igf2 levels Search Results


94
R&D Systems quantikine elisa kit
IGF-II overexpression promotes cardiomyocyte maturation in vivo. ESC- and PSC-derived cardiomyocytes at 1 × 10 5 cells/recipient mouse were injected into the heart at 1 week after acute myocardial infarction (MI). The IGF-II and VEGF levels in the injection sites ( a ) and the serum ( b ) were measured by <t>ELISA</t> at 4 weeks post-transplant. Data are expressed as the mean ± SD. * p < 0.05 vs. any other group. n = 12. c Immunofluorescence staining was performed to observe the cardiomyocyte morphology and to detect α-actinin expression (red staining) in the injection sites at 4 weeks post-transplant. Blue staining, Hoechst 33342. Green staining, eGFP. Scale bars, 10 μm
Quantikine Elisa Kit, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/quantikine elisa kit/product/R&D Systems
Average 94 stars, based on 1 article reviews
quantikine elisa kit - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

95
Thermo Fisher gene exp h19 hs00262142 g1
Primer sequences for methylation-specific PCR.
Gene Exp H19 Hs00262142 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp h19 hs00262142 g1/product/Thermo Fisher
Average 95 stars, based on 1 article reviews
gene exp h19 hs00262142 g1 - by Bioz Stars, 2026-04
95/100 stars
  Buy from Supplier

93
Cusabio igf2 levels
Figure 4. <t>IGF2</t> was experimentally demonstrated as a direct target of miR-615-5p in pancreatic cancer cells. (a) Putative miR-615-5p-binding sequences in IGF2 3′-UTR and a schematic diagram of the reporter constructs showing the IGF2 3′-UTR sequence (IGF2_WT) and the mutated IGF2 3′-UTR sequence (IGF2_MUT; the mutant nucleotides of the miR-615-5p-binding site are underlined). (b) The IGF2_WT reporter or the IGF2_MUT reporter was co-transfected with the Renilla luciferase reporter into BXPC-3 and SW1990 cells containing either the miR-615-5p mimic or the negative control. Luciferase activity was assayed 48 h after transfection. (c) The expression of IGF2 mRNA was measured by real-time PCR in BXPC-3 and SW1990 cells 48 h after transfection. Beta-actin was used as a housekeeping gene control. (d) IGF2 protein levels in BXPC-3 and SW1990 cell supernatants were detected by ELISA 48 h after transfection. (e) IGF2 protein in BXPC-3 and SW1990 cells was detected by western blot 48 h post transfection. GAPDH was used as a housekeeping protein control. A grayscale analysis of the western blot data is shown.
Igf2 Levels, supplied by Cusabio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/igf2 levels/product/Cusabio
Average 93 stars, based on 1 article reviews
igf2 levels - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

88
Cusabio igf2
Let-7b has an enhanced inhibitory effect on IGF2BP3 expression in dwarf myoblast than in normal myoblast. (A) Desmin immunostaining of primary myoblast. (B) Relative let-7b expression in normal and dwarf myoblasts after transfection of let-7b mimic or NC mimic. (C) Relative mRNA expression after transfection of let-7b mimic or NC mimic in myoblast isolated from normal chicken. (D) Relative mRNA expression after transfection of let-7b mimic or NC mimic in myoblast isolated from dwarf chicken. (E) Relative IGF2BP3 protein expression in normal and dwarf myoblast after transfection of let-7b mimic or NC mimic. (F) <t>ELISA</t> analyzes of <t>IGF2</t> protein expression in normal and dwarf myoblast after transfection of let-7b mimic or NC mimic. (G) Relative mRNA expression after transfection of let-7b inhibitor or NC inhibitor in myoblast isolated from normal chicken. (H) Relative mRNA expression after transfection of let-7b inhibitor or NC inhibitor in myoblast isolated from dwarf chicken. (I) Relative IGF2BP3 protein expression in normal and dwarf myoblast after transfection of let-7b inhibitor or NC inhibitor. (J) Relative luciferase activity of dwarf and normal myoblasts transfected with let-7b mimics and pmirGLO-IGF2BP3-3′UTR. Data were displayed as normalized fold change in relative luciferase activity (Firefly luciferase/Renilla luciferase, relative value of NC group in normal myoblast was set as 1). The data in (B–D,F–H,J) are mean ± S.E.M. with three cultures per group, and three wells per culture were assayed ( n = 9/treatment group). The data in (E,I) are mean ± S.E.M. from three independent experiments done in duplicate ( n = 6/treatment group). For (B–I) , independent sample t -test was used to analyze the statistical differences between groups. * p < 0.05; ** p < 0.01. For (F,J) , different letters above the bars indicate significant differences ( p < 0.05) by using the Duncan's Multiple Range Test, at the p < 0.05 significance level.
Igf2, supplied by Cusabio, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/igf2/product/Cusabio
Average 88 stars, based on 1 article reviews
igf2 - by Bioz Stars, 2026-04
88/100 stars
  Buy from Supplier

90
Quest Diagnostics serum igf-2
Let-7b has an enhanced inhibitory effect on IGF2BP3 expression in dwarf myoblast than in normal myoblast. (A) Desmin immunostaining of primary myoblast. (B) Relative let-7b expression in normal and dwarf myoblasts after transfection of let-7b mimic or NC mimic. (C) Relative mRNA expression after transfection of let-7b mimic or NC mimic in myoblast isolated from normal chicken. (D) Relative mRNA expression after transfection of let-7b mimic or NC mimic in myoblast isolated from dwarf chicken. (E) Relative IGF2BP3 protein expression in normal and dwarf myoblast after transfection of let-7b mimic or NC mimic. (F) <t>ELISA</t> analyzes of <t>IGF2</t> protein expression in normal and dwarf myoblast after transfection of let-7b mimic or NC mimic. (G) Relative mRNA expression after transfection of let-7b inhibitor or NC inhibitor in myoblast isolated from normal chicken. (H) Relative mRNA expression after transfection of let-7b inhibitor or NC inhibitor in myoblast isolated from dwarf chicken. (I) Relative IGF2BP3 protein expression in normal and dwarf myoblast after transfection of let-7b inhibitor or NC inhibitor. (J) Relative luciferase activity of dwarf and normal myoblasts transfected with let-7b mimics and pmirGLO-IGF2BP3-3′UTR. Data were displayed as normalized fold change in relative luciferase activity (Firefly luciferase/Renilla luciferase, relative value of NC group in normal myoblast was set as 1). The data in (B–D,F–H,J) are mean ± S.E.M. with three cultures per group, and three wells per culture were assayed ( n = 9/treatment group). The data in (E,I) are mean ± S.E.M. from three independent experiments done in duplicate ( n = 6/treatment group). For (B–I) , independent sample t -test was used to analyze the statistical differences between groups. * p < 0.05; ** p < 0.01. For (F,J) , different letters above the bars indicate significant differences ( p < 0.05) by using the Duncan's Multiple Range Test, at the p < 0.05 significance level.
Serum Igf 2, supplied by Quest Diagnostics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/serum igf-2/product/Quest Diagnostics
Average 90 stars, based on 1 article reviews
serum igf-2 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GroPep Bioreagents protocol #3002
Let-7b has an enhanced inhibitory effect on IGF2BP3 expression in dwarf myoblast than in normal myoblast. (A) Desmin immunostaining of primary myoblast. (B) Relative let-7b expression in normal and dwarf myoblasts after transfection of let-7b mimic or NC mimic. (C) Relative mRNA expression after transfection of let-7b mimic or NC mimic in myoblast isolated from normal chicken. (D) Relative mRNA expression after transfection of let-7b mimic or NC mimic in myoblast isolated from dwarf chicken. (E) Relative IGF2BP3 protein expression in normal and dwarf myoblast after transfection of let-7b mimic or NC mimic. (F) <t>ELISA</t> analyzes of <t>IGF2</t> protein expression in normal and dwarf myoblast after transfection of let-7b mimic or NC mimic. (G) Relative mRNA expression after transfection of let-7b inhibitor or NC inhibitor in myoblast isolated from normal chicken. (H) Relative mRNA expression after transfection of let-7b inhibitor or NC inhibitor in myoblast isolated from dwarf chicken. (I) Relative IGF2BP3 protein expression in normal and dwarf myoblast after transfection of let-7b inhibitor or NC inhibitor. (J) Relative luciferase activity of dwarf and normal myoblasts transfected with let-7b mimics and pmirGLO-IGF2BP3-3′UTR. Data were displayed as normalized fold change in relative luciferase activity (Firefly luciferase/Renilla luciferase, relative value of NC group in normal myoblast was set as 1). The data in (B–D,F–H,J) are mean ± S.E.M. with three cultures per group, and three wells per culture were assayed ( n = 9/treatment group). The data in (E,I) are mean ± S.E.M. from three independent experiments done in duplicate ( n = 6/treatment group). For (B–I) , independent sample t -test was used to analyze the statistical differences between groups. * p < 0.05; ** p < 0.01. For (F,J) , different letters above the bars indicate significant differences ( p < 0.05) by using the Duncan's Multiple Range Test, at the p < 0.05 significance level.
Protocol #3002, supplied by GroPep Bioreagents, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/protocol #3002/product/GroPep Bioreagents
Average 90 stars, based on 1 article reviews
protocol #3002 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Inserm Transfert mannose-6-phosphate/insulin-like growth factor 2 receptor (m6p/igf2-r)
Let-7b has an enhanced inhibitory effect on IGF2BP3 expression in dwarf myoblast than in normal myoblast. (A) Desmin immunostaining of primary myoblast. (B) Relative let-7b expression in normal and dwarf myoblasts after transfection of let-7b mimic or NC mimic. (C) Relative mRNA expression after transfection of let-7b mimic or NC mimic in myoblast isolated from normal chicken. (D) Relative mRNA expression after transfection of let-7b mimic or NC mimic in myoblast isolated from dwarf chicken. (E) Relative IGF2BP3 protein expression in normal and dwarf myoblast after transfection of let-7b mimic or NC mimic. (F) <t>ELISA</t> analyzes of <t>IGF2</t> protein expression in normal and dwarf myoblast after transfection of let-7b mimic or NC mimic. (G) Relative mRNA expression after transfection of let-7b inhibitor or NC inhibitor in myoblast isolated from normal chicken. (H) Relative mRNA expression after transfection of let-7b inhibitor or NC inhibitor in myoblast isolated from dwarf chicken. (I) Relative IGF2BP3 protein expression in normal and dwarf myoblast after transfection of let-7b inhibitor or NC inhibitor. (J) Relative luciferase activity of dwarf and normal myoblasts transfected with let-7b mimics and pmirGLO-IGF2BP3-3′UTR. Data were displayed as normalized fold change in relative luciferase activity (Firefly luciferase/Renilla luciferase, relative value of NC group in normal myoblast was set as 1). The data in (B–D,F–H,J) are mean ± S.E.M. with three cultures per group, and three wells per culture were assayed ( n = 9/treatment group). The data in (E,I) are mean ± S.E.M. from three independent experiments done in duplicate ( n = 6/treatment group). For (B–I) , independent sample t -test was used to analyze the statistical differences between groups. * p < 0.05; ** p < 0.01. For (F,J) , different letters above the bars indicate significant differences ( p < 0.05) by using the Duncan's Multiple Range Test, at the p < 0.05 significance level.
Mannose 6 Phosphate/Insulin Like Growth Factor 2 Receptor (M6p/Igf2 R), supplied by Inserm Transfert, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mannose-6-phosphate/insulin-like growth factor 2 receptor (m6p/igf2-r)/product/Inserm Transfert
Average 90 stars, based on 1 article reviews
mannose-6-phosphate/insulin-like growth factor 2 receptor (m6p/igf2-r) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc prism 5.0 software
Let-7b has an enhanced inhibitory effect on IGF2BP3 expression in dwarf myoblast than in normal myoblast. (A) Desmin immunostaining of primary myoblast. (B) Relative let-7b expression in normal and dwarf myoblasts after transfection of let-7b mimic or NC mimic. (C) Relative mRNA expression after transfection of let-7b mimic or NC mimic in myoblast isolated from normal chicken. (D) Relative mRNA expression after transfection of let-7b mimic or NC mimic in myoblast isolated from dwarf chicken. (E) Relative IGF2BP3 protein expression in normal and dwarf myoblast after transfection of let-7b mimic or NC mimic. (F) <t>ELISA</t> analyzes of <t>IGF2</t> protein expression in normal and dwarf myoblast after transfection of let-7b mimic or NC mimic. (G) Relative mRNA expression after transfection of let-7b inhibitor or NC inhibitor in myoblast isolated from normal chicken. (H) Relative mRNA expression after transfection of let-7b inhibitor or NC inhibitor in myoblast isolated from dwarf chicken. (I) Relative IGF2BP3 protein expression in normal and dwarf myoblast after transfection of let-7b inhibitor or NC inhibitor. (J) Relative luciferase activity of dwarf and normal myoblasts transfected with let-7b mimics and pmirGLO-IGF2BP3-3′UTR. Data were displayed as normalized fold change in relative luciferase activity (Firefly luciferase/Renilla luciferase, relative value of NC group in normal myoblast was set as 1). The data in (B–D,F–H,J) are mean ± S.E.M. with three cultures per group, and three wells per culture were assayed ( n = 9/treatment group). The data in (E,I) are mean ± S.E.M. from three independent experiments done in duplicate ( n = 6/treatment group). For (B–I) , independent sample t -test was used to analyze the statistical differences between groups. * p < 0.05; ** p < 0.01. For (F,J) , different letters above the bars indicate significant differences ( p < 0.05) by using the Duncan's Multiple Range Test, at the p < 0.05 significance level.
Prism 5.0 Software, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prism 5.0 software/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
prism 5.0 software - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

93
Thermo Fisher gene exp ins igf2 hs01005963 m1
Summary of EWS-FLI1 network analysis
Gene Exp Ins Igf2 Hs01005963 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp ins igf2 hs01005963 m1/product/Thermo Fisher
Average 93 stars, based on 1 article reviews
gene exp ins igf2 hs01005963 m1 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

91
Boster Bio serum igf2 levels
Placentas were collected from gestation days (GD) 15 and 18 Ascl1 fl/fl and hep-Ascl1 -/- mice. (A) Frozen placental sections underwent periodic acid-Schiff (PAS) staining. Glycogen is stained red to purple. (B) Frozen placental sections were subjected to PL-I and PL-II in situ hybridization staining using RNAscope 2.5 HD Assay-BROWN kit. The PL-I and PL-II mRNAs are stained dark brown. (C) Quantification of relative intensity of Western blotting signals from . Data are presented as the mean fold changes relative to GD15 Ascl1 fl/fl mice (± SD; n = 3 for each group). *, P < 0.05, between Ascl1 fl/fl and hep-Ascl1 -/- mice. AKT, total protein kinase B; Ascl1 , achaete-scute homolog 1; ERK1/2, extracellular signal-regulated kinase 1/2; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; <t>IGF2,</t> insulin-like growth factor; PL-II, placental lactogen II.
Serum Igf2 Levels, supplied by Boster Bio, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/serum igf2 levels/product/Boster Bio
Average 91 stars, based on 1 article reviews
serum igf2 levels - by Bioz Stars, 2026-04
91/100 stars
  Buy from Supplier

86
Thermo Fisher gene exp igf2 mm00439565 g1
Placentas were collected from gestation days (GD) 15 and 18 Ascl1 fl/fl and hep-Ascl1 -/- mice. (A) Frozen placental sections underwent periodic acid-Schiff (PAS) staining. Glycogen is stained red to purple. (B) Frozen placental sections were subjected to PL-I and PL-II in situ hybridization staining using RNAscope 2.5 HD Assay-BROWN kit. The PL-I and PL-II mRNAs are stained dark brown. (C) Quantification of relative intensity of Western blotting signals from . Data are presented as the mean fold changes relative to GD15 Ascl1 fl/fl mice (± SD; n = 3 for each group). *, P < 0.05, between Ascl1 fl/fl and hep-Ascl1 -/- mice. AKT, total protein kinase B; Ascl1 , achaete-scute homolog 1; ERK1/2, extracellular signal-regulated kinase 1/2; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; <t>IGF2,</t> insulin-like growth factor; PL-II, placental lactogen II.
Gene Exp Igf2 Mm00439565 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp igf2 mm00439565 g1/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
gene exp igf2 mm00439565 g1 - by Bioz Stars, 2026-04
86/100 stars
  Buy from Supplier

90
Thermo Fisher prism 7000
Placentas were collected from gestation days (GD) 15 and 18 Ascl1 fl/fl and hep-Ascl1 -/- mice. (A) Frozen placental sections underwent periodic acid-Schiff (PAS) staining. Glycogen is stained red to purple. (B) Frozen placental sections were subjected to PL-I and PL-II in situ hybridization staining using RNAscope 2.5 HD Assay-BROWN kit. The PL-I and PL-II mRNAs are stained dark brown. (C) Quantification of relative intensity of Western blotting signals from . Data are presented as the mean fold changes relative to GD15 Ascl1 fl/fl mice (± SD; n = 3 for each group). *, P < 0.05, between Ascl1 fl/fl and hep-Ascl1 -/- mice. AKT, total protein kinase B; Ascl1 , achaete-scute homolog 1; ERK1/2, extracellular signal-regulated kinase 1/2; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; <t>IGF2,</t> insulin-like growth factor; PL-II, placental lactogen II.
Prism 7000, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prism 7000/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
prism 7000 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


IGF-II overexpression promotes cardiomyocyte maturation in vivo. ESC- and PSC-derived cardiomyocytes at 1 × 10 5 cells/recipient mouse were injected into the heart at 1 week after acute myocardial infarction (MI). The IGF-II and VEGF levels in the injection sites ( a ) and the serum ( b ) were measured by ELISA at 4 weeks post-transplant. Data are expressed as the mean ± SD. * p < 0.05 vs. any other group. n = 12. c Immunofluorescence staining was performed to observe the cardiomyocyte morphology and to detect α-actinin expression (red staining) in the injection sites at 4 weeks post-transplant. Blue staining, Hoechst 33342. Green staining, eGFP. Scale bars, 10 μm

Journal: Stem Cell Research & Therapy

Article Title: Insulin-like growth factor-II overexpression accelerates parthenogenetic stem cell differentiation into cardiomyocytes and improves cardiac function after acute myocardial infarction in mice

doi: 10.1186/s13287-020-1575-4

Figure Lengend Snippet: IGF-II overexpression promotes cardiomyocyte maturation in vivo. ESC- and PSC-derived cardiomyocytes at 1 × 10 5 cells/recipient mouse were injected into the heart at 1 week after acute myocardial infarction (MI). The IGF-II and VEGF levels in the injection sites ( a ) and the serum ( b ) were measured by ELISA at 4 weeks post-transplant. Data are expressed as the mean ± SD. * p < 0.05 vs. any other group. n = 12. c Immunofluorescence staining was performed to observe the cardiomyocyte morphology and to detect α-actinin expression (red staining) in the injection sites at 4 weeks post-transplant. Blue staining, Hoechst 33342. Green staining, eGFP. Scale bars, 10 μm

Article Snippet: IGF-II levels in serum (Quantikine ELISA Kit, cat# MG200, R&D Systems, Minneapolis, MN, USA), heart tissue (DuoSet ELISA, cat# DY792, R&D Systems), vascular endothelial growth factor (VEGF) levels in serum (cat# ab100751; Abcam), and heart tissue (cat# ab209882; Abcam) were determined with ELISA kits following the manufacturer’s instructions.

Techniques: Over Expression, In Vivo, Derivative Assay, Injection, Enzyme-linked Immunosorbent Assay, Immunofluorescence, Staining, Expressing

Primer sequences for methylation-specific PCR.

Journal: Endocrine Connections

Article Title: 3-M syndrome: a growth disorder associated with IGF2 silencing

doi: 10.1530/EC-13-0065

Figure Lengend Snippet: Primer sequences for methylation-specific PCR.

Article Snippet: IGF2 and H19 mRNA levels were assessed using TaqMan assays (Hs01005963_m1 and Hs00262142_g1) with a cyclophyllin A probe (4333763T) for control gene expression.

Techniques: Methylation

Primer sequences for pyrosequencing.

Journal: Endocrine Connections

Article Title: 3-M syndrome: a growth disorder associated with IGF2 silencing

doi: 10.1530/EC-13-0065

Figure Lengend Snippet: Primer sequences for pyrosequencing.

Article Snippet: IGF2 and H19 mRNA levels were assessed using TaqMan assays (Hs01005963_m1 and Hs00262142_g1) with a cyclophyllin A probe (4333763T) for control gene expression.

Techniques: Methylation, Sequencing

Top 20 up- and downregulated probesets in the 3-M group as a whole and in each cell line by mutation.

Journal: Endocrine Connections

Article Title: 3-M syndrome: a growth disorder associated with IGF2 silencing

doi: 10.1530/EC-13-0065

Figure Lengend Snippet: Top 20 up- and downregulated probesets in the 3-M group as a whole and in each cell line by mutation.

Article Snippet: IGF2 and H19 mRNA levels were assessed using TaqMan assays (Hs01005963_m1 and Hs00262142_g1) with a cyclophyllin A probe (4333763T) for control gene expression.

Techniques: Mutagenesis

Relative fold expression of (A) IGF2 and (B) H19 measured using quantitative PCR in all 3-M cell lines. Expression of IGF2 is reduced while H19 is increased. * P <0.05.

Journal: Endocrine Connections

Article Title: 3-M syndrome: a growth disorder associated with IGF2 silencing

doi: 10.1530/EC-13-0065

Figure Lengend Snippet: Relative fold expression of (A) IGF2 and (B) H19 measured using quantitative PCR in all 3-M cell lines. Expression of IGF2 is reduced while H19 is increased. * P <0.05.

Article Snippet: IGF2 and H19 mRNA levels were assessed using TaqMan assays (Hs01005963_m1 and Hs00262142_g1) with a cyclophyllin A probe (4333763T) for control gene expression.

Techniques: Expressing, Real-time Polymerase Chain Reaction

Figure 4. IGF2 was experimentally demonstrated as a direct target of miR-615-5p in pancreatic cancer cells. (a) Putative miR-615-5p-binding sequences in IGF2 3′-UTR and a schematic diagram of the reporter constructs showing the IGF2 3′-UTR sequence (IGF2_WT) and the mutated IGF2 3′-UTR sequence (IGF2_MUT; the mutant nucleotides of the miR-615-5p-binding site are underlined). (b) The IGF2_WT reporter or the IGF2_MUT reporter was co-transfected with the Renilla luciferase reporter into BXPC-3 and SW1990 cells containing either the miR-615-5p mimic or the negative control. Luciferase activity was assayed 48 h after transfection. (c) The expression of IGF2 mRNA was measured by real-time PCR in BXPC-3 and SW1990 cells 48 h after transfection. Beta-actin was used as a housekeeping gene control. (d) IGF2 protein levels in BXPC-3 and SW1990 cell supernatants were detected by ELISA 48 h after transfection. (e) IGF2 protein in BXPC-3 and SW1990 cells was detected by western blot 48 h post transfection. GAPDH was used as a housekeeping protein control. A grayscale analysis of the western blot data is shown.

Journal: Oncogene

Article Title: miR-615-5p is epigenetically inactivated and functions as a tumor suppressor in pancreatic ductal adenocarcinoma.

doi: 10.1038/onc.2014.101

Figure Lengend Snippet: Figure 4. IGF2 was experimentally demonstrated as a direct target of miR-615-5p in pancreatic cancer cells. (a) Putative miR-615-5p-binding sequences in IGF2 3′-UTR and a schematic diagram of the reporter constructs showing the IGF2 3′-UTR sequence (IGF2_WT) and the mutated IGF2 3′-UTR sequence (IGF2_MUT; the mutant nucleotides of the miR-615-5p-binding site are underlined). (b) The IGF2_WT reporter or the IGF2_MUT reporter was co-transfected with the Renilla luciferase reporter into BXPC-3 and SW1990 cells containing either the miR-615-5p mimic or the negative control. Luciferase activity was assayed 48 h after transfection. (c) The expression of IGF2 mRNA was measured by real-time PCR in BXPC-3 and SW1990 cells 48 h after transfection. Beta-actin was used as a housekeeping gene control. (d) IGF2 protein levels in BXPC-3 and SW1990 cell supernatants were detected by ELISA 48 h after transfection. (e) IGF2 protein in BXPC-3 and SW1990 cells was detected by western blot 48 h post transfection. GAPDH was used as a housekeeping protein control. A grayscale analysis of the western blot data is shown.

Article Snippet: IGF2 levels in the BXPC-3 and SW1990 cell Oncogene (2015) 1629 – 1640 © 2015 Macmillan Publishers Limited supernatants were detected using a human IGF2 ELISA kit (Cusabio Biotech, Newark, DE, USA) according to the manufacturer’s instructions.

Techniques: Binding Assay, Construct, Sequencing, Mutagenesis, Transfection, Luciferase, Negative Control, Activity Assay, Expressing, Real-time Polymerase Chain Reaction, Control, Enzyme-linked Immunosorbent Assay, Western Blot

Figure 5. miR-615-5p suppressed pancreatic cancer cell proliferation by directly targeting IGF2. (a) Immunofluorescence. BXPC-3 and SW1990 cells were fixed and incubated with primary antibodies for IGF2 and then Alexa Fluor 488-conjugated anti-rabbit secondary antibodies. Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI). The fluorescence level of IGF2 was notably decreased in miR-615-5p-transfected cells. Magnification: × 400. (b) BXPC-3 and SW1990 cell proliferation was detected by the MTT assay at 0, 24, 48 and 72 h after co-transfection with different combinations of NC or MIMIC with GFP or IGF2. For NC+GFP vs MIMIC+GFP: *Po0.05; **Po0.01. For NC+GFP vs NC+IGF2: #Po0.05; ##Po0.01. For NC+IGF2 vs MIMIC+IGF2: △△Po0.01. (c) The IGF2 protein was detected by western blot at 48 h post-transfection. GAPDH was used as a housekeeping protein control. A grayscale analysis of the western blot data is shown.

Journal: Oncogene

Article Title: miR-615-5p is epigenetically inactivated and functions as a tumor suppressor in pancreatic ductal adenocarcinoma.

doi: 10.1038/onc.2014.101

Figure Lengend Snippet: Figure 5. miR-615-5p suppressed pancreatic cancer cell proliferation by directly targeting IGF2. (a) Immunofluorescence. BXPC-3 and SW1990 cells were fixed and incubated with primary antibodies for IGF2 and then Alexa Fluor 488-conjugated anti-rabbit secondary antibodies. Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI). The fluorescence level of IGF2 was notably decreased in miR-615-5p-transfected cells. Magnification: × 400. (b) BXPC-3 and SW1990 cell proliferation was detected by the MTT assay at 0, 24, 48 and 72 h after co-transfection with different combinations of NC or MIMIC with GFP or IGF2. For NC+GFP vs MIMIC+GFP: *Po0.05; **Po0.01. For NC+GFP vs NC+IGF2: #Po0.05; ##Po0.01. For NC+IGF2 vs MIMIC+IGF2: △△Po0.01. (c) The IGF2 protein was detected by western blot at 48 h post-transfection. GAPDH was used as a housekeeping protein control. A grayscale analysis of the western blot data is shown.

Article Snippet: IGF2 levels in the BXPC-3 and SW1990 cell Oncogene (2015) 1629 – 1640 © 2015 Macmillan Publishers Limited supernatants were detected using a human IGF2 ELISA kit (Cusabio Biotech, Newark, DE, USA) according to the manufacturer’s instructions.

Techniques: Incubation, Staining, Transfection, MTT Assay, Cotransfection, Western Blot, Control

Figure 6. Imprinting status and expression levels of IGF2. (a) Gel photo of ApaI-digested PCR products for IGF2 genotyping. The heterozygous samples had two bands, which were considered as informative. (b) Gel photo of ApaI-digested RT–PCR products for imprinting status analysis. The ratios between the two bands are listed. The samples with a ratio of o3:1 or >1:3 had LOI of IGF2. (c, e) Results of qRT–PCR analysis of IGF2 mRNA expression in the 32 pairs of tissues shown on a column chart and a scattergram. (d, f) qRT–PCR results of miR-615-5p expression levels in the 32 pairs of tissues shown on a column chart and a scattergram. (g) The inverse correlation between IGF2 and miR-615-5p expression levels was examined by Pearson’s correlation analysis (R = −0.456, P = 0.033).

Journal: Oncogene

Article Title: miR-615-5p is epigenetically inactivated and functions as a tumor suppressor in pancreatic ductal adenocarcinoma.

doi: 10.1038/onc.2014.101

Figure Lengend Snippet: Figure 6. Imprinting status and expression levels of IGF2. (a) Gel photo of ApaI-digested PCR products for IGF2 genotyping. The heterozygous samples had two bands, which were considered as informative. (b) Gel photo of ApaI-digested RT–PCR products for imprinting status analysis. The ratios between the two bands are listed. The samples with a ratio of o3:1 or >1:3 had LOI of IGF2. (c, e) Results of qRT–PCR analysis of IGF2 mRNA expression in the 32 pairs of tissues shown on a column chart and a scattergram. (d, f) qRT–PCR results of miR-615-5p expression levels in the 32 pairs of tissues shown on a column chart and a scattergram. (g) The inverse correlation between IGF2 and miR-615-5p expression levels was examined by Pearson’s correlation analysis (R = −0.456, P = 0.033).

Article Snippet: IGF2 levels in the BXPC-3 and SW1990 cell Oncogene (2015) 1629 – 1640 © 2015 Macmillan Publishers Limited supernatants were detected using a human IGF2 ELISA kit (Cusabio Biotech, Newark, DE, USA) according to the manufacturer’s instructions.

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR

Figure 7. The overexpression of miR-615-5p inhibited tumorigenicity in vivo. (a) The relative expression of miR-615-5p in the SW1990-vector group and the SW1990-mir-615 group was analyzed by qRT–PCR. (b, c) Photographs of tumors derived from the SW1990-vector group and the SW1990-mir-615 group of nude mice. (d, e) The graph is representative of tumor growth 25 days after inoculation. Tumor volume and weight were calculated, and all data are shown as mean ± s.d. (f) The expression of IGF2 was measured by immunohistochemistry in the tissues extracted from the SW1990-vector and SW1990-mir-615 nude mice. Magnification: × 40. (g) The percentage of IGF2-positive cells was calculated.

Journal: Oncogene

Article Title: miR-615-5p is epigenetically inactivated and functions as a tumor suppressor in pancreatic ductal adenocarcinoma.

doi: 10.1038/onc.2014.101

Figure Lengend Snippet: Figure 7. The overexpression of miR-615-5p inhibited tumorigenicity in vivo. (a) The relative expression of miR-615-5p in the SW1990-vector group and the SW1990-mir-615 group was analyzed by qRT–PCR. (b, c) Photographs of tumors derived from the SW1990-vector group and the SW1990-mir-615 group of nude mice. (d, e) The graph is representative of tumor growth 25 days after inoculation. Tumor volume and weight were calculated, and all data are shown as mean ± s.d. (f) The expression of IGF2 was measured by immunohistochemistry in the tissues extracted from the SW1990-vector and SW1990-mir-615 nude mice. Magnification: × 40. (g) The percentage of IGF2-positive cells was calculated.

Article Snippet: IGF2 levels in the BXPC-3 and SW1990 cell Oncogene (2015) 1629 – 1640 © 2015 Macmillan Publishers Limited supernatants were detected using a human IGF2 ELISA kit (Cusabio Biotech, Newark, DE, USA) according to the manufacturer’s instructions.

Techniques: Over Expression, In Vivo, Expressing, Plasmid Preparation, Quantitative RT-PCR, Derivative Assay, Immunohistochemistry

Let-7b has an enhanced inhibitory effect on IGF2BP3 expression in dwarf myoblast than in normal myoblast. (A) Desmin immunostaining of primary myoblast. (B) Relative let-7b expression in normal and dwarf myoblasts after transfection of let-7b mimic or NC mimic. (C) Relative mRNA expression after transfection of let-7b mimic or NC mimic in myoblast isolated from normal chicken. (D) Relative mRNA expression after transfection of let-7b mimic or NC mimic in myoblast isolated from dwarf chicken. (E) Relative IGF2BP3 protein expression in normal and dwarf myoblast after transfection of let-7b mimic or NC mimic. (F) ELISA analyzes of IGF2 protein expression in normal and dwarf myoblast after transfection of let-7b mimic or NC mimic. (G) Relative mRNA expression after transfection of let-7b inhibitor or NC inhibitor in myoblast isolated from normal chicken. (H) Relative mRNA expression after transfection of let-7b inhibitor or NC inhibitor in myoblast isolated from dwarf chicken. (I) Relative IGF2BP3 protein expression in normal and dwarf myoblast after transfection of let-7b inhibitor or NC inhibitor. (J) Relative luciferase activity of dwarf and normal myoblasts transfected with let-7b mimics and pmirGLO-IGF2BP3-3′UTR. Data were displayed as normalized fold change in relative luciferase activity (Firefly luciferase/Renilla luciferase, relative value of NC group in normal myoblast was set as 1). The data in (B–D,F–H,J) are mean ± S.E.M. with three cultures per group, and three wells per culture were assayed ( n = 9/treatment group). The data in (E,I) are mean ± S.E.M. from three independent experiments done in duplicate ( n = 6/treatment group). For (B–I) , independent sample t -test was used to analyze the statistical differences between groups. * p < 0.05; ** p < 0.01. For (F,J) , different letters above the bars indicate significant differences ( p < 0.05) by using the Duncan's Multiple Range Test, at the p < 0.05 significance level.

Journal: Frontiers in Physiology

Article Title: Let-7b Regulates Myoblast Proliferation by Inhibiting IGF2BP3 Expression in Dwarf and Normal Chicken

doi: 10.3389/fphys.2017.00477

Figure Lengend Snippet: Let-7b has an enhanced inhibitory effect on IGF2BP3 expression in dwarf myoblast than in normal myoblast. (A) Desmin immunostaining of primary myoblast. (B) Relative let-7b expression in normal and dwarf myoblasts after transfection of let-7b mimic or NC mimic. (C) Relative mRNA expression after transfection of let-7b mimic or NC mimic in myoblast isolated from normal chicken. (D) Relative mRNA expression after transfection of let-7b mimic or NC mimic in myoblast isolated from dwarf chicken. (E) Relative IGF2BP3 protein expression in normal and dwarf myoblast after transfection of let-7b mimic or NC mimic. (F) ELISA analyzes of IGF2 protein expression in normal and dwarf myoblast after transfection of let-7b mimic or NC mimic. (G) Relative mRNA expression after transfection of let-7b inhibitor or NC inhibitor in myoblast isolated from normal chicken. (H) Relative mRNA expression after transfection of let-7b inhibitor or NC inhibitor in myoblast isolated from dwarf chicken. (I) Relative IGF2BP3 protein expression in normal and dwarf myoblast after transfection of let-7b inhibitor or NC inhibitor. (J) Relative luciferase activity of dwarf and normal myoblasts transfected with let-7b mimics and pmirGLO-IGF2BP3-3′UTR. Data were displayed as normalized fold change in relative luciferase activity (Firefly luciferase/Renilla luciferase, relative value of NC group in normal myoblast was set as 1). The data in (B–D,F–H,J) are mean ± S.E.M. with three cultures per group, and three wells per culture were assayed ( n = 9/treatment group). The data in (E,I) are mean ± S.E.M. from three independent experiments done in duplicate ( n = 6/treatment group). For (B–I) , independent sample t -test was used to analyze the statistical differences between groups. * p < 0.05; ** p < 0.01. For (F,J) , different letters above the bars indicate significant differences ( p < 0.05) by using the Duncan's Multiple Range Test, at the p < 0.05 significance level.

Article Snippet: The levels of IGF2 were determined using chicken IGF2 ELISA kit (CUSABIO BIOTECH Co. Ltd. China), following the manufacturer's instructions.

Techniques: Expressing, Immunostaining, Transfection, Isolation, Enzyme-linked Immunosorbent Assay, Luciferase, Activity Assay

Schematic illustration for signaling pathways of skeletal muscle growth regulated by let-7b. let-7b can inhibit skeletal muscle development through let-7b-IGF2BP3-IGF2 signaling pathway and let-7b-GHR-GHR downstream genes pathway in normal chicken. However, the large deletion mutation at the exon 10 and 3′UTR of GHR gene in dwarf chicken lead to disruption of let-7b binding site in GHR 3′UTR. In this case, let-7b would enhance its inhibition on IGF2BP3 expression. Therefore, let-7b inhibits skeletal muscle development only through let-7b-IGF2BP3-IGF2 signaling pathway with enhancing effect in dwarf chicken.

Journal: Frontiers in Physiology

Article Title: Let-7b Regulates Myoblast Proliferation by Inhibiting IGF2BP3 Expression in Dwarf and Normal Chicken

doi: 10.3389/fphys.2017.00477

Figure Lengend Snippet: Schematic illustration for signaling pathways of skeletal muscle growth regulated by let-7b. let-7b can inhibit skeletal muscle development through let-7b-IGF2BP3-IGF2 signaling pathway and let-7b-GHR-GHR downstream genes pathway in normal chicken. However, the large deletion mutation at the exon 10 and 3′UTR of GHR gene in dwarf chicken lead to disruption of let-7b binding site in GHR 3′UTR. In this case, let-7b would enhance its inhibition on IGF2BP3 expression. Therefore, let-7b inhibits skeletal muscle development only through let-7b-IGF2BP3-IGF2 signaling pathway with enhancing effect in dwarf chicken.

Article Snippet: The levels of IGF2 were determined using chicken IGF2 ELISA kit (CUSABIO BIOTECH Co. Ltd. China), following the manufacturer's instructions.

Techniques: Protein-Protein interactions, Mutagenesis, Disruption, Binding Assay, Inhibition, Expressing

Summary of EWS-FLI1 network analysis

Journal: BMC Systems Biology

Article Title: Localizing potentially active post-transcriptional regulations in the Ewing's sarcoma gene regulatory network

doi: 10.1186/1752-0509-4-146

Figure Lengend Snippet: Summary of EWS-FLI1 network analysis

Article Snippet: Levels of IGF2 mRNA (taqman Hs01005963_m1, Applied biosystems) and FASLG mRNA (forward primer: ggaaagtggcccatttaaca reverse primer: ccagaaagcaggacaattcc) were measured by real-time quantitative polymerase-chain reaction (RT-QPCR, normalized to RPLP0).

Techniques: Functional Assay, Migration

Representation of predictions in the network . This figure shows parts of the network where the predictions considered in the section 'Discussion' are located. It helps backtracking the source of each prediction. Part A . Predictions on TGFBR2 mRNA and protein are deduced from the observation on EWS-FLI1. The prediction about BCL2 mRNA is deduced from the prediction about IGFBP3, deduced from the prediction about the IGF1 protein which, in turn, is deduced from the observation on AKT1 mRNA. The prediction about the TP73 protein is deduced from the observation on PDGFRB mRNA and serves, together with the observation on CDKN1C mRNA, as a source of the prediction about the IGF2 protein and subsequently - about IGF2 mRNA. The prediction about the family of proteins (.RAS) is deduced from the prediction about the IGFBP3 protein and, together with the prediction about the IGF1 protein, is a source of the prediction on family of proteins (PIK3C.). Part B . Prediction about the JUN protein is deduced from the observation on JUN mRNA and serves as a source for the prediction about the TP53 mRNA. Prediction about the FASLG is a forward deduction from the observation on the FASLG mRNA. Part C . Prediction about the (RAC.) family of proteins is deduced as the only possible explanation of the combination of observations on (RHO.) mRNA family and the phenotypic node [Cell Migration]. Part D . Prediction on phosphorylation of RB1 is a forward deduction from the prediction on PRKCB1 which is deduced from the observation on PRKCB1 mRNA. Part E . The prediction about the CDC2 protein is a result of the correlated interactions of its precursors, predictions on complexes ((CCNA.)^ p:CDC2)) and (CCNB1^ p:CDC2).

Journal: BMC Systems Biology

Article Title: Localizing potentially active post-transcriptional regulations in the Ewing's sarcoma gene regulatory network

doi: 10.1186/1752-0509-4-146

Figure Lengend Snippet: Representation of predictions in the network . This figure shows parts of the network where the predictions considered in the section 'Discussion' are located. It helps backtracking the source of each prediction. Part A . Predictions on TGFBR2 mRNA and protein are deduced from the observation on EWS-FLI1. The prediction about BCL2 mRNA is deduced from the prediction about IGFBP3, deduced from the prediction about the IGF1 protein which, in turn, is deduced from the observation on AKT1 mRNA. The prediction about the TP73 protein is deduced from the observation on PDGFRB mRNA and serves, together with the observation on CDKN1C mRNA, as a source of the prediction about the IGF2 protein and subsequently - about IGF2 mRNA. The prediction about the family of proteins (.RAS) is deduced from the prediction about the IGFBP3 protein and, together with the prediction about the IGF1 protein, is a source of the prediction on family of proteins (PIK3C.). Part B . Prediction about the JUN protein is deduced from the observation on JUN mRNA and serves as a source for the prediction about the TP53 mRNA. Prediction about the FASLG is a forward deduction from the observation on the FASLG mRNA. Part C . Prediction about the (RAC.) family of proteins is deduced as the only possible explanation of the combination of observations on (RHO.) mRNA family and the phenotypic node [Cell Migration]. Part D . Prediction on phosphorylation of RB1 is a forward deduction from the prediction on PRKCB1 which is deduced from the observation on PRKCB1 mRNA. Part E . The prediction about the CDC2 protein is a result of the correlated interactions of its precursors, predictions on complexes ((CCNA.)^ p:CDC2)) and (CCNB1^ p:CDC2).

Article Snippet: Levels of IGF2 mRNA (taqman Hs01005963_m1, Applied biosystems) and FASLG mRNA (forward primer: ggaaagtggcccatttaaca reverse primer: ccagaaagcaggacaattcc) were measured by real-time quantitative polymerase-chain reaction (RT-QPCR, normalized to RPLP0).

Techniques: Migration, Phospho-proteomics

RT-QPCR data on FASLG, IGF2 and EWS-FLI1 time series . Quantification of FASLG, IGF2 and EWS-FLI1 was performed by RT-QPCR in a time series experiment. EWS-FLI1 was silenced upon shRNA induction by addition of doxycycline in the media for up to 24 days. For the recovery series, doxycycline was omitted from the media after the 10th day of culture (dashed lines).

Journal: BMC Systems Biology

Article Title: Localizing potentially active post-transcriptional regulations in the Ewing's sarcoma gene regulatory network

doi: 10.1186/1752-0509-4-146

Figure Lengend Snippet: RT-QPCR data on FASLG, IGF2 and EWS-FLI1 time series . Quantification of FASLG, IGF2 and EWS-FLI1 was performed by RT-QPCR in a time series experiment. EWS-FLI1 was silenced upon shRNA induction by addition of doxycycline in the media for up to 24 days. For the recovery series, doxycycline was omitted from the media after the 10th day of culture (dashed lines).

Article Snippet: Levels of IGF2 mRNA (taqman Hs01005963_m1, Applied biosystems) and FASLG mRNA (forward primer: ggaaagtggcccatttaaca reverse primer: ccagaaagcaggacaattcc) were measured by real-time quantitative polymerase-chain reaction (RT-QPCR, normalized to RPLP0).

Techniques: Quantitative RT-PCR, shRNA

Western blotting on IGF2 and FASLG . Western blotting of FASLG, IGF2 and beta-actin in a time series experiment. EWS-FLI1 was silenced upon shRNA induction by addition of doxycyclin in the media for up to 17 days.

Journal: BMC Systems Biology

Article Title: Localizing potentially active post-transcriptional regulations in the Ewing's sarcoma gene regulatory network

doi: 10.1186/1752-0509-4-146

Figure Lengend Snippet: Western blotting on IGF2 and FASLG . Western blotting of FASLG, IGF2 and beta-actin in a time series experiment. EWS-FLI1 was silenced upon shRNA induction by addition of doxycyclin in the media for up to 17 days.

Article Snippet: Levels of IGF2 mRNA (taqman Hs01005963_m1, Applied biosystems) and FASLG mRNA (forward primer: ggaaagtggcccatttaaca reverse primer: ccagaaagcaggacaattcc) were measured by real-time quantitative polymerase-chain reaction (RT-QPCR, normalized to RPLP0).

Techniques: Western Blot, shRNA

Placentas were collected from gestation days (GD) 15 and 18 Ascl1 fl/fl and hep-Ascl1 -/- mice. (A) Frozen placental sections underwent periodic acid-Schiff (PAS) staining. Glycogen is stained red to purple. (B) Frozen placental sections were subjected to PL-I and PL-II in situ hybridization staining using RNAscope 2.5 HD Assay-BROWN kit. The PL-I and PL-II mRNAs are stained dark brown. (C) Quantification of relative intensity of Western blotting signals from . Data are presented as the mean fold changes relative to GD15 Ascl1 fl/fl mice (± SD; n = 3 for each group). *, P < 0.05, between Ascl1 fl/fl and hep-Ascl1 -/- mice. AKT, total protein kinase B; Ascl1 , achaete-scute homolog 1; ERK1/2, extracellular signal-regulated kinase 1/2; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IGF2, insulin-like growth factor; PL-II, placental lactogen II.

Journal: bioRxiv

Article Title: Activation of proneuronal transcription factor Ascl1 in maternal liver ensures a healthy pregnancy

doi: 10.1101/2021.04.27.441617

Figure Lengend Snippet: Placentas were collected from gestation days (GD) 15 and 18 Ascl1 fl/fl and hep-Ascl1 -/- mice. (A) Frozen placental sections underwent periodic acid-Schiff (PAS) staining. Glycogen is stained red to purple. (B) Frozen placental sections were subjected to PL-I and PL-II in situ hybridization staining using RNAscope 2.5 HD Assay-BROWN kit. The PL-I and PL-II mRNAs are stained dark brown. (C) Quantification of relative intensity of Western blotting signals from . Data are presented as the mean fold changes relative to GD15 Ascl1 fl/fl mice (± SD; n = 3 for each group). *, P < 0.05, between Ascl1 fl/fl and hep-Ascl1 -/- mice. AKT, total protein kinase B; Ascl1 , achaete-scute homolog 1; ERK1/2, extracellular signal-regulated kinase 1/2; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IGF2, insulin-like growth factor; PL-II, placental lactogen II.

Article Snippet: Serum IGF2 levels were quantified using a 1/6 dilution with the Mouse IGF-2 ELISA Kit (Boster Biological Technology, EK0381) as per directions by the manufacturer and read with the SpectraMax M2e spectrophotometer using the SoftMax Pro 6 program.

Techniques: Staining, In Situ Hybridization, RNAscope, HD Assay, Western Blot

Maternal livers were collected and weighed from nonpregnant (NP) and gestation days (GD) 15 and 18 Ascl1 fl/fl and hep-Ascl1 -/- mice. (A) Hepatic Igf2 mRNA levels were measured using qRT-PCR and presented as the mean fold changes relative to NP controls ± SD (n = 4-5). (B) Western blotting was performed using liver lysates with an antibody against IGF2. (C) Igf2 in situ hybridization on liver sections. (D) IGF2 immunostaining. (E) Levels of hepatic Igf2 promoter-specific transcript variants were measured using qRT-PCR and presented as the mean fold changes relative to NP controls ± SD (n = 4-5). (F) Levels of IGF2 protein in serum were measured using ELISA and presented as the mean fold changes ± SD (n = 3-5). *, P < 0.05; **, P < 0.01; ***, P < 0.001. P0, placental-specific Igf2 promoter; P1-3, placental- and fetal liver-specific Igf2 promoter.

Journal: bioRxiv

Article Title: Activation of proneuronal transcription factor Ascl1 in maternal liver ensures a healthy pregnancy

doi: 10.1101/2021.04.27.441617

Figure Lengend Snippet: Maternal livers were collected and weighed from nonpregnant (NP) and gestation days (GD) 15 and 18 Ascl1 fl/fl and hep-Ascl1 -/- mice. (A) Hepatic Igf2 mRNA levels were measured using qRT-PCR and presented as the mean fold changes relative to NP controls ± SD (n = 4-5). (B) Western blotting was performed using liver lysates with an antibody against IGF2. (C) Igf2 in situ hybridization on liver sections. (D) IGF2 immunostaining. (E) Levels of hepatic Igf2 promoter-specific transcript variants were measured using qRT-PCR and presented as the mean fold changes relative to NP controls ± SD (n = 4-5). (F) Levels of IGF2 protein in serum were measured using ELISA and presented as the mean fold changes ± SD (n = 3-5). *, P < 0.05; **, P < 0.01; ***, P < 0.001. P0, placental-specific Igf2 promoter; P1-3, placental- and fetal liver-specific Igf2 promoter.

Article Snippet: Serum IGF2 levels were quantified using a 1/6 dilution with the Mouse IGF-2 ELISA Kit (Boster Biological Technology, EK0381) as per directions by the manufacturer and read with the SpectraMax M2e spectrophotometer using the SoftMax Pro 6 program.

Techniques: Quantitative RT-PCR, Western Blot, In Situ Hybridization, Immunostaining, Enzyme-linked Immunosorbent Assay