|
Miltenyi Biotec
apc anti cd119 ifngr1 antibody Apc Anti Cd119 Ifngr1 Antibody, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ifngr1/CD119+Antibody%2C+anti-human%2C+REAfinity/pmc13271017-597-9-13 Average 93 stars, based on 1 article reviews
apc anti cd119 ifngr1 antibody - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
OriGene
cytomegalovirus cmv promoter based pcmv xl5 Cytomegalovirus Cmv Promoter Based Pcmv Xl5, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ifngr1/IFNGR1+(NM_000416)+Human+Untagged+Clone/pm19285161-48-6-12 Average 90 stars, based on 1 article reviews
cytomegalovirus cmv promoter based pcmv xl5 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Miltenyi Biotec
cd119 rea189 ![]() Cd119 Rea189, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ifngr1/CD119+Antibody%2C+anti-mouse%2C+REAfinity/pmc06089399-135-52-54 Average 93 stars, based on 1 article reviews
cd119 rea189 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Proteintech
ifngr1 levels ![]() Ifngr1 Levels, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ifngr1/IFNGR1+Antibody/pmc10140599-466-2-13 Average 93 stars, based on 1 article reviews
ifngr1 levels - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
anti ifngr1 ![]() Anti Ifngr1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ifngr1/IFNGR1+Antibody/pmc08812775-45-25-28 Average 93 stars, based on 1 article reviews
anti ifngr1 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Biorbyt
anti ifngr1 ![]() Anti Ifngr1, supplied by Biorbyt, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ifngr1/IFNGR1+antibody/pmc05946019-133-15-17 Average 88 stars, based on 1 article reviews
anti ifngr1 - by Bioz Stars,
2026-09
88/100 stars
|
Buy from Supplier |
|
OriGene
ifngr1 ![]() Ifngr1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ifngr1/IFNGR1+(NM_000416)+Human+Tagged+ORF+Clone+Lentiviral+Particle/pmc04679503-123-5-40 Average 90 stars, based on 1 article reviews
ifngr1 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Cyagen Biosciences
ifngr1 ![]() Ifngr1, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ifngr1/Ifngr1/bio_rxiv__2025__07__02__662891-56-0-32 Average 94 stars, based on 1 article reviews
ifngr1 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
OriGene
human ifn γ receptor ![]() Human Ifn γ Receptor, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ifngr1/IFNGR1+(NM_000416)+Human+Tagged+ORF+Clone/pmc04698109-201-2-7 Average 90 stars, based on 1 article reviews
human ifn γ receptor - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
OriGene
type ifngr1 ![]() Type Ifngr1, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ifngr1/IFNGR1+(NM_000416)+Human+Tagged+ORF+Clone/pmc04679503-208-5-15 Average 93 stars, based on 1 article reviews
type ifngr1 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
OriGene
hp200396 ifngr1 rev ggctggtatgacgtgatgagtg ![]() Hp200396 Ifngr1 Rev Ggctggtatgacgtgatgagtg, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ifngr1/IFNGR1+Human+qPCR+Primer+Pair/pm39898483__sb4c00569_si_001-45-18-16 Average 93 stars, based on 1 article reviews
hp200396 ifngr1 rev ggctggtatgacgtgatgagtg - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Oncotarget
Article Title: ST2/IL-33 signaling promotes malignant development of experimental squamous cell carcinoma by decreasing NK cells cytotoxicity and modulating the intratumoral cell infiltrate
doi: 10.18632/oncotarget.25768
Figure Lengend Snippet: The frequencies of macrophages (F4/80 + ), B (CD19 + ) and T cells (CD4 + and CD8 + ), and dendritic cells (CD11c + ) were determined using immunostaining and FACS analysis in tumor lesions that were harvested from mice on day 126. The bars show (A) the absolute number of leukocytes and the number of (B) CD4 + T lymphocytes, (C) CD8 + T lymphocytes, (D) B lymphocytes, (E) dendritic cells, (F) and macrophages present in the tumor lesions. (G) Frequencies of CD11b + (myeloid cells), CD119 + (M1) and CD124 + (M2) cells in the tumor microenvironment. The data are representative of three experiments (n = 5 per group). * P < 0.05.
Article Snippet: For immunostaining, FcγRs were blocked in mAb 2.4G2, and the cells were then stained for surface markers using PerCP-, PE- and FITC-conjugated antibodies against CD45 (30-F11), CD19 (1D3), CD3 (145-2C11), CD4 (RM4-5), CD8 (53-6.7), CD11b (M1/70), CD27 (LG3A10), DC (33D1), CD124 (mIL4R-M1), NKp46 (29A1.4), KLRG1 (2F1) (BD Biosciences), F4/80 (BM8) (eBioscience), and
Techniques: Immunostaining
Journal: Cell Reports Medicine
Article Title: MYC activation impairs cell-intrinsic IFNγ signaling and confers resistance to anti-PD1/PD-L1 therapy in lung cancer
doi: 10.1016/j.xcrm.2023.101006
Figure Lengend Snippet: Genetic inactivation and expression of IFNγ receptor 1 (IFNGR1) in LC (A) Chromatograms depicting, at the genomic level, the p.Q212X mutation at IFNGR1 in PDC11 cells and the matched normal DNA. The nucleotide change is indicated by an arrow. (B) Western blot of IFNGR1 and PD-L1 in the indicated LC cells. ACTIN and TUBULIN, protein-loading controls. (C) Western blot showing changes in levels of the indicated proteins in the PCD11 cells expressing ectopic wild-type IFNGR1 (IFNGR1-PDC11) on treatment with IFNγ (30 nM), as compared with the empty vector (EV-PDC11) control. Experiments were independently repeated at least twice with similar results. (D) mRNA levels assessed by real-time qPCR of the indicated transcripts (relative to ACTIN ) under basal conditions and after administering IFNγ (30 nM), in H596 cells, in PCD11 parental cells (PDC11), in cells expressing ectopic wild-type IFNGR1 and in EV-PDC11 controls. Results are presented as the median of independent biological triplicates. Asterisks denote statistical significance (∗p < 0.05; ∗∗∗p < 0.005; ∗∗∗∗p < 0.001) from two-tailed Student’s t tests. Data are presented as the mean ± SD. (E) Representative weak and strong immunostaining of IFNGR1 in lung primary tumors. Scale bars, 50 μm. (F) Distribution of the immunostaining of IFNGR1 among lung tumors, by histopathology and levels of HLA-I/B2M and PD-L1. Fisher’s exact test. ns, not significant, LuAD, lung adenocarcinoma; LuSCC, lung squamous cell carcinoma; ns, not significant.
Article Snippet: To determine
Techniques: Expressing, Mutagenesis, Western Blot, Plasmid Preparation, Control, Two Tailed Test, Immunostaining, Histopathology
Journal: Cell Reports Medicine
Article Title: MYC activation impairs cell-intrinsic IFNγ signaling and confers resistance to anti-PD1/PD-L1 therapy in lung cancer
doi: 10.1016/j.xcrm.2023.101006
Figure Lengend Snippet: Oncogenic MYC and low level of constitutive expression of IFNγsign genes (A) Oncoplot of the presence of alterations in the indicated genes. Immunoresponse indicates the presence of mutations of genes involved in immunorecognition (e.g., B2M , TAP1/2 , CALR ) or response to IFNγ ( JAK2 and IFNGR1 ) , and CCLE at cBioPortal. (B) Graphs showing gene expression values in transcripts per million (TPMs) for the transcripts within the IFNγ signature from RNA-seq and at GEO: GSE109720) in (lo)MAX-, (hi)MAX-, and (hi)MYC/MAX-expressing cells. Bars indicate means; differences assessed by two-sided Student’s t test. ns, not significant; S, SCLC. (C) Gene set enrichment analysis (GSEA) showing an inverse correlation in gene expression between the IFNγsign and datasets, including from lungs of mice overexpressing Nmyc (GEO: GSE6077). FDR, false discovery rate; NES, normalized enrichment score.
Article Snippet: To determine
Techniques: Expressing, Gene Expression, RNA Sequencing
Journal: Cell Reports Medicine
Article Title: MYC activation impairs cell-intrinsic IFNγ signaling and confers resistance to anti-PD1/PD-L1 therapy in lung cancer
doi: 10.1016/j.xcrm.2023.101006
Figure Lengend Snippet:
Article Snippet: To determine
Techniques: Virus, Recombinant, Modification, DC Protein Assay, Plasmid Preparation, Sequencing, SYBR Green Assay, Magnetic Beads, Gene Expression, Software
Journal: The Journal of allergy and clinical immunology
Article Title: Targeted Deep Sequencing Identifies Rare ‘loss-of-function’ Variants in IFNGR1 for Risk of Atopic Dermatitis Complicated by Eczema Herpeticum
doi: 10.1016/j.jaci.2015.06.047
Figure Lengend Snippet: Association between common variants in IFNGR1 and protection against ADEH+ among European Americans ( P ≤ 0.05)
Article Snippet: Association between common variants in
Techniques:
Journal: The Journal of allergy and clinical immunology
Article Title: Targeted Deep Sequencing Identifies Rare ‘loss-of-function’ Variants in IFNGR1 for Risk of Atopic Dermatitis Complicated by Eczema Herpeticum
doi: 10.1016/j.jaci.2015.06.047
Figure Lengend Snippet: Summary of total number of variants identified by sequencing in four interferon-pathway genes, the number of private variants identified in ADEH+ or ADEH− patients and the break down according to rarity, novelty and major functional categories.
Article Snippet: Association between common variants in
Techniques: Sequencing, Functional Assay
Journal: The Journal of allergy and clinical immunology
Article Title: Targeted Deep Sequencing Identifies Rare ‘loss-of-function’ Variants in IFNGR1 for Risk of Atopic Dermatitis Complicated by Eczema Herpeticum
doi: 10.1016/j.jaci.2015.06.047
Figure Lengend Snippet: Schematic presentation of 6 rare missense variants in IFNGR1. On the top, the variations that identified by targeted sequencing are illustrated with allele frequencies (in ADEH+/ADEH− patients), 3 known functional variations are highlighted in bold and 2 novel variants are in red. On the bottom, the various domain and 7 exons in the 5′ to 3′ direction are indicated. SP=signal peptide, TM=transmembrane domain.
Article Snippet: Association between common variants in
Techniques: Sequencing, Functional Assay
Journal: The Journal of allergy and clinical immunology
Article Title: Targeted Deep Sequencing Identifies Rare ‘loss-of-function’ Variants in IFNGR1 for Risk of Atopic Dermatitis Complicated by Eczema Herpeticum
doi: 10.1016/j.jaci.2015.06.047
Figure Lengend Snippet: Single marker and haplotype association tests for European Americans and ENCODE regulation tracks on IFNGR1 region (chr6: 137,516,621-137,542,567). SNVs identified by targeted sequencing significantly associated with ADEH+ phenotype (with P values great than 0.01) were illustrated (top panel). The y axis indicates the value of −log10 (P), and the x axis indicates the relative position for each SNV locus in IFNGR1, 3′ to 5′ direction. The vertical lines (green for intron, red for coding-nonsynonymous, purple for coding-synonymous, grey for near-gene-5 and blue for utr-5) represent the position of each SNV on the x axis, and height of the line on the y axis indicates the value of −log10 (P). Similarly, the most significant haplotype results from two to seven-marker windows across the IFNGR1gene were also illustrated by horizontal lines in black (except red color was used for the 7-SNP window) and a P value cutoff of 0.05 was depicted by the grey horizontal line. The bottom panel illustrates the IFNGR1 structure, position of seven SNVs within IFNGR1 gene region (User Track) and regulatory regions with ENCODE regulation tracks including UCSC Gene (IFNGR1), DNase Clusters, Transcription Factor ChIP-seq, Layered H3K27Ac and Transcription Levels on 3 cell lines (NHLF (in pink color), NHEK (in purple color), and K562 (in blue color).
Article Snippet: Association between common variants in
Techniques: Marker, Sequencing, ChIP-sequencing
Journal: The Journal of allergy and clinical immunology
Article Title: Targeted Deep Sequencing Identifies Rare ‘loss-of-function’ Variants in IFNGR1 for Risk of Atopic Dermatitis Complicated by Eczema Herpeticum
doi: 10.1016/j.jaci.2015.06.047
Figure Lengend Snippet: IFN-γ induced phosphorylation of STAT1 is reduced in IFNgR1(−/−). EBV cells reconstituted with IFNgR1V14M and IFNgR1Y397C variants. Plasmids of IFNgR1WT, IFNgR1V14M, IFNgR1Y397C, and IFNgR1V14MY397C were transfected into IFNgR1 deficient cells. The cells were then stimulated with recombinant human IFN-γ at concentration of 0, 10 ng/ml and 50ng/ml for 30 min. 100μg of protein per lane were loaded for the detection of pSTAT1, STAT1, IFNgR1 wildtype and mutants.
Article Snippet: Association between common variants in
Techniques: Phospho-proteomics, Transfection, Recombinant, Concentration Assay
Journal: bioRxiv
Article Title: Common Signatures of Neutrophils in Diverse Disease Conditions
doi: 10.1101/2025.07.02.662891
Figure Lengend Snippet: a UMAP plot of neutrophil transcriptional states in the pooled scRNA-seq dataset of the bone marrow, peripheral blood, spleens, and disease-inflicted tissues of different mouse models. GMP, granulocyte-monocyte progenitors. b Violin plots of the signature genes for neutrophil transcriptional states. c RNA velocity plot of neutrophil transcriptional states. d Pseudotime trajectory analysis of neutrophil transcriptional states. e, f UMAP plots of neutrophils in the diseased tissues (e) or the peripheral blood (f) of different mouse models. g Proportions of neutrophil transcriptional states in the bone marrow, peripheral blood, spleens, and diseased tissues of different mouse models. h Enrichment score heatmap of the gene sets of cytokine-related pathways in neutrophil transcriptional states. i, j C57BL/6 wild-type or Ifngr1 -/- mice (i) or Rag2 -/- and Rag2 -/- Il2rg -/- mice (j) were subjected to the ALI model. Total neutrophils in the peripheral blood, spleens, and lung tissues and their mean fluorescence intensity (MFI) of Cd274 expression were assessed by FACS. Mean ± SEM, * p < 0.05, ** p < 0.01, *** p < 0.001 (ANOVA test). k BALB/c wild-type or nude mice were utilized in the LCPNS-SIIN glioma model. Total neutrophils and Cd274 + neutrophils in the bone marrow, peripheral blood, spleens, and tumors were examined by FACS. Mean ± SD, * p < 0.05, ** p < 0.01 (ANOVA test). l, m C57BL/6 wild-type mice were subjected to ALI (l) or LCPNS-SIIN gliomas (m) . MFI of Cd244, Il4ra, or Cd101 expressed by neutrophils in the peripheral blood was quantified by FACS. Mean ± SD, ns not significant, ** p < 0.01 (Student’s t- test).
Article Snippet:
Techniques: Fluorescence, Expressing
Journal: The Journal of allergy and clinical immunology
Article Title: Targeted Deep Sequencing Identifies Rare ‘loss-of-function’ Variants in IFNGR1 for Risk of Atopic Dermatitis Complicated by Eczema Herpeticum
doi: 10.1016/j.jaci.2015.06.047
Figure Lengend Snippet: Association between common variants in IFNGR1 and protection against ADEH+ among European Americans ( P ≤ 0.05)
Article Snippet: Mammalian expression construct of wild
Techniques:
Journal: The Journal of allergy and clinical immunology
Article Title: Targeted Deep Sequencing Identifies Rare ‘loss-of-function’ Variants in IFNGR1 for Risk of Atopic Dermatitis Complicated by Eczema Herpeticum
doi: 10.1016/j.jaci.2015.06.047
Figure Lengend Snippet: Summary of total number of variants identified by sequencing in four interferon-pathway genes, the number of private variants identified in ADEH+ or ADEH− patients and the break down according to rarity, novelty and major functional categories.
Article Snippet: Mammalian expression construct of wild
Techniques: Sequencing, Functional Assay
Journal: The Journal of allergy and clinical immunology
Article Title: Targeted Deep Sequencing Identifies Rare ‘loss-of-function’ Variants in IFNGR1 for Risk of Atopic Dermatitis Complicated by Eczema Herpeticum
doi: 10.1016/j.jaci.2015.06.047
Figure Lengend Snippet: Schematic presentation of 6 rare missense variants in IFNGR1. On the top, the variations that identified by targeted sequencing are illustrated with allele frequencies (in ADEH+/ADEH− patients), 3 known functional variations are highlighted in bold and 2 novel variants are in red. On the bottom, the various domain and 7 exons in the 5′ to 3′ direction are indicated. SP=signal peptide, TM=transmembrane domain.
Article Snippet: Mammalian expression construct of wild
Techniques: Sequencing, Functional Assay
Journal: The Journal of allergy and clinical immunology
Article Title: Targeted Deep Sequencing Identifies Rare ‘loss-of-function’ Variants in IFNGR1 for Risk of Atopic Dermatitis Complicated by Eczema Herpeticum
doi: 10.1016/j.jaci.2015.06.047
Figure Lengend Snippet: Single marker and haplotype association tests for European Americans and ENCODE regulation tracks on IFNGR1 region (chr6: 137,516,621-137,542,567). SNVs identified by targeted sequencing significantly associated with ADEH+ phenotype (with P values great than 0.01) were illustrated (top panel). The y axis indicates the value of −log10 (P), and the x axis indicates the relative position for each SNV locus in IFNGR1, 3′ to 5′ direction. The vertical lines (green for intron, red for coding-nonsynonymous, purple for coding-synonymous, grey for near-gene-5 and blue for utr-5) represent the position of each SNV on the x axis, and height of the line on the y axis indicates the value of −log10 (P). Similarly, the most significant haplotype results from two to seven-marker windows across the IFNGR1gene were also illustrated by horizontal lines in black (except red color was used for the 7-SNP window) and a P value cutoff of 0.05 was depicted by the grey horizontal line. The bottom panel illustrates the IFNGR1 structure, position of seven SNVs within IFNGR1 gene region (User Track) and regulatory regions with ENCODE regulation tracks including UCSC Gene (IFNGR1), DNase Clusters, Transcription Factor ChIP-seq, Layered H3K27Ac and Transcription Levels on 3 cell lines (NHLF (in pink color), NHEK (in purple color), and K562 (in blue color).
Article Snippet: Mammalian expression construct of wild
Techniques: Marker, Sequencing, ChIP-sequencing
Journal: The Journal of allergy and clinical immunology
Article Title: Targeted Deep Sequencing Identifies Rare ‘loss-of-function’ Variants in IFNGR1 for Risk of Atopic Dermatitis Complicated by Eczema Herpeticum
doi: 10.1016/j.jaci.2015.06.047
Figure Lengend Snippet: IFN-γ induced phosphorylation of STAT1 is reduced in IFNgR1(−/−). EBV cells reconstituted with IFNgR1V14M and IFNgR1Y397C variants. Plasmids of IFNgR1WT, IFNgR1V14M, IFNgR1Y397C, and IFNgR1V14MY397C were transfected into IFNgR1 deficient cells. The cells were then stimulated with recombinant human IFN-γ at concentration of 0, 10 ng/ml and 50ng/ml for 30 min. 100μg of protein per lane were loaded for the detection of pSTAT1, STAT1, IFNgR1 wildtype and mutants.
Article Snippet: Mammalian expression construct of wild
Techniques: Phospho-proteomics, Transfection, Recombinant, Concentration Assay