ifnar2 gene Search Results


94
Thermo Fisher gene exp ifnar2 hs01022059 m1
Gene Exp Ifnar2 Hs01022059 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp ifnar2 hs01022059 m1/product/Thermo Fisher
Average 94 stars, based on 1 article reviews
gene exp ifnar2 hs01022059 m1 - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

89
Thermo Fisher gene exp ifnar2 hs01022060 m1
Gene Exp Ifnar2 Hs01022060 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp ifnar2 hs01022060 m1/product/Thermo Fisher
Average 89 stars, based on 1 article reviews
gene exp ifnar2 hs01022060 m1 - by Bioz Stars, 2026-04
89/100 stars
  Buy from Supplier

91
Thermo Fisher gene exp ifnar2 hs00174198 m1
Human interferon pathway: Assay IDs and targets.
Gene Exp Ifnar2 Hs00174198 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp ifnar2 hs00174198 m1/product/Thermo Fisher
Average 91 stars, based on 1 article reviews
gene exp ifnar2 hs00174198 m1 - by Bioz Stars, 2026-04
91/100 stars
  Buy from Supplier

86
Thermo Fisher gene exp ifnar2 mm00494916 m1
Human interferon pathway: Assay IDs and targets.
Gene Exp Ifnar2 Mm00494916 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp ifnar2 mm00494916 m1/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
gene exp ifnar2 mm00494916 m1 - by Bioz Stars, 2026-04
86/100 stars
  Buy from Supplier

93
Thermo Fisher gene exp ifnar2 bt03215061 m1
Human interferon pathway: Assay IDs and targets.
Gene Exp Ifnar2 Bt03215061 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp ifnar2 bt03215061 m1/product/Thermo Fisher
Average 93 stars, based on 1 article reviews
gene exp ifnar2 bt03215061 m1 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

91
Thermo Fisher gene exp ifnar2 hs01022064 m1
Summary of genome-wide significant pQTLs.
Gene Exp Ifnar2 Hs01022064 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp ifnar2 hs01022064 m1/product/Thermo Fisher
Average 91 stars, based on 1 article reviews
gene exp ifnar2 hs01022064 m1 - by Bioz Stars, 2026-04
91/100 stars
  Buy from Supplier

90
Human Protein Atlas ifnar2 gene
Summary of genome-wide significant pQTLs.
Ifnar2 Gene, supplied by Human Protein Atlas, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ifnar2 gene/product/Human Protein Atlas
Average 90 stars, based on 1 article reviews
ifnar2 gene - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

88
Thermo Fisher gene exp ifnar2 rn01498715 m1
Summary of genome-wide significant pQTLs.
Gene Exp Ifnar2 Rn01498715 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp ifnar2 rn01498715 m1/product/Thermo Fisher
Average 88 stars, based on 1 article reviews
gene exp ifnar2 rn01498715 m1 - by Bioz Stars, 2026-04
88/100 stars
  Buy from Supplier

Image Search Results


Human interferon pathway: Assay IDs and targets.

Journal: Viruses

Article Title: Activation of Interferon-Stimulated Genes following Varicella-Zoster Virus Infection in a Human iPSC-Derived Neuronal In Vitro Model Depends on Exogenous Interferon-α

doi: 10.3390/v14112517

Figure Lengend Snippet: Human interferon pathway: Assay IDs and targets.

Article Snippet: Hs00174198_m1 , IFNAR2.

Techniques:

Summary of genome-wide significant pQTLs.

Journal: PLoS Genetics

Article Title: Function of multiple sclerosis-protective HLA class I alleles revealed by genome-wide protein-quantitative trait loci mapping of interferon signalling

doi: 10.1371/journal.pgen.1009199

Figure Lengend Snippet: Summary of genome-wide significant pQTLs.

Article Snippet: Fast TaqMan qPCR was performed using TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific) and TaqMan gene expression assays: Hs01022064_m1 ( IFNAR2c ), Hs00174198_m1 ( IFNAR2bc) , Hs00988304_m1 ( IFNGR1 ), Hs03043885_g1 ( RPL13A ) (all from ThermoFischer). mRNA levels of IFNAR2b were determined with custom designed primers and probes [ ]: Forward primer: CTATTCACAGGTGCAGTCATAATGC, Reverse primer:: GCACGCTTGTAATCCCAGCTA, Taqman probe: FAM-CAGTCGTCCTGCCTAAGCTTCCCCA-TAMRA.

Techniques: Genome Wide

(A-C) Data on IFNAR2 cell surface levels. (A) Regional association plot for IFNAR2 surface levels in CD56 dim NK cell and (B) boxplots stratified by rs28488669 and rs2186355. (C) Heat-map of the relation between p-values for the two cis -IFNAR2 pQTLs in different cell-types as specified. (D-E) Data on IFN-α induced phosphorylation of STAT4 (pSTAT4) and STAT1 (pSTAT1). (D) Regional association plot of the IFN-α induced pSTAT4 in CD56 dim NK cells and (E) boxplots stratified by rs2298260. (F) Heat-map of the relation between pQTL p-values for IFN-α induced pSTAT1 and pSTAT4 in indicated cell-types. (A and D) The genome-wide significance level (p < 5.0E-8) is denoted by a red line. (A-F) p-values from the full model using single (A, D-F), or two additive SNPs (B-C), ( n = 303). Boxplots show median, IQR and range. gMFI = geometric mean fluorescence intensity.

Journal: PLoS Genetics

Article Title: Function of multiple sclerosis-protective HLA class I alleles revealed by genome-wide protein-quantitative trait loci mapping of interferon signalling

doi: 10.1371/journal.pgen.1009199

Figure Lengend Snippet: (A-C) Data on IFNAR2 cell surface levels. (A) Regional association plot for IFNAR2 surface levels in CD56 dim NK cell and (B) boxplots stratified by rs28488669 and rs2186355. (C) Heat-map of the relation between p-values for the two cis -IFNAR2 pQTLs in different cell-types as specified. (D-E) Data on IFN-α induced phosphorylation of STAT4 (pSTAT4) and STAT1 (pSTAT1). (D) Regional association plot of the IFN-α induced pSTAT4 in CD56 dim NK cells and (E) boxplots stratified by rs2298260. (F) Heat-map of the relation between pQTL p-values for IFN-α induced pSTAT1 and pSTAT4 in indicated cell-types. (A and D) The genome-wide significance level (p < 5.0E-8) is denoted by a red line. (A-F) p-values from the full model using single (A, D-F), or two additive SNPs (B-C), ( n = 303). Boxplots show median, IQR and range. gMFI = geometric mean fluorescence intensity.

Article Snippet: Fast TaqMan qPCR was performed using TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific) and TaqMan gene expression assays: Hs01022064_m1 ( IFNAR2c ), Hs00174198_m1 ( IFNAR2bc) , Hs00988304_m1 ( IFNGR1 ), Hs03043885_g1 ( RPL13A ) (all from ThermoFischer). mRNA levels of IFNAR2b were determined with custom designed primers and probes [ ]: Forward primer: CTATTCACAGGTGCAGTCATAATGC, Reverse primer:: GCACGCTTGTAATCCCAGCTA, Taqman probe: FAM-CAGTCGTCCTGCCTAAGCTTCCCCA-TAMRA.

Techniques: Phospho-proteomics, Genome Wide, Fluorescence

(A) Regional association plots of the trans -IFNAR2 pQTL in B cells before (top) and after conditioning for rs2735099 (middle) and rs17199328 (bottom). (B-D) Boxplots of IFNAR2 levels in B cells (B), CD8 + T cells (C) and CD4 + T (D) cells stratified by rs2735099 and rs17199328 ( n = 301). (E-F) IFNAR1 (E) and IFNGR2 (F) surface levels in B cells ( n = 95). p-values from the full model using single (A, E and F), or two additive SNPs (B-D). Boxplots show median, IQR and range. gMFI = geometric mean fluorescence intensity.

Journal: PLoS Genetics

Article Title: Function of multiple sclerosis-protective HLA class I alleles revealed by genome-wide protein-quantitative trait loci mapping of interferon signalling

doi: 10.1371/journal.pgen.1009199

Figure Lengend Snippet: (A) Regional association plots of the trans -IFNAR2 pQTL in B cells before (top) and after conditioning for rs2735099 (middle) and rs17199328 (bottom). (B-D) Boxplots of IFNAR2 levels in B cells (B), CD8 + T cells (C) and CD4 + T (D) cells stratified by rs2735099 and rs17199328 ( n = 301). (E-F) IFNAR1 (E) and IFNGR2 (F) surface levels in B cells ( n = 95). p-values from the full model using single (A, E and F), or two additive SNPs (B-D). Boxplots show median, IQR and range. gMFI = geometric mean fluorescence intensity.

Article Snippet: Fast TaqMan qPCR was performed using TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific) and TaqMan gene expression assays: Hs01022064_m1 ( IFNAR2c ), Hs00174198_m1 ( IFNAR2bc) , Hs00988304_m1 ( IFNGR1 ), Hs03043885_g1 ( RPL13A ) (all from ThermoFischer). mRNA levels of IFNAR2b were determined with custom designed primers and probes [ ]: Forward primer: CTATTCACAGGTGCAGTCATAATGC, Reverse primer:: GCACGCTTGTAATCCCAGCTA, Taqman probe: FAM-CAGTCGTCCTGCCTAAGCTTCCCCA-TAMRA.

Techniques: Fluorescence

(A) Correlation between rs2735099 and rs17199328 genotypes and imputed HLA-A ( n = 301) and HLA-B alleles ( n = 303). (B) The proportion of B cells subsets in bulk B cells ( n = 95). (C) IFNAR2 surface levels in subsets of B cells from healthy donors ( n = 95). (D) IFNAR2 surface levels in subsets of B cells and T cells from healthy donors ( n = 22) and PwMS ( n = 26). (B-D) Data are stratified by the sum of the MS-protective class I alleles HLA-A*02, HLA-A*68 and HLA-B*44, as indicated. p-values from the full model (B-C) or a simple linear regression (D), using the sum of MS-protective alleles (0–3) as a continuous variable. Boxplots show median, IQR and range. gMFI = geometric mean fluorescence intensity.

Journal: PLoS Genetics

Article Title: Function of multiple sclerosis-protective HLA class I alleles revealed by genome-wide protein-quantitative trait loci mapping of interferon signalling

doi: 10.1371/journal.pgen.1009199

Figure Lengend Snippet: (A) Correlation between rs2735099 and rs17199328 genotypes and imputed HLA-A ( n = 301) and HLA-B alleles ( n = 303). (B) The proportion of B cells subsets in bulk B cells ( n = 95). (C) IFNAR2 surface levels in subsets of B cells from healthy donors ( n = 95). (D) IFNAR2 surface levels in subsets of B cells and T cells from healthy donors ( n = 22) and PwMS ( n = 26). (B-D) Data are stratified by the sum of the MS-protective class I alleles HLA-A*02, HLA-A*68 and HLA-B*44, as indicated. p-values from the full model (B-C) or a simple linear regression (D), using the sum of MS-protective alleles (0–3) as a continuous variable. Boxplots show median, IQR and range. gMFI = geometric mean fluorescence intensity.

Article Snippet: Fast TaqMan qPCR was performed using TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific) and TaqMan gene expression assays: Hs01022064_m1 ( IFNAR2c ), Hs00174198_m1 ( IFNAR2bc) , Hs00988304_m1 ( IFNGR1 ), Hs03043885_g1 ( RPL13A ) (all from ThermoFischer). mRNA levels of IFNAR2b were determined with custom designed primers and probes [ ]: Forward primer: CTATTCACAGGTGCAGTCATAATGC, Reverse primer:: GCACGCTTGTAATCCCAGCTA, Taqman probe: FAM-CAGTCGTCCTGCCTAAGCTTCCCCA-TAMRA.

Techniques: Fluorescence

(A) A schematic picture of the IFNAR2 isoforms. (B) IFNAR2bc , IFNAR2b and IFNAR2c mRNA levels in isolated B cells determined using qRT-PCR. mRNA levels are normalized to the expression of the reference gene RPL13A and expressed as arbitrary units (AU) ( n = 47, simple linear regression using the sum of MS-protective class I alleles (HLAsum) as independent variable). (C) Correlation between IFNAR2bc mRNA levels and IFNAR2 surface receptor levels determined using flow cytometry ( n = 47). Data are binned into 0, 1 and ≥2 HLAsum. p-values and Pearson’s correlation coefficient (r) from linear regressions of each group are shown in coloured text. p-values from multiple linear regressions of the combined data using HLAsum (continuous variable) and mRNA values as independent variables in the full model are denoted in black. (D) Heat-maps comparing the correlation between IFNAR2 levels and IFN-α induced pSTAT1 (top) or pSTAT4 (bottom) in indicated cell-types with and without including HLAsum as a covariate in the full model ( n = 303). (E-G) Correlation between IFNAR2 protein levels and IFN-α (2000 IU/ml) induced pSTAT1 (E), pSTAT4 (F) and CXCL10 (G) in B cells. p-values as described in (C), ( n = 303). Boxplots show median, IQR and range. gMFI = geometric mean fluorescence intensity.

Journal: PLoS Genetics

Article Title: Function of multiple sclerosis-protective HLA class I alleles revealed by genome-wide protein-quantitative trait loci mapping of interferon signalling

doi: 10.1371/journal.pgen.1009199

Figure Lengend Snippet: (A) A schematic picture of the IFNAR2 isoforms. (B) IFNAR2bc , IFNAR2b and IFNAR2c mRNA levels in isolated B cells determined using qRT-PCR. mRNA levels are normalized to the expression of the reference gene RPL13A and expressed as arbitrary units (AU) ( n = 47, simple linear regression using the sum of MS-protective class I alleles (HLAsum) as independent variable). (C) Correlation between IFNAR2bc mRNA levels and IFNAR2 surface receptor levels determined using flow cytometry ( n = 47). Data are binned into 0, 1 and ≥2 HLAsum. p-values and Pearson’s correlation coefficient (r) from linear regressions of each group are shown in coloured text. p-values from multiple linear regressions of the combined data using HLAsum (continuous variable) and mRNA values as independent variables in the full model are denoted in black. (D) Heat-maps comparing the correlation between IFNAR2 levels and IFN-α induced pSTAT1 (top) or pSTAT4 (bottom) in indicated cell-types with and without including HLAsum as a covariate in the full model ( n = 303). (E-G) Correlation between IFNAR2 protein levels and IFN-α (2000 IU/ml) induced pSTAT1 (E), pSTAT4 (F) and CXCL10 (G) in B cells. p-values as described in (C), ( n = 303). Boxplots show median, IQR and range. gMFI = geometric mean fluorescence intensity.

Article Snippet: Fast TaqMan qPCR was performed using TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific) and TaqMan gene expression assays: Hs01022064_m1 ( IFNAR2c ), Hs00174198_m1 ( IFNAR2bc) , Hs00988304_m1 ( IFNGR1 ), Hs03043885_g1 ( RPL13A ) (all from ThermoFischer). mRNA levels of IFNAR2b were determined with custom designed primers and probes [ ]: Forward primer: CTATTCACAGGTGCAGTCATAATGC, Reverse primer:: GCACGCTTGTAATCCCAGCTA, Taqman probe: FAM-CAGTCGTCCTGCCTAAGCTTCCCCA-TAMRA.

Techniques: Isolation, Quantitative RT-PCR, Expressing, Flow Cytometry, Fluorescence

(A) Cis -eQTL analysis within ± 1 Mb from the HLA-A*02/A*68 and HLA-B*44 tag SNPs in LCLs ( n = 373). The p-value threshold of p < 3.2E-4, corresponding to a Bonferroni adjusted p-value of < 0.05 (155 analysed genes) is denoted with dotted lines. Data for 28 of the 155 genes are shown. The inset shows the transcript specific cis -eQTL p-values of HLA-J . (B) Correlation between p-values from the IFNAR2 pQTL in B cells and the cis -eQTL in LCLs for the transcript HLA-J-001 (left) and HCG4P5-001 (right). The HLA-A*02/A*68 and the B*44 tagging SNPs are marked in red and blue respectively. (C) Cis -meQTL analysis of the HLA-A*02/A*68 tagging SNP rs2735099 in primary B cells ( n = 43). The p-value threshold of p < 2.1E-6, corresponding to a Bonferroni adjusted p-value of < 0.05 (23, 722 analysed CpG-sites) is denoted with dotted red lines.

Journal: PLoS Genetics

Article Title: Function of multiple sclerosis-protective HLA class I alleles revealed by genome-wide protein-quantitative trait loci mapping of interferon signalling

doi: 10.1371/journal.pgen.1009199

Figure Lengend Snippet: (A) Cis -eQTL analysis within ± 1 Mb from the HLA-A*02/A*68 and HLA-B*44 tag SNPs in LCLs ( n = 373). The p-value threshold of p < 3.2E-4, corresponding to a Bonferroni adjusted p-value of < 0.05 (155 analysed genes) is denoted with dotted lines. Data for 28 of the 155 genes are shown. The inset shows the transcript specific cis -eQTL p-values of HLA-J . (B) Correlation between p-values from the IFNAR2 pQTL in B cells and the cis -eQTL in LCLs for the transcript HLA-J-001 (left) and HCG4P5-001 (right). The HLA-A*02/A*68 and the B*44 tagging SNPs are marked in red and blue respectively. (C) Cis -meQTL analysis of the HLA-A*02/A*68 tagging SNP rs2735099 in primary B cells ( n = 43). The p-value threshold of p < 2.1E-6, corresponding to a Bonferroni adjusted p-value of < 0.05 (23, 722 analysed CpG-sites) is denoted with dotted red lines.

Article Snippet: Fast TaqMan qPCR was performed using TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific) and TaqMan gene expression assays: Hs01022064_m1 ( IFNAR2c ), Hs00174198_m1 ( IFNAR2bc) , Hs00988304_m1 ( IFNGR1 ), Hs03043885_g1 ( RPL13A ) (all from ThermoFischer). mRNA levels of IFNAR2b were determined with custom designed primers and probes [ ]: Forward primer: CTATTCACAGGTGCAGTCATAATGC, Reverse primer:: GCACGCTTGTAATCCCAGCTA, Taqman probe: FAM-CAGTCGTCCTGCCTAAGCTTCCCCA-TAMRA.

Techniques: