, and PPARD in PC3 cells cultured alone or in Transwell coculture with adipocytes; B, Oncomine gene analysis comparing the expression of prostaglandin/EP receptor target genes (VEGF, MYC, PPARD, and CCND1) in patient samples collected from metastatic or primary sites. Data were ordered by "overexpression," and the threshold was adjusted to P < 1E4; fold change, 2 and gene rank, top 10%. C, Immunoblot analysis of p-GSK-3b (1:1,000), GSK-3b (1:1,000), p-b-catenin (1:1,000), b-catenin (1:1,000), and Cyclin D (1:1,000) proteins in PC3 cells grown alone or in Transwell with adipocytes. D, Proposed mechanism of adipocyte–tumor cell cross-talk involving the IL1b/COX-2/MCP-1 axis. Tumor cells stimulate adipocyte lipolysis. Lipolysis-mediated increase in IL1b and COX-2 levels and augmented production of PGE2 lead to prosurvival effects on the tumor and therapy resistance.
Article Snippet: Adipocyte cultures werefixedwith 3.7% formaldehyde, stained with NFkB (p65) antibody (Cell Signaling Technology; #8242), and imaged on a Zeiss LSM 780 confocal microscope with a 40 water immersion objective. siRNA approaches For gene-expression analyses, PC3 or ARCaP(M) cells were plated in 6-well plates or onTranswellfilters and grownovernight, then a
Techniques: Gene Expression, Cell Culture, Expressing, Over Expression, Western Blot