ifitm3 human reverse Search Results


90
OriGene human ifitm3
(a) E2012 and E2012-BPyne structures. (b) Cell membranes were photolabeled with E2012-BPyne and then clicked with TAMRA-azide and analyzed (left: Coomassie blue; right: in-gel fluorescence). (c) Biotinylated proteins were captured by E2012-BPyne and analyzed by WB. (d) <t>IFITM3</t> co-immunoprecipitated with γ-secretase subunits using anti-PS1. (e) IFITM3 was co-purified with γ-secretase subunits by GY6 or 163-BP-L-biotin. (f) An interaction (red) between PS1 and IFITM3 was determined by in situ PLA in mouse primary neurons (bottom panel). Negative controls using PS1 or IFITM3 alone (top two panels), dapi (blue), F-actin (green), scale bar = 50μm. (g) Labeling of IFITM3 by E2012-Bpyne in WT and dKO MEF cells. All WB and IF images are representative of three independent experiments (except b: 2 replicates).
Human Ifitm3, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifitm3+human+reverse/pmc07919141-210-3-5?v=OriGene
Average 90 stars, based on 1 article reviews
human ifitm3 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

99
Abcam ifitm3
Stable IFITM‐positive cell lines were produced in 293T cells, and the expression of each protein was measured by flow cytometry. 293T cells were infected with ZIKV HD78 (MOI 1), and viral replication was measured at days 2 and 3 post‐infection (pi) by flow cytometry using the anti‐E protein antibody 4G2, as illustrated in one representative experiment. Results from four independent experiments as in (B) were quantified at day 3 pi. Mean ± SEM. 293T cells expressing or not <t>IFITM3</t> were infected with the indicated ZIKV strains. Viral replication was measured at day 2 or 3 post‐infection (pi) by flow cytometry using the anti‐E protein antibody 4G2. Results are mean ± SEM of three independent experiments. Human foreskin fibroblasts (HFF) (left panels) or human adult dermal fibroblasts (HDFa) (right panels) overexpressing or not IFITM3 were infected with ZIKV, and the % of E‐positive cells was measured by flow cytometry at day 2 pi. For each cell type, one representative experiment is shown on the left and the mean ± SEM of three independent experiments on the right. Data information: Statistical significance was determined using ANOVA test. *** P < 0.001; ** P < 0.01.
Ifitm3, supplied by Abcam, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifitm3+human+reverse/pmc05470047-214-11-12?v=Abcam
Average 99 stars, based on 1 article reviews
ifitm3 - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

95
Proteintech ifitm3
A Cell viability of siRNA‐transfected U87‐MG/CD4/CXCR4 cells was assessed 72 h post‐transfection by measuring ATP levels. Data represent the mean ± S.E.M of 3 biological replicates. B U87‐MG/CD4/CXR4 cells were transfected with siRNAs, pre‐treated or not with IFN and infected with WT HIV‐1 (NL4‐3) in the presence or not of reverse transcription inhibitors (AZT/3TC). 48 h later, cells were lysed, RNA extracted and RT‐qPCR analysis performed to measure HIV‐1 RNAs. Data represent the mean ± S.E.M of 4 biological replicates. Two‐way ANOVA on log‐transformed data with Sidak's test. C Supernatants from (B) were harvested 48 h post‐infection and AlphaLisa used to measure CA p24 Gag production. Data represent the mean ± S.E.M of 4 biological replicates. Two‐tailed, unpaired t test. D RT‐qPCR analysis was performed RNA samples from (B) to measure relative expression of the ISG OAS1, ISG15, and MX1 (normalized to actin and GAPDH). Data represent the mean ± S.E.M of 4 biological replicates. Two‐way ANOVA with Dunnett's test. E U87‐MG/CD4/CXCR4 cells were transduced to express Cas9 and sgRNAs either targeting nothing (CTRL) or IRF9 and STAT1 (IRF9/STAT1). After 2 weeks, cells were treated or not with IFN, and, 48 h later, <t>IFITM3</t> and MX2 induction was analyzed by immunoblotting, Actin served as a loading control. A representative immunoblot is shown. F siRNA‐transfected MDMs were harvested 48 h post‐transfection for RNA extraction and quantification of DDX42 mRNA levels by RT‐qPCR. Actin and GAPDH were used as endogenous controls. Data represent the mean ± S.E.M of 3 biological replicates performed with cells from different blood donors (parallel samples from Fig ). One‐way ANOVA with Dunnett's test. G U87‐MG/CD4/CXCR4 cells were transduced with lentiviral vectors expressing either Firefly (negative control), WT DDX42 (WT) or a motif I point mutant, which has an impaired ATPase activity (K303E). Transduced cells were infected with HIV‐1 Renilla (NL4‐3/Nef‐IRES‐Renilla) and the infection efficiency was assessed 24 h later by measuring Renilla activity. Data represent the mean ± S.E.M of 3 biological replicates. Two‐way ANOVA on log‐transformed data with Dunnett's test. Data information: P values are denoted as follow: ns, not significant, * P < 0.05, ** P < 0.01, *** P < 0.001. Source data are available online for this figure.
Ifitm3, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifitm3+human+reverse/pmc09638865-344-63-65?v=Proteintech
Average 95 stars, based on 1 article reviews
ifitm3 - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

86
Eurofins ifitm3 human reverse
MYCT1 is a transmembrane phosphoglycoprotein that interacts with IFITM2/3. (A) Endogenous MYCT1 is located at cell–cell junctions (arrow) and in puncta (arrowhead). Staining of human primary ECs for MYCT1 (black), VE-cadherin (magenta), and DNA (blue). Scale bar, 10 µm. (B) MYCT1 is a membrane protein. Western blot analysis of various EC fractions for MYCT1, GAPDH, PECAM1, H3K27ac, and vimentin proteins. Cy, cytoplasm; Mb, membrane; Nu, nucleus; Ck, cytoskeleton. (C) MYCT1 is glycosylated. Western blot analysis of MYCT1 protein electrophoretic mobility in control and PNGase-F–treated lysates. (D) Schematic model of MYCT1 structure and domains with phosphorylation sites, identified by mass spectrometry. MYCT1 phosphorylation sites are highly conserved as indicated by the color scale. Asterisks indicate sites also described at https://www.phosphosite.org/ . (E) Top five proteins interacting with MYCT1 as identified by mass spectrometry, among which IFITM2 and <t>IFITM3.</t> ECs were transduced with recombinant adenoviruses to transiently overexpress MYCT1 or GFP, as a control. Cell lysates were collected 48 h after transduction, immunoprecipitated using MYCT1 antibody or a control IgG, and analyzed by mass spectrometry. Proteins interacting with both endogenous and overexpressed MYCT1 were selected and ranked by normalized spectral abundance factor (NSAF) from two independent mass spectrometry (MS) experiments are shown (31 proteins); the top five proteins are highlighted in magenta. (F) GO terms of the cellular component and biological process overrepresented in the MYCT1 interactome. Fisher’s exact test with adjustment for false discovery rate (FDR). (G) Validation of IFITM2/3 and MYCT1 interaction by co-IP. EC lysates from confluent ECs were immunoprecipitated (IP) with MYCT1 or control IgG and blotted for IFITM2/3. H, IgG heavy chain; L, IgG light chain. (H) IFITM2/3 are constitutively expressed in ECs in vitro and in vivo . Staining of human primary ECs (upper panels), human brain and WAT sections (lower panels) for MYCT1 (gray), IFITM2/3 (green), VE-cadherin (magenta), and DNA (blue). Scale bar, 20 µm (brain) and 50 µm (adipose tissue). (I) MYCT1 and IFITM2/3 interact in brain ECs. Proximity ligation assay (PLA) in human brain sections. Detection of PLA dots (gray) in ECs and staining for VE-cadherin (magenta) and DNA (blue). Arrowheads, colocalization of MYCT1::IFITM2/3 PLA dots and VE-cadherin staining. Scale bar, 20 µm. See also . Source data are available for this figure: .
Ifitm3 Human Reverse, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifitm3+human+reverse/pmc13016079-123-0-4?v=Eurofins
Average 86 stars, based on 1 article reviews
ifitm3 human reverse - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

90
Meridian Bioscience sensifast 2 sybr lorox kit
MYCT1 is a transmembrane phosphoglycoprotein that interacts with IFITM2/3. (A) Endogenous MYCT1 is located at cell–cell junctions (arrow) and in puncta (arrowhead). Staining of human primary ECs for MYCT1 (black), VE-cadherin (magenta), and DNA (blue). Scale bar, 10 µm. (B) MYCT1 is a membrane protein. Western blot analysis of various EC fractions for MYCT1, GAPDH, PECAM1, H3K27ac, and vimentin proteins. Cy, cytoplasm; Mb, membrane; Nu, nucleus; Ck, cytoskeleton. (C) MYCT1 is glycosylated. Western blot analysis of MYCT1 protein electrophoretic mobility in control and PNGase-F–treated lysates. (D) Schematic model of MYCT1 structure and domains with phosphorylation sites, identified by mass spectrometry. MYCT1 phosphorylation sites are highly conserved as indicated by the color scale. Asterisks indicate sites also described at https://www.phosphosite.org/ . (E) Top five proteins interacting with MYCT1 as identified by mass spectrometry, among which IFITM2 and <t>IFITM3.</t> ECs were transduced with recombinant adenoviruses to transiently overexpress MYCT1 or GFP, as a control. Cell lysates were collected 48 h after transduction, immunoprecipitated using MYCT1 antibody or a control IgG, and analyzed by mass spectrometry. Proteins interacting with both endogenous and overexpressed MYCT1 were selected and ranked by normalized spectral abundance factor (NSAF) from two independent mass spectrometry (MS) experiments are shown (31 proteins); the top five proteins are highlighted in magenta. (F) GO terms of the cellular component and biological process overrepresented in the MYCT1 interactome. Fisher’s exact test with adjustment for false discovery rate (FDR). (G) Validation of IFITM2/3 and MYCT1 interaction by co-IP. EC lysates from confluent ECs were immunoprecipitated (IP) with MYCT1 or control IgG and blotted for IFITM2/3. H, IgG heavy chain; L, IgG light chain. (H) IFITM2/3 are constitutively expressed in ECs in vitro and in vivo . Staining of human primary ECs (upper panels), human brain and WAT sections (lower panels) for MYCT1 (gray), IFITM2/3 (green), VE-cadherin (magenta), and DNA (blue). Scale bar, 20 µm (brain) and 50 µm (adipose tissue). (I) MYCT1 and IFITM2/3 interact in brain ECs. Proximity ligation assay (PLA) in human brain sections. Detection of PLA dots (gray) in ECs and staining for VE-cadherin (magenta) and DNA (blue). Arrowheads, colocalization of MYCT1::IFITM2/3 PLA dots and VE-cadherin staining. Scale bar, 20 µm. See also . Source data are available for this figure: .
Sensifast 2 Sybr Lorox Kit, supplied by Meridian Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifitm3+human+reverse/pm34319159-296-36-41?v=Meridian+Bioscience
Average 90 stars, based on 1 article reviews
sensifast 2 sybr lorox kit - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Meridian Bioscience sensifast cdna synthesis kit
MYCT1 is a transmembrane phosphoglycoprotein that interacts with IFITM2/3. (A) Endogenous MYCT1 is located at cell–cell junctions (arrow) and in puncta (arrowhead). Staining of human primary ECs for MYCT1 (black), VE-cadherin (magenta), and DNA (blue). Scale bar, 10 µm. (B) MYCT1 is a membrane protein. Western blot analysis of various EC fractions for MYCT1, GAPDH, PECAM1, H3K27ac, and vimentin proteins. Cy, cytoplasm; Mb, membrane; Nu, nucleus; Ck, cytoskeleton. (C) MYCT1 is glycosylated. Western blot analysis of MYCT1 protein electrophoretic mobility in control and PNGase-F–treated lysates. (D) Schematic model of MYCT1 structure and domains with phosphorylation sites, identified by mass spectrometry. MYCT1 phosphorylation sites are highly conserved as indicated by the color scale. Asterisks indicate sites also described at https://www.phosphosite.org/ . (E) Top five proteins interacting with MYCT1 as identified by mass spectrometry, among which IFITM2 and <t>IFITM3.</t> ECs were transduced with recombinant adenoviruses to transiently overexpress MYCT1 or GFP, as a control. Cell lysates were collected 48 h after transduction, immunoprecipitated using MYCT1 antibody or a control IgG, and analyzed by mass spectrometry. Proteins interacting with both endogenous and overexpressed MYCT1 were selected and ranked by normalized spectral abundance factor (NSAF) from two independent mass spectrometry (MS) experiments are shown (31 proteins); the top five proteins are highlighted in magenta. (F) GO terms of the cellular component and biological process overrepresented in the MYCT1 interactome. Fisher’s exact test with adjustment for false discovery rate (FDR). (G) Validation of IFITM2/3 and MYCT1 interaction by co-IP. EC lysates from confluent ECs were immunoprecipitated (IP) with MYCT1 or control IgG and blotted for IFITM2/3. H, IgG heavy chain; L, IgG light chain. (H) IFITM2/3 are constitutively expressed in ECs in vitro and in vivo . Staining of human primary ECs (upper panels), human brain and WAT sections (lower panels) for MYCT1 (gray), IFITM2/3 (green), VE-cadherin (magenta), and DNA (blue). Scale bar, 20 µm (brain) and 50 µm (adipose tissue). (I) MYCT1 and IFITM2/3 interact in brain ECs. Proximity ligation assay (PLA) in human brain sections. Detection of PLA dots (gray) in ECs and staining for VE-cadherin (magenta) and DNA (blue). Arrowheads, colocalization of MYCT1::IFITM2/3 PLA dots and VE-cadherin staining. Scale bar, 20 µm. See also . Source data are available for this figure: .
Sensifast Cdna Synthesis Kit, supplied by Meridian Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifitm3+human+reverse/pm34319159-296-24-28?v=Meridian+Bioscience
Average 90 stars, based on 1 article reviews
sensifast cdna synthesis kit - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

95
Qiagen hiperfect transfection reagent
MYCT1 is a transmembrane phosphoglycoprotein that interacts with IFITM2/3. (A) Endogenous MYCT1 is located at cell–cell junctions (arrow) and in puncta (arrowhead). Staining of human primary ECs for MYCT1 (black), VE-cadherin (magenta), and DNA (blue). Scale bar, 10 µm. (B) MYCT1 is a membrane protein. Western blot analysis of various EC fractions for MYCT1, GAPDH, PECAM1, H3K27ac, and vimentin proteins. Cy, cytoplasm; Mb, membrane; Nu, nucleus; Ck, cytoskeleton. (C) MYCT1 is glycosylated. Western blot analysis of MYCT1 protein electrophoretic mobility in control and PNGase-F–treated lysates. (D) Schematic model of MYCT1 structure and domains with phosphorylation sites, identified by mass spectrometry. MYCT1 phosphorylation sites are highly conserved as indicated by the color scale. Asterisks indicate sites also described at https://www.phosphosite.org/ . (E) Top five proteins interacting with MYCT1 as identified by mass spectrometry, among which IFITM2 and <t>IFITM3.</t> ECs were transduced with recombinant adenoviruses to transiently overexpress MYCT1 or GFP, as a control. Cell lysates were collected 48 h after transduction, immunoprecipitated using MYCT1 antibody or a control IgG, and analyzed by mass spectrometry. Proteins interacting with both endogenous and overexpressed MYCT1 were selected and ranked by normalized spectral abundance factor (NSAF) from two independent mass spectrometry (MS) experiments are shown (31 proteins); the top five proteins are highlighted in magenta. (F) GO terms of the cellular component and biological process overrepresented in the MYCT1 interactome. Fisher’s exact test with adjustment for false discovery rate (FDR). (G) Validation of IFITM2/3 and MYCT1 interaction by co-IP. EC lysates from confluent ECs were immunoprecipitated (IP) with MYCT1 or control IgG and blotted for IFITM2/3. H, IgG heavy chain; L, IgG light chain. (H) IFITM2/3 are constitutively expressed in ECs in vitro and in vivo . Staining of human primary ECs (upper panels), human brain and WAT sections (lower panels) for MYCT1 (gray), IFITM2/3 (green), VE-cadherin (magenta), and DNA (blue). Scale bar, 20 µm (brain) and 50 µm (adipose tissue). (I) MYCT1 and IFITM2/3 interact in brain ECs. Proximity ligation assay (PLA) in human brain sections. Detection of PLA dots (gray) in ECs and staining for VE-cadherin (magenta) and DNA (blue). Arrowheads, colocalization of MYCT1::IFITM2/3 PLA dots and VE-cadherin staining. Scale bar, 20 µm. See also . Source data are available for this figure: .
Hiperfect Transfection Reagent, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifitm3+human+reverse/pmc03719792-123-5-8?v=Qiagen
Average 95 stars, based on 1 article reviews
hiperfect transfection reagent - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

99
Qiagen rneasy plus mini kit
MYCT1 is a transmembrane phosphoglycoprotein that interacts with IFITM2/3. (A) Endogenous MYCT1 is located at cell–cell junctions (arrow) and in puncta (arrowhead). Staining of human primary ECs for MYCT1 (black), VE-cadherin (magenta), and DNA (blue). Scale bar, 10 µm. (B) MYCT1 is a membrane protein. Western blot analysis of various EC fractions for MYCT1, GAPDH, PECAM1, H3K27ac, and vimentin proteins. Cy, cytoplasm; Mb, membrane; Nu, nucleus; Ck, cytoskeleton. (C) MYCT1 is glycosylated. Western blot analysis of MYCT1 protein electrophoretic mobility in control and PNGase-F–treated lysates. (D) Schematic model of MYCT1 structure and domains with phosphorylation sites, identified by mass spectrometry. MYCT1 phosphorylation sites are highly conserved as indicated by the color scale. Asterisks indicate sites also described at https://www.phosphosite.org/ . (E) Top five proteins interacting with MYCT1 as identified by mass spectrometry, among which IFITM2 and <t>IFITM3.</t> ECs were transduced with recombinant adenoviruses to transiently overexpress MYCT1 or GFP, as a control. Cell lysates were collected 48 h after transduction, immunoprecipitated using MYCT1 antibody or a control IgG, and analyzed by mass spectrometry. Proteins interacting with both endogenous and overexpressed MYCT1 were selected and ranked by normalized spectral abundance factor (NSAF) from two independent mass spectrometry (MS) experiments are shown (31 proteins); the top five proteins are highlighted in magenta. (F) GO terms of the cellular component and biological process overrepresented in the MYCT1 interactome. Fisher’s exact test with adjustment for false discovery rate (FDR). (G) Validation of IFITM2/3 and MYCT1 interaction by co-IP. EC lysates from confluent ECs were immunoprecipitated (IP) with MYCT1 or control IgG and blotted for IFITM2/3. H, IgG heavy chain; L, IgG light chain. (H) IFITM2/3 are constitutively expressed in ECs in vitro and in vivo . Staining of human primary ECs (upper panels), human brain and WAT sections (lower panels) for MYCT1 (gray), IFITM2/3 (green), VE-cadherin (magenta), and DNA (blue). Scale bar, 20 µm (brain) and 50 µm (adipose tissue). (I) MYCT1 and IFITM2/3 interact in brain ECs. Proximity ligation assay (PLA) in human brain sections. Detection of PLA dots (gray) in ECs and staining for VE-cadherin (magenta) and DNA (blue). Arrowheads, colocalization of MYCT1::IFITM2/3 PLA dots and VE-cadherin staining. Scale bar, 20 µm. See also . Source data are available for this figure: .
Rneasy Plus Mini Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifitm3+human+reverse/pmc10145288-44-9-13?v=Qiagen
Average 99 stars, based on 1 article reviews
rneasy plus mini kit - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

90
Promega gotaq qpcr master mix
<t>qPCR</t> analysis. Cells were infected or mock-infected with rAd5-IFITM3 or wtAd5 at an MOI of 100 for 24 h, followed by infection of H5N1 with 10-fold dilution (MOI = 1). Total RNA was extracted from the cells at 0, 6, 12 and 24 hpi of H5N1 infection and reverse transcribed. Thereafter, the qPCR was performed using specific primer targeting M2 gene of H5N1. (A) A549, (B) MDCK.
Gotaq Qpcr Master Mix, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifitm3+human+reverse/pmc07112391-43-6-10?v=Promega
Average 90 stars, based on 1 article reviews
gotaq qpcr master mix - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
PrimerDesign Inc nanoscript2 kit
<t>qPCR</t> analysis. Cells were infected or mock-infected with rAd5-IFITM3 or wtAd5 at an MOI of 100 for 24 h, followed by infection of H5N1 with 10-fold dilution (MOI = 1). Total RNA was extracted from the cells at 0, 6, 12 and 24 hpi of H5N1 infection and reverse transcribed. Thereafter, the qPCR was performed using specific primer targeting M2 gene of H5N1. (A) A549, (B) MDCK.
Nanoscript2 Kit, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifitm3+human+reverse/pmc07097848-237-5-7?v=PrimerDesign+Inc
Average 90 stars, based on 1 article reviews
nanoscript2 kit - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

94
Proteintech immunoblotting mouse anti ifitm1
<t>qPCR</t> analysis. Cells were infected or mock-infected with rAd5-IFITM3 or wtAd5 at an MOI of 100 for 24 h, followed by infection of H5N1 with 10-fold dilution (MOI = 1). Total RNA was extracted from the cells at 0, 6, 12 and 24 hpi of H5N1 infection and reverse transcribed. Thereafter, the qPCR was performed using specific primer targeting M2 gene of H5N1. (A) A549, (B) MDCK.
Immunoblotting Mouse Anti Ifitm1, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifitm3+human+reverse/bio_rxiv__2021__07__23__453596-144-6-9?v=Proteintech
Average 94 stars, based on 1 article reviews
immunoblotting mouse anti ifitm1 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

96
Proteintech lamin b1
Subcellular quantitative proteomic analysis of herpes simplex virus type 1 (HSV-1)-infected HEK 293T cells. ( A ) Intracellular levels of HSV-1 genome DNA and IFNB1 and ISG56 mRNAs in HSV-1 infected HEK 293T cells. Mock- or HSV-1 (MOI = 5)-infected HEK 293T cells were harvested at 4 h p.i. and 20 h p.i. Total RNA was extracted and reverse transcribed into the cDNA to quantify the intracellular mRNA level of IFNB1 and ISG56 using quantitative RT-PCR. The total DNA was extracted, and the intracellular DNA level of the HSV-1 genome was measured with quantitative RT-PCR. ( B ) The MS analysis workflow of the stable isotope-labeled amino acid culture (SILAC). ( C ) Confirming the subcellular fractionation efficiency by Western blot. Cytoplasmic and nuclear fractions from the three biological replicates (R1, R2, and R3) were subjected to Western blot analyses. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and <t>lamin</t> <t>B1</t> were used as markers of cytoplasmic and nuclear proteins, respectively. H: hours.
Lamin B1, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ifitm3+human+reverse/pmc06930547-151-28-30?v=Proteintech
Average 96 stars, based on 1 article reviews
lamin b1 - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

Image Search Results


(a) E2012 and E2012-BPyne structures. (b) Cell membranes were photolabeled with E2012-BPyne and then clicked with TAMRA-azide and analyzed (left: Coomassie blue; right: in-gel fluorescence). (c) Biotinylated proteins were captured by E2012-BPyne and analyzed by WB. (d) IFITM3 co-immunoprecipitated with γ-secretase subunits using anti-PS1. (e) IFITM3 was co-purified with γ-secretase subunits by GY6 or 163-BP-L-biotin. (f) An interaction (red) between PS1 and IFITM3 was determined by in situ PLA in mouse primary neurons (bottom panel). Negative controls using PS1 or IFITM3 alone (top two panels), dapi (blue), F-actin (green), scale bar = 50μm. (g) Labeling of IFITM3 by E2012-Bpyne in WT and dKO MEF cells. All WB and IF images are representative of three independent experiments (except b: 2 replicates).

Journal: Nature

Article Title: Innate immunity protein IFITM3 modulates γ-secretase in Alzheimer disease

doi: 10.1038/s41586-020-2681-2

Figure Lengend Snippet: (a) E2012 and E2012-BPyne structures. (b) Cell membranes were photolabeled with E2012-BPyne and then clicked with TAMRA-azide and analyzed (left: Coomassie blue; right: in-gel fluorescence). (c) Biotinylated proteins were captured by E2012-BPyne and analyzed by WB. (d) IFITM3 co-immunoprecipitated with γ-secretase subunits using anti-PS1. (e) IFITM3 was co-purified with γ-secretase subunits by GY6 or 163-BP-L-biotin. (f) An interaction (red) between PS1 and IFITM3 was determined by in situ PLA in mouse primary neurons (bottom panel). Negative controls using PS1 or IFITM3 alone (top two panels), dapi (blue), F-actin (green), scale bar = 50μm. (g) Labeling of IFITM3 by E2012-Bpyne in WT and dKO MEF cells. All WB and IF images are representative of three independent experiments (except b: 2 replicates).

Article Snippet: Plasmid DNAs for human IFITM3 (OriGene) were cloned into the pcDNA3.1 vector.

Techniques: Fluorescence, Immunoprecipitation, Purification, In Situ, Labeling

(a) LC-MS/MS analysis of the 15 kDa band identified four peptides that match with human IFITM3. (b) WB analysis of E2012-BPyne (500 nM) labeled PS1-NTF protein. (c) Structures of imidazole GSMs, acid GSM and GSIs. (d) WB analysis of E2012-BPyne labeled proteins in the absence or presence of imidazole GSMs, acid GSM and GSIs. Labeled proteins were captured and analyzed by WB for IFITM3. (e) Structures of GY6 and 163-BP-L-biotin. (f) IFITM3 co-immunoprecipitates with γ-secretase subunits. CHAPSO solubilized cell membranes were immunoprecipitated with anti-IFITM3 antibody and probed with antibodies against PS2-CTF and Pen-2. Rabbit IgG was used as a negative control. (g) IFITM3 does not co-immunoprecipitate with SPP. CHAPSO solubilized cell membranes were immunoprecipitated with a monoclonal anti-IFITM3 antibody (9D11) and probed with antibodies against SPP and IFITM3. Mouse IgG was used as a negative control. (h) Analysis of the total protein level in WT MEF or PS1/2 double KO MEF cells. The same amount of membrane proteins was loaded and analyzed by Western blotting. ( i ) IFITM3 mRNA expression levels were measured by RT-PCR in WT MEF or PS1/2 double KO MEF cells (n=6). All WB images and graphs are representative of three independent experiments (except; a/d: 2 replicates). Graphs are mean ± SD. ns, not significant, two-sided Student’s t-test.

Journal: Nature

Article Title: Innate immunity protein IFITM3 modulates γ-secretase in Alzheimer disease

doi: 10.1038/s41586-020-2681-2

Figure Lengend Snippet: (a) LC-MS/MS analysis of the 15 kDa band identified four peptides that match with human IFITM3. (b) WB analysis of E2012-BPyne (500 nM) labeled PS1-NTF protein. (c) Structures of imidazole GSMs, acid GSM and GSIs. (d) WB analysis of E2012-BPyne labeled proteins in the absence or presence of imidazole GSMs, acid GSM and GSIs. Labeled proteins were captured and analyzed by WB for IFITM3. (e) Structures of GY6 and 163-BP-L-biotin. (f) IFITM3 co-immunoprecipitates with γ-secretase subunits. CHAPSO solubilized cell membranes were immunoprecipitated with anti-IFITM3 antibody and probed with antibodies against PS2-CTF and Pen-2. Rabbit IgG was used as a negative control. (g) IFITM3 does not co-immunoprecipitate with SPP. CHAPSO solubilized cell membranes were immunoprecipitated with a monoclonal anti-IFITM3 antibody (9D11) and probed with antibodies against SPP and IFITM3. Mouse IgG was used as a negative control. (h) Analysis of the total protein level in WT MEF or PS1/2 double KO MEF cells. The same amount of membrane proteins was loaded and analyzed by Western blotting. ( i ) IFITM3 mRNA expression levels were measured by RT-PCR in WT MEF or PS1/2 double KO MEF cells (n=6). All WB images and graphs are representative of three independent experiments (except; a/d: 2 replicates). Graphs are mean ± SD. ns, not significant, two-sided Student’s t-test.

Article Snippet: Plasmid DNAs for human IFITM3 (OriGene) were cloned into the pcDNA3.1 vector.

Techniques: Liquid Chromatography with Mass Spectroscopy, Labeling, Immunoprecipitation, Negative Control, Membrane, Western Blot, Expressing, Reverse Transcription Polymerase Chain Reaction

(a) IFITM3 KD by siRNA (n=3) in HEK-APP WT cells was confirmed by WB. Scramble siRNA (SC, n=3), a negative control. (b) IFITM3 KD reduces secreted Aβ40 (n=6, ****p<0.0001) and 42 (n=6, ****p<0.0001). Aβ levels were calculated as % of SC. (c) IFITM3 was KO of U138 cells, and empty vector (EV) was used as control. IFITM3 was reintroduced by transient transfection in both EV and KO cell lines. IFITM3 expression was confirmed by WB. (d) Effect of KO and rescue of IFITM3 on γ-secretase activity for Aβ40 (n=3, *p= 0.0249, ****p<0.0001) and 42 (n=3, *p=0.0359, **p=0.0025) cleavage. (e) Comparison IC 50 of GSM E2012-BPyne against γ-secretase for Aβ40 (n=6, **p= 0.0017) and Aβ42 (n=6, ns) cleavages in U138 EV and KO cells. All WB images and graphs are representative of three independent experiments (except; e: contains data from 2 experimental replicates of n=3). Graphs are mean ± SD. Ns, not significant, two-sided Student’s t-test (except; d: one-way ANOVA and Fishers LSD test).

Journal: Nature

Article Title: Innate immunity protein IFITM3 modulates γ-secretase in Alzheimer disease

doi: 10.1038/s41586-020-2681-2

Figure Lengend Snippet: (a) IFITM3 KD by siRNA (n=3) in HEK-APP WT cells was confirmed by WB. Scramble siRNA (SC, n=3), a negative control. (b) IFITM3 KD reduces secreted Aβ40 (n=6, ****p<0.0001) and 42 (n=6, ****p<0.0001). Aβ levels were calculated as % of SC. (c) IFITM3 was KO of U138 cells, and empty vector (EV) was used as control. IFITM3 was reintroduced by transient transfection in both EV and KO cell lines. IFITM3 expression was confirmed by WB. (d) Effect of KO and rescue of IFITM3 on γ-secretase activity for Aβ40 (n=3, *p= 0.0249, ****p<0.0001) and 42 (n=3, *p=0.0359, **p=0.0025) cleavage. (e) Comparison IC 50 of GSM E2012-BPyne against γ-secretase for Aβ40 (n=6, **p= 0.0017) and Aβ42 (n=6, ns) cleavages in U138 EV and KO cells. All WB images and graphs are representative of three independent experiments (except; e: contains data from 2 experimental replicates of n=3). Graphs are mean ± SD. Ns, not significant, two-sided Student’s t-test (except; d: one-way ANOVA and Fishers LSD test).

Article Snippet: Plasmid DNAs for human IFITM3 (OriGene) were cloned into the pcDNA3.1 vector.

Techniques: Negative Control, Plasmid Preparation, Control, Transfection, Expressing, Activity Assay, Comparison

(a) Quantification of WB showed that IFITM3 KD did not change protein expression levels of APP, Nct and PS1-NTF in HEK-APP WT cells (n=3). (b) Schematic representation of cell-free γ-secretase assay. γ-Secretase is incubated with a recombinant APP substrate in the presence of 0.25% CHAPSO. Cleaved Aβ40 and 42 species are measured with cleavage specific antibodies and AlphaLISA technology. ( c ) Schematic model showing different GSM and GSI binding sites in γ-secretase: E2012 (imidazole GSM), GSM-1 (acid GSM), and L458 (transition state analogue inhibitor, GSI). (d-f) Comparison of IC 50 of (d) GSM-25 (EV: n=9, KO: n= 8) for Aβ40 (****p<0.0001) and Aβ42 (ns), (e) GSM-1 (n=6) for Aβ40 (**p=0.0039) and Aβ42 (ns), and (f) L458 (n=3) for Aβ40 (ns) and Aβ42 (ns) cleavages in the U138 EV or KO cell lines (n≥3). (g) IFITM3 knockdown (KD) does not affect expression of γ-secretase subunits. IFITM3 was knocked-down by siRNA (6 pmol, n=3) in HEK-NotchΔE cells and scramble siRNA (SC, n=3) was used as a negative control. Cell lysates were probed by antibodies against Nct, PS1-NTF and IFITM3. β-Actin was used as a loading control. (h) Effect of IFITM3 KD on γ-secretase activity. IFITM3 KD increased γ-secretase cleaved product NICD, analyzed by WB. Cell lysates were probed by antibodies against c-myc (NotchΔE) and NICD and a representative quantification of NICD (n=8, ***p=0.001) is shown (lower panel). (i) Cell based NICD AlphaLISA assay (left panel) revealed an increase in NICD production with IFITM3 KD. Quantification of NICD (n=8, ***p=0.001) is shown in the right panel. (j) Effect of IFITM3 KO on γ-secretase activity. KO cells lines have increased γ-secretase activity as compared to the EV cell line. The NICD cleavage in vitro was measured by AlphaLISA assay (n=3,**p=0.0096). All WB images and graphs are representative of three independent experiments Graphs are mean ± SD. ns, not significant, two-sided Student’s t-test.

Journal: Nature

Article Title: Innate immunity protein IFITM3 modulates γ-secretase in Alzheimer disease

doi: 10.1038/s41586-020-2681-2

Figure Lengend Snippet: (a) Quantification of WB showed that IFITM3 KD did not change protein expression levels of APP, Nct and PS1-NTF in HEK-APP WT cells (n=3). (b) Schematic representation of cell-free γ-secretase assay. γ-Secretase is incubated with a recombinant APP substrate in the presence of 0.25% CHAPSO. Cleaved Aβ40 and 42 species are measured with cleavage specific antibodies and AlphaLISA technology. ( c ) Schematic model showing different GSM and GSI binding sites in γ-secretase: E2012 (imidazole GSM), GSM-1 (acid GSM), and L458 (transition state analogue inhibitor, GSI). (d-f) Comparison of IC 50 of (d) GSM-25 (EV: n=9, KO: n= 8) for Aβ40 (****p<0.0001) and Aβ42 (ns), (e) GSM-1 (n=6) for Aβ40 (**p=0.0039) and Aβ42 (ns), and (f) L458 (n=3) for Aβ40 (ns) and Aβ42 (ns) cleavages in the U138 EV or KO cell lines (n≥3). (g) IFITM3 knockdown (KD) does not affect expression of γ-secretase subunits. IFITM3 was knocked-down by siRNA (6 pmol, n=3) in HEK-NotchΔE cells and scramble siRNA (SC, n=3) was used as a negative control. Cell lysates were probed by antibodies against Nct, PS1-NTF and IFITM3. β-Actin was used as a loading control. (h) Effect of IFITM3 KD on γ-secretase activity. IFITM3 KD increased γ-secretase cleaved product NICD, analyzed by WB. Cell lysates were probed by antibodies against c-myc (NotchΔE) and NICD and a representative quantification of NICD (n=8, ***p=0.001) is shown (lower panel). (i) Cell based NICD AlphaLISA assay (left panel) revealed an increase in NICD production with IFITM3 KD. Quantification of NICD (n=8, ***p=0.001) is shown in the right panel. (j) Effect of IFITM3 KO on γ-secretase activity. KO cells lines have increased γ-secretase activity as compared to the EV cell line. The NICD cleavage in vitro was measured by AlphaLISA assay (n=3,**p=0.0096). All WB images and graphs are representative of three independent experiments Graphs are mean ± SD. ns, not significant, two-sided Student’s t-test.

Article Snippet: Plasmid DNAs for human IFITM3 (OriGene) were cloned into the pcDNA3.1 vector.

Techniques: Expressing, Incubation, Recombinant, Binding Assay, Comparison, Knockdown, Negative Control, Control, Activity Assay, In Vitro

(a) Protein levels of γ-secretase subunits and IFITM3 in pooled membranes from 4- and 28-month-old WT mouse brains (n=5 mice per age and sex group except n=4 for 28 female, female: **p=0.0014, male: **p=0.0065). Quantified as percent of 4-month female level. (b) γ-Secretase activity for Aβ40 (female: p=***0.0002, male: **p=0.0095) and Aβ42 (female: p=**0.0024, male: **p=0.0088) production in vitro from pooled membrane. (c) Solubilized membranes were captured by 163-BP-L-biotin and then analyzed for γ-secretase and IFITM3 levels. (d) WB for PS1-NTF and IFITM3 (left panel, representative mice shown) in membranes of 18-month-old WT (n=4) and IFITM3−/− (n=5) mouse brains. γ-Secretase activity for Aβ40 (***p=0.0004) and 42 (****p=<0.0001) cleavage (right panels). (e) APP, Nct, PS1-NTF and IFITM3 in membranes from 3- and 12-month-old WT and 5xFAD mice. Quantified as percent of 3-months-old WT (n=5 per group except n=4 for WT at 12 months)(3moWT-12mo5X: ****p<0.0001, 12moWT-12mo5X: ***p=0.004, 3mo5X-12mo5X: ***p=0.0003). (f) WB for PS1-NTF and IFITM3 (left panel) in membranes from 4-month-old 5xFAD (n=3) and IFITM3−/−; 5xFAD (n=3) mouse brains. γ-Secretase activity in vitro for Aβ40 (***p=0.0003) and 42 (**p=<0.0011) cleavage (right panels). (g) Fluorescence microscopy of amyloid plaques in cortex and hippocampus (Thioflavin-S, green) in 4-month-old PFA perfused mice (5xFAD: n=4, IFITM3−/−; 5xFAD: n=5). Scale bar = 300μm (left), 200μm (right). Number of plaques per mm 2 of tissue was calculated throughout the brain and averaged (cor (cortex): *p=0.0109, hip (hippocampus): **p=0.0026). All WB and IF images and graphs are representative of three independent experiments (except; c and quantifications in e: 2 replicates and g: every 1/6 th section throughout the brain). Bar graphs are mean ± SD. Violin plots represent median (middle line) and interquartile range (outer lines). Ns, not significant, two-sided Student’s t-test (except; e: two-way ANOVA followed by Tukey).

Journal: Nature

Article Title: Innate immunity protein IFITM3 modulates γ-secretase in Alzheimer disease

doi: 10.1038/s41586-020-2681-2

Figure Lengend Snippet: (a) Protein levels of γ-secretase subunits and IFITM3 in pooled membranes from 4- and 28-month-old WT mouse brains (n=5 mice per age and sex group except n=4 for 28 female, female: **p=0.0014, male: **p=0.0065). Quantified as percent of 4-month female level. (b) γ-Secretase activity for Aβ40 (female: p=***0.0002, male: **p=0.0095) and Aβ42 (female: p=**0.0024, male: **p=0.0088) production in vitro from pooled membrane. (c) Solubilized membranes were captured by 163-BP-L-biotin and then analyzed for γ-secretase and IFITM3 levels. (d) WB for PS1-NTF and IFITM3 (left panel, representative mice shown) in membranes of 18-month-old WT (n=4) and IFITM3−/− (n=5) mouse brains. γ-Secretase activity for Aβ40 (***p=0.0004) and 42 (****p=<0.0001) cleavage (right panels). (e) APP, Nct, PS1-NTF and IFITM3 in membranes from 3- and 12-month-old WT and 5xFAD mice. Quantified as percent of 3-months-old WT (n=5 per group except n=4 for WT at 12 months)(3moWT-12mo5X: ****p<0.0001, 12moWT-12mo5X: ***p=0.004, 3mo5X-12mo5X: ***p=0.0003). (f) WB for PS1-NTF and IFITM3 (left panel) in membranes from 4-month-old 5xFAD (n=3) and IFITM3−/−; 5xFAD (n=3) mouse brains. γ-Secretase activity in vitro for Aβ40 (***p=0.0003) and 42 (**p=<0.0011) cleavage (right panels). (g) Fluorescence microscopy of amyloid plaques in cortex and hippocampus (Thioflavin-S, green) in 4-month-old PFA perfused mice (5xFAD: n=4, IFITM3−/−; 5xFAD: n=5). Scale bar = 300μm (left), 200μm (right). Number of plaques per mm 2 of tissue was calculated throughout the brain and averaged (cor (cortex): *p=0.0109, hip (hippocampus): **p=0.0026). All WB and IF images and graphs are representative of three independent experiments (except; c and quantifications in e: 2 replicates and g: every 1/6 th section throughout the brain). Bar graphs are mean ± SD. Violin plots represent median (middle line) and interquartile range (outer lines). Ns, not significant, two-sided Student’s t-test (except; e: two-way ANOVA followed by Tukey).

Article Snippet: Plasmid DNAs for human IFITM3 (OriGene) were cloned into the pcDNA3.1 vector.

Techniques: Activity Assay, In Vitro, Membrane, Fluorescence, Microscopy

(a) WBs for Nct and PS1-NTF were quantified by Odyssey imaging (n=5 mice pooled per group, except n=4 for 28F, all=ns). (b) Effect of aging on subcellular localizations of IFITM3. A hemibrain from male wild-type C57BL/6 mouse at 4 and 28 months (n=1 per group) were homogenized and layered on iodixanol gradient (2.5 – 30 %). Fractions were collected from the top and resolved by WBs for γ-secretase, IFITM3 and different subcellular markers. (c) WBs for APP, Nct, and PS1-NTF were quantified by Odyssey imaging (n=5 mice per group except n=4 for WT at 12 months). APP: 3moWT-3mo5X: ****p<0.001, 3mo5X-12mo5X: ****p<0.0001, 12moWT-12mo5X: ****p<0.0001). Nct: 3moWT-12moWT: ****p<0.001, 3mo5X-12mo5X: ****p<0.001, 12moWT-12mo5X: ****p<0.001. PS1-NTF: 3moWT-12mo5X: ***p=0.0004, 12moWT-12mo5X: ****p<0.001. ( d ) Immunostaining of IFITM3 in mouse brains. Fluorescence microscopy of IFITM3 expression in 12-month-old PFA perfused mice (WT, upper panel, 5XFAD, lower panel). Representative images of cortex, hippocampus and subiculum (left to right) show IFITM3 (green) and DAPI (blue). Scale bar = 1000μm, 200μm, 100μm (left to right). Total IFITM3 fluorescence area within the hippocampus and cortex of WT and 5XFAD was quantified using FIJI. Total IFITM3 was divided by tissue area and 5XFAD expression was normalized to average of WT (WT: n=7, 5XFAD: n=9)(cor (cortex): **p=0.0035, hip (hippocampus): ****p<0.0001 ). (e) IFITM3 expression in astrocytes and microglia is upregulated in 5XFAD mice compared to WT mice. Fluorescence microscopy of IFITM3, GFAP (top) and Iba1 (bottom) expression in 12-month-old PFA perfused mice (WT, upper panel, 5XFAD, lower panel). Representative images of the hippocampus and cortex show IFITM3 (red), GFAP (green – top), Iba1 (green - bottom), and DAPI (blue), scale bar = 500μm. Inset panels (left to right) show GFAP or Iba1 (green), IFITM3 (red) and merge. Scale bar = 50μm. All WB images and graphs are representative of three independent experiments (except; b: 2 replicates). Graphs are mean ± SD. ns, not significant, , two-sided Student’s t-test, (except; c: one-way ANOVA followed by Tukey).

Journal: Nature

Article Title: Innate immunity protein IFITM3 modulates γ-secretase in Alzheimer disease

doi: 10.1038/s41586-020-2681-2

Figure Lengend Snippet: (a) WBs for Nct and PS1-NTF were quantified by Odyssey imaging (n=5 mice pooled per group, except n=4 for 28F, all=ns). (b) Effect of aging on subcellular localizations of IFITM3. A hemibrain from male wild-type C57BL/6 mouse at 4 and 28 months (n=1 per group) were homogenized and layered on iodixanol gradient (2.5 – 30 %). Fractions were collected from the top and resolved by WBs for γ-secretase, IFITM3 and different subcellular markers. (c) WBs for APP, Nct, and PS1-NTF were quantified by Odyssey imaging (n=5 mice per group except n=4 for WT at 12 months). APP: 3moWT-3mo5X: ****p<0.001, 3mo5X-12mo5X: ****p<0.0001, 12moWT-12mo5X: ****p<0.0001). Nct: 3moWT-12moWT: ****p<0.001, 3mo5X-12mo5X: ****p<0.001, 12moWT-12mo5X: ****p<0.001. PS1-NTF: 3moWT-12mo5X: ***p=0.0004, 12moWT-12mo5X: ****p<0.001. ( d ) Immunostaining of IFITM3 in mouse brains. Fluorescence microscopy of IFITM3 expression in 12-month-old PFA perfused mice (WT, upper panel, 5XFAD, lower panel). Representative images of cortex, hippocampus and subiculum (left to right) show IFITM3 (green) and DAPI (blue). Scale bar = 1000μm, 200μm, 100μm (left to right). Total IFITM3 fluorescence area within the hippocampus and cortex of WT and 5XFAD was quantified using FIJI. Total IFITM3 was divided by tissue area and 5XFAD expression was normalized to average of WT (WT: n=7, 5XFAD: n=9)(cor (cortex): **p=0.0035, hip (hippocampus): ****p<0.0001 ). (e) IFITM3 expression in astrocytes and microglia is upregulated in 5XFAD mice compared to WT mice. Fluorescence microscopy of IFITM3, GFAP (top) and Iba1 (bottom) expression in 12-month-old PFA perfused mice (WT, upper panel, 5XFAD, lower panel). Representative images of the hippocampus and cortex show IFITM3 (red), GFAP (green – top), Iba1 (green - bottom), and DAPI (blue), scale bar = 500μm. Inset panels (left to right) show GFAP or Iba1 (green), IFITM3 (red) and merge. Scale bar = 50μm. All WB images and graphs are representative of three independent experiments (except; b: 2 replicates). Graphs are mean ± SD. ns, not significant, , two-sided Student’s t-test, (except; c: one-way ANOVA followed by Tukey).

Article Snippet: Plasmid DNAs for human IFITM3 (OriGene) were cloned into the pcDNA3.1 vector.

Techniques: Imaging, Immunostaining, Fluorescence, Microscopy, Expressing

(a) The expression profiles of IFITM3 in human control (n=76) and LOAD (n=80) from temporal cortex (**p=0.002)(Mayo Clinic cohort). (b) IFITM3 mRNA expression levels in control and LOAD samples (LOAD: n=18 and control: n=10, **p=0.0056). (c) The protein levels of γ-secretase subunits and IFITM3 in human brain membranes (LOAD: n=18 and control: n=10, *p=0.0127). IFITM3 quantified as relative intensity. (d) IFITM3 expression (left) between control (n=10), LOAD-L (n=10) and LOAD-H (n=8)(****p<0.0001). γ-Secretase activity for Aβ40 (**p=0.0037, ***p=0.0007) and 42 (**p=0.0036, ***p=0.0002) cleavage between groups. (e) Primary mouse neurons were treated with control (n=2), 10ng/mL (n=3, ***p=0.0005) or 100 ng/mL (n=3, ***p=0.0003) of IFN-γ, membranes were probed for γ-secretase and IFITM3 (left panel, quantified: right panel). (f) Quantification of secreted Aβ40 from 10ng/mL (n=8, **p=0.0010) and 100 ng/mL (n=8, **p=0.0026) IFN-γ treated neurons Aβ42 from 10ng/mL (n=8, ***p=0.0006) and 100 ng/mL (n=8, ***p=0.0003) IFN-γ (n=8). (g) γ-Secretase activity for Aβ40 (n=6, ***p=0.0007) and 42 (n=6, ***p=0.006) cleavage from IFN-γ treated neuron membranes. (h) Photolabeled PS-NTF in neuronal membranes and quantified as % of control (control: n=10, 10ng/ml: n=5, **p=0.0023, 100ng/ml: n=7,****p<0.0001). (i) WB for IFITM3 and PS1-NTF primary human astrocytes treated with PBS, IL-6, or IL-1β (control: n=6, IL-6: n=4, **p=0.0014, IL-1β: n=3, *p=0.0103), data normalized to PBS. (j) γ-Secretase activity for Aβ40 (control: n=8 IL-6: n=7, **p=0.0098, IL-1β: n=9,****p<0.0001) and 42 (control: n= IL-6: n=7, *p=0.0467, IL-1β: n=9, ****p<0.0001) in astrocyte membrane. All WB images and graphs are representative of three independent experiments (except; b: 1 replicate, c/g: 2 replicates, d: γ-secretase activity graph contains data from two independent replicates, h: 5 replicates). Graphs are mean ± SD. Ns, not significant, *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, two-sided Student’s t-test.

Journal: Nature

Article Title: Innate immunity protein IFITM3 modulates γ-secretase in Alzheimer disease

doi: 10.1038/s41586-020-2681-2

Figure Lengend Snippet: (a) The expression profiles of IFITM3 in human control (n=76) and LOAD (n=80) from temporal cortex (**p=0.002)(Mayo Clinic cohort). (b) IFITM3 mRNA expression levels in control and LOAD samples (LOAD: n=18 and control: n=10, **p=0.0056). (c) The protein levels of γ-secretase subunits and IFITM3 in human brain membranes (LOAD: n=18 and control: n=10, *p=0.0127). IFITM3 quantified as relative intensity. (d) IFITM3 expression (left) between control (n=10), LOAD-L (n=10) and LOAD-H (n=8)(****p<0.0001). γ-Secretase activity for Aβ40 (**p=0.0037, ***p=0.0007) and 42 (**p=0.0036, ***p=0.0002) cleavage between groups. (e) Primary mouse neurons were treated with control (n=2), 10ng/mL (n=3, ***p=0.0005) or 100 ng/mL (n=3, ***p=0.0003) of IFN-γ, membranes were probed for γ-secretase and IFITM3 (left panel, quantified: right panel). (f) Quantification of secreted Aβ40 from 10ng/mL (n=8, **p=0.0010) and 100 ng/mL (n=8, **p=0.0026) IFN-γ treated neurons Aβ42 from 10ng/mL (n=8, ***p=0.0006) and 100 ng/mL (n=8, ***p=0.0003) IFN-γ (n=8). (g) γ-Secretase activity for Aβ40 (n=6, ***p=0.0007) and 42 (n=6, ***p=0.006) cleavage from IFN-γ treated neuron membranes. (h) Photolabeled PS-NTF in neuronal membranes and quantified as % of control (control: n=10, 10ng/ml: n=5, **p=0.0023, 100ng/ml: n=7,****p<0.0001). (i) WB for IFITM3 and PS1-NTF primary human astrocytes treated with PBS, IL-6, or IL-1β (control: n=6, IL-6: n=4, **p=0.0014, IL-1β: n=3, *p=0.0103), data normalized to PBS. (j) γ-Secretase activity for Aβ40 (control: n=8 IL-6: n=7, **p=0.0098, IL-1β: n=9,****p<0.0001) and 42 (control: n= IL-6: n=7, *p=0.0467, IL-1β: n=9, ****p<0.0001) in astrocyte membrane. All WB images and graphs are representative of three independent experiments (except; b: 1 replicate, c/g: 2 replicates, d: γ-secretase activity graph contains data from two independent replicates, h: 5 replicates). Graphs are mean ± SD. Ns, not significant, *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, two-sided Student’s t-test.

Article Snippet: Plasmid DNAs for human IFITM3 (OriGene) were cloned into the pcDNA3.1 vector.

Techniques: Expressing, Control, Activity Assay, Membrane

(a) Spearman’s correlation of mRNA expression of human IFITM3 gene with age was analyzed in the cortex (n=158) and hippocampus (n=123) of normal human brains using the Genotype-Tissue Expression (GTEx) cohort.. (b) mRNA expression in non-demented subject control (n=10) and LOAD samples (n=18) of MAP2 (ns), GFAP (**p=0.0046), and AIF1 (ns) were measured, which were used in – . (c) Expression profiles of MAP2 (ns), GFAP (****p<0.0001), and AIF1 (ns) in the temporal cortex of human control (n=76) and LOAD samples (n=80) using the Mayo Clinic cohort data. Correlation analyses were carried out and p values were calculated. The protein levels of Nct (****p<0.0001) and PS1-NTF (**p=0.0042) in human brain membranes (control and LOAD). The samples were analyzed by WB and quantified (n=10 and 18, respectively). Signal was normalized to HeLa cell membrane. (e-f) IFITM3 SNP Genotypes. (e) Allelic discrimination plot depicting rs34481144 genotype calls for control (n=9), LOAD-L (n=10), and LOAD-H (n=8) brain samples. The axes show delta Rn values obtained from TaqMan SNP genotyping analysis. Samples without genomic DNA were used as non-template controls (shown as black squares in the left lower quadrant, n=2). (f) Allele frequency of rs34481144 genotype in control (n=9) and LOAD (n=18). ( g ) mRNA level of IFITM3 gene in four types of EGFP/L10a-expressing mouse hippocampal neurons (GAD2 (glutamate decarboxylase 2), CCK (cholecystokinin), PV (parvalbumin), and CORT (cortistatin) expressing GABAergic neurons)(n=4 per group, GAD2-PV: ***p=0.0003, CCK-PV: ****p<0.0001, CCK-Cort *p=0.0363, PV-Cort: **p=0.0059). ( h ) mRNA levels of IFITM3 in human iPSC-derived neurons (n=4) and human primary astrocytes (n=3) were measured by qPCR (****p<0.0001). ( i-j ) Human iPSC-derived neurons (i) and human primary astrocytes (j) were stained for IFITM3 with MAP2 (neuronal marker) or S100β (astrocyte marker). DAPI was used for nucleus staining. Scale bar = 200 and 500 μm. ( k ) Induction of IFITM3 by IFN-α in primary neurons. E16 mouse primary neurons were treated with 100 ng/ml of IFN-α at DIV12 for 24 hours. The protein levels of γ-secretase and IFITM3 were analyzed by WB (n=4 per group). β-Tubulin III was used as a loading control. ( l ) Effect of IFITM3 induction on γ-secretase activity for Aβ40 (*p=0.0116) and Aβ42 (*p=0.0319) activity. Membranes from primary neurons were incubated with the recombinant APP substrate C100-ΔID-FLAG and γ-secretase activity (Aβ cleavage rate) was assayed by human Aβ three-plex MSD kits (n=12, 10). ( m ) JC8 whole cell photolabeling. Neuronal membranes were photolabeled with JC8 in the absence or presence of L458 and analyzed by anti-PS1-NTF antibody. Photolabeled PS1-NTF protein level was quantified by Odyssey imaging (n=3, *p=0.0210). (n) Spearman’s correlation between the expression level of IFITM3 and viruses. In the Brodmann Area 22 (BA-22 region) in the Mount Sinai Brain Bank (MSBB) cohort, the expression level of IFITM3 is positively correlated with the expression level of the human herpesvirus-6B (HHV-6B) (rho=0.248, p=0.044, n=66). In the Brodmann Area 36 (BA-36 region), the expression level of IFITM3 is positively correlated with the expression of hepatitis C virus genotype 4 (rho=0.255, p=0.033, n=70). All WB images and graphs are representative of two independent experiments (except; b/e: 1 replicate, h: data pooled from 2 experiments, k: 3 replicates, l: data pooled from 4 experiments). Bar graphs are mean ± SD. Violin plots represent median (middle line) and interquartile range (outer lines). ns, not significant, * P < 0.05, ** P < 0.01, **** P < 0.0001, two-sided Student’s t-test (except; g: One-Way ANOVA followed by Tukey).

Journal: Nature

Article Title: Innate immunity protein IFITM3 modulates γ-secretase in Alzheimer disease

doi: 10.1038/s41586-020-2681-2

Figure Lengend Snippet: (a) Spearman’s correlation of mRNA expression of human IFITM3 gene with age was analyzed in the cortex (n=158) and hippocampus (n=123) of normal human brains using the Genotype-Tissue Expression (GTEx) cohort.. (b) mRNA expression in non-demented subject control (n=10) and LOAD samples (n=18) of MAP2 (ns), GFAP (**p=0.0046), and AIF1 (ns) were measured, which were used in – . (c) Expression profiles of MAP2 (ns), GFAP (****p<0.0001), and AIF1 (ns) in the temporal cortex of human control (n=76) and LOAD samples (n=80) using the Mayo Clinic cohort data. Correlation analyses were carried out and p values were calculated. The protein levels of Nct (****p<0.0001) and PS1-NTF (**p=0.0042) in human brain membranes (control and LOAD). The samples were analyzed by WB and quantified (n=10 and 18, respectively). Signal was normalized to HeLa cell membrane. (e-f) IFITM3 SNP Genotypes. (e) Allelic discrimination plot depicting rs34481144 genotype calls for control (n=9), LOAD-L (n=10), and LOAD-H (n=8) brain samples. The axes show delta Rn values obtained from TaqMan SNP genotyping analysis. Samples without genomic DNA were used as non-template controls (shown as black squares in the left lower quadrant, n=2). (f) Allele frequency of rs34481144 genotype in control (n=9) and LOAD (n=18). ( g ) mRNA level of IFITM3 gene in four types of EGFP/L10a-expressing mouse hippocampal neurons (GAD2 (glutamate decarboxylase 2), CCK (cholecystokinin), PV (parvalbumin), and CORT (cortistatin) expressing GABAergic neurons)(n=4 per group, GAD2-PV: ***p=0.0003, CCK-PV: ****p<0.0001, CCK-Cort *p=0.0363, PV-Cort: **p=0.0059). ( h ) mRNA levels of IFITM3 in human iPSC-derived neurons (n=4) and human primary astrocytes (n=3) were measured by qPCR (****p<0.0001). ( i-j ) Human iPSC-derived neurons (i) and human primary astrocytes (j) were stained for IFITM3 with MAP2 (neuronal marker) or S100β (astrocyte marker). DAPI was used for nucleus staining. Scale bar = 200 and 500 μm. ( k ) Induction of IFITM3 by IFN-α in primary neurons. E16 mouse primary neurons were treated with 100 ng/ml of IFN-α at DIV12 for 24 hours. The protein levels of γ-secretase and IFITM3 were analyzed by WB (n=4 per group). β-Tubulin III was used as a loading control. ( l ) Effect of IFITM3 induction on γ-secretase activity for Aβ40 (*p=0.0116) and Aβ42 (*p=0.0319) activity. Membranes from primary neurons were incubated with the recombinant APP substrate C100-ΔID-FLAG and γ-secretase activity (Aβ cleavage rate) was assayed by human Aβ three-plex MSD kits (n=12, 10). ( m ) JC8 whole cell photolabeling. Neuronal membranes were photolabeled with JC8 in the absence or presence of L458 and analyzed by anti-PS1-NTF antibody. Photolabeled PS1-NTF protein level was quantified by Odyssey imaging (n=3, *p=0.0210). (n) Spearman’s correlation between the expression level of IFITM3 and viruses. In the Brodmann Area 22 (BA-22 region) in the Mount Sinai Brain Bank (MSBB) cohort, the expression level of IFITM3 is positively correlated with the expression level of the human herpesvirus-6B (HHV-6B) (rho=0.248, p=0.044, n=66). In the Brodmann Area 36 (BA-36 region), the expression level of IFITM3 is positively correlated with the expression of hepatitis C virus genotype 4 (rho=0.255, p=0.033, n=70). All WB images and graphs are representative of two independent experiments (except; b/e: 1 replicate, h: data pooled from 2 experiments, k: 3 replicates, l: data pooled from 4 experiments). Bar graphs are mean ± SD. Violin plots represent median (middle line) and interquartile range (outer lines). ns, not significant, * P < 0.05, ** P < 0.01, **** P < 0.0001, two-sided Student’s t-test (except; g: One-Way ANOVA followed by Tukey).

Article Snippet: Plasmid DNAs for human IFITM3 (OriGene) were cloned into the pcDNA3.1 vector.

Techniques: Expressing, Control, Membrane, Derivative Assay, Staining, Marker, Activity Assay, Incubation, Recombinant, Imaging, Virus

(a) Schematic model showing L458 binding to the subsites (S2-S3’) in the active site of γ-secretase. (b) Photolabeling of IFITM3 and PS1 by four inhibitors. (c) Photolabeling of IFITM3 and PS1 by L505 in human brains (control: n=4, LOAD-L: n=5, LOAD-H: n=5). (d) Pearson’s correlation between γ-secretase activity and L505 labeled IFITM3 (Fig. 5c) in LOAD samples (n=10). (e) Double cross-linking of γ-secretase and IFITM3 by the dual probe, L631. WB reveals multiple protein complex species containing IFITM3, PS1-NTF, PS1-CTF, IFITM3 homodimer, IFITM3-PS1 and PS1-NTF-CTF heterodimers. (f) Schematic representation of the interaction between IFITM3 and γ-secretase, IFITM3 is near the active site and can be crosslinked with PS1-NTF. (g) IFITM3 connects infections and innate immunity with Aβ production and AD risk. (A) Pathogenic challenge, or other inflammatory conditions, induce the release of proinflammatory cytokines from astrocytes and microglia. (B) Cytokines upregulate IFITM3 expression in neurons and astrocytes that potentiates γ-secretase, increasing Aβ production. (C) As part of an innate immune response, Aβ acts as an antimicrobial or antiviral peptide. In turn, Aβ accumulation also triggers AD pathology. All WB images and graphs are representative of three independent experiments (except; c: 2 replicates).

Journal: Nature

Article Title: Innate immunity protein IFITM3 modulates γ-secretase in Alzheimer disease

doi: 10.1038/s41586-020-2681-2

Figure Lengend Snippet: (a) Schematic model showing L458 binding to the subsites (S2-S3’) in the active site of γ-secretase. (b) Photolabeling of IFITM3 and PS1 by four inhibitors. (c) Photolabeling of IFITM3 and PS1 by L505 in human brains (control: n=4, LOAD-L: n=5, LOAD-H: n=5). (d) Pearson’s correlation between γ-secretase activity and L505 labeled IFITM3 (Fig. 5c) in LOAD samples (n=10). (e) Double cross-linking of γ-secretase and IFITM3 by the dual probe, L631. WB reveals multiple protein complex species containing IFITM3, PS1-NTF, PS1-CTF, IFITM3 homodimer, IFITM3-PS1 and PS1-NTF-CTF heterodimers. (f) Schematic representation of the interaction between IFITM3 and γ-secretase, IFITM3 is near the active site and can be crosslinked with PS1-NTF. (g) IFITM3 connects infections and innate immunity with Aβ production and AD risk. (A) Pathogenic challenge, or other inflammatory conditions, induce the release of proinflammatory cytokines from astrocytes and microglia. (B) Cytokines upregulate IFITM3 expression in neurons and astrocytes that potentiates γ-secretase, increasing Aβ production. (C) As part of an innate immune response, Aβ acts as an antimicrobial or antiviral peptide. In turn, Aβ accumulation also triggers AD pathology. All WB images and graphs are representative of three independent experiments (except; c: 2 replicates).

Article Snippet: Plasmid DNAs for human IFITM3 (OriGene) were cloned into the pcDNA3.1 vector.

Techniques: Binding Assay, Control, Activity Assay, Labeling, Expressing

Stable IFITM‐positive cell lines were produced in 293T cells, and the expression of each protein was measured by flow cytometry. 293T cells were infected with ZIKV HD78 (MOI 1), and viral replication was measured at days 2 and 3 post‐infection (pi) by flow cytometry using the anti‐E protein antibody 4G2, as illustrated in one representative experiment. Results from four independent experiments as in (B) were quantified at day 3 pi. Mean ± SEM. 293T cells expressing or not IFITM3 were infected with the indicated ZIKV strains. Viral replication was measured at day 2 or 3 post‐infection (pi) by flow cytometry using the anti‐E protein antibody 4G2. Results are mean ± SEM of three independent experiments. Human foreskin fibroblasts (HFF) (left panels) or human adult dermal fibroblasts (HDFa) (right panels) overexpressing or not IFITM3 were infected with ZIKV, and the % of E‐positive cells was measured by flow cytometry at day 2 pi. For each cell type, one representative experiment is shown on the left and the mean ± SEM of three independent experiments on the right. Data information: Statistical significance was determined using ANOVA test. *** P < 0.001; ** P < 0.01.

Journal: The EMBO Journal

Article Title: Zika virus induces massive cytoplasmic vacuolization and paraptosis‐like death in infected cells

doi: 10.15252/embj.201695597

Figure Lengend Snippet: Stable IFITM‐positive cell lines were produced in 293T cells, and the expression of each protein was measured by flow cytometry. 293T cells were infected with ZIKV HD78 (MOI 1), and viral replication was measured at days 2 and 3 post‐infection (pi) by flow cytometry using the anti‐E protein antibody 4G2, as illustrated in one representative experiment. Results from four independent experiments as in (B) were quantified at day 3 pi. Mean ± SEM. 293T cells expressing or not IFITM3 were infected with the indicated ZIKV strains. Viral replication was measured at day 2 or 3 post‐infection (pi) by flow cytometry using the anti‐E protein antibody 4G2. Results are mean ± SEM of three independent experiments. Human foreskin fibroblasts (HFF) (left panels) or human adult dermal fibroblasts (HDFa) (right panels) overexpressing or not IFITM3 were infected with ZIKV, and the % of E‐positive cells was measured by flow cytometry at day 2 pi. For each cell type, one representative experiment is shown on the left and the mean ± SEM of three independent experiments on the right. Data information: Statistical significance was determined using ANOVA test. *** P < 0.001; ** P < 0.01.

Article Snippet: The following antibodies were used: IFITM1 (Proteintech, 60074‐1‐Ig), IFITM2 (Proteintech, 66137‐1‐Ig), IFITM3 (Abcam, EPR5242/ab109429), actin (Santa Cruz Biotechnology), tubulin (Santa Cruz Biotechnology), and LC3 (MBL International PM036).

Techniques: Produced, Expressing, Flow Cytometry, Infection

HeLa cells were transduced to stably express a control scrambled shRNA (sh‐SCR) or shRNA targeting IFITM3 (sh‐IFITM3). The level of endogenous IFITMs in the presence or absence of IFN‐α (1,000 IU/ml for 48 h) was assessed by Western blot. HeLa sh‐SCR or sh‐IFITM3 treated or not with IFN‐α were infected with ZIKV HD78 (MOI 1), and the % of E‐positive cells was determined by flow cytometry at day 2 pi. Mean ± SEM of three independent experiments. HeLa sh‐SCR or sh‐IFITM3 cells were infected with ZIKV (MOI 1) for 2–4 days in the presence of propidium iodide (PI) for time‐lapse microscopy. The cells also expressed GFP to facilitate visualization of the cytoplasm and the vacuoles. Still images were extracted from (from HeLa sh‐IFITM3 infected cells) at the indicated time points. The area of the PI + signal was quantified for each condition. Nine fields from three independent experiments were analyzed and plotted as mean ± SEM. is a representative example of data used for quantification. The % of dead cells from 9 fields was visually scored at day 3 pi and plotted as mean. ZIKV E expression determined by flow cytometry and the proportion of cells displaying vacuoles was scored by visual examination of at least 200 cells at 24 h pi in HeLa sh‐SCR or sh‐IFITM3 cells infected with the indicated MOIs. Mean ± SEM of three independent experiments is shown. Data information: Statistical significance was determined using ANOVA and Bonferroni post‐tests. *** P < 0.001; ** P < 0.01; * P < 0.05.

Journal: The EMBO Journal

Article Title: Zika virus induces massive cytoplasmic vacuolization and paraptosis‐like death in infected cells

doi: 10.15252/embj.201695597

Figure Lengend Snippet: HeLa cells were transduced to stably express a control scrambled shRNA (sh‐SCR) or shRNA targeting IFITM3 (sh‐IFITM3). The level of endogenous IFITMs in the presence or absence of IFN‐α (1,000 IU/ml for 48 h) was assessed by Western blot. HeLa sh‐SCR or sh‐IFITM3 treated or not with IFN‐α were infected with ZIKV HD78 (MOI 1), and the % of E‐positive cells was determined by flow cytometry at day 2 pi. Mean ± SEM of three independent experiments. HeLa sh‐SCR or sh‐IFITM3 cells were infected with ZIKV (MOI 1) for 2–4 days in the presence of propidium iodide (PI) for time‐lapse microscopy. The cells also expressed GFP to facilitate visualization of the cytoplasm and the vacuoles. Still images were extracted from (from HeLa sh‐IFITM3 infected cells) at the indicated time points. The area of the PI + signal was quantified for each condition. Nine fields from three independent experiments were analyzed and plotted as mean ± SEM. is a representative example of data used for quantification. The % of dead cells from 9 fields was visually scored at day 3 pi and plotted as mean. ZIKV E expression determined by flow cytometry and the proportion of cells displaying vacuoles was scored by visual examination of at least 200 cells at 24 h pi in HeLa sh‐SCR or sh‐IFITM3 cells infected with the indicated MOIs. Mean ± SEM of three independent experiments is shown. Data information: Statistical significance was determined using ANOVA and Bonferroni post‐tests. *** P < 0.001; ** P < 0.01; * P < 0.05.

Article Snippet: The following antibodies were used: IFITM1 (Proteintech, 60074‐1‐Ig), IFITM2 (Proteintech, 66137‐1‐Ig), IFITM3 (Abcam, EPR5242/ab109429), actin (Santa Cruz Biotechnology), tubulin (Santa Cruz Biotechnology), and LC3 (MBL International PM036).

Techniques: Stable Transfection, shRNA, Western Blot, Infection, Flow Cytometry, Time-lapse Microscopy, Expressing

Effect of IFITM3 in HDFa cells. Left panel: The levels of endogenous IFITM3 were assessed by flow cytometry in HDFa transfected with a control siRNA or siRNA targeting IFITM3. Black curve: isotype control. Right panel: The cells were pretreated or not with IFN‐α (1,000 IU/ml for 48 h) and infected with ZIKV HD78 (MOI 1) for 24 h. Infected cells were scored by 4G2 staining and flow cytometry (right panel). Mean ± SEM from three independent experiments is shown. IFITM3 does not affect virus attachment to target cells. HeLa sh‐SCR or sh‐IFITM3 were incubated with ZIKV for 1 h at 4°C. The mean fluorescence intensity (MFI) of 4G2 staining was determined by flow cytometry. Black curve: isotype control. IFITM3 prevents intracellular accumulation of viral RNA. HeLa sh‐SCR or sh‐IFITM3 were infected with ZIKV for 2 or 4 h at 37°C. The black triangle indicates increasing amounts of virus (MOI 3 and 10). Virus remaining at the cell surface was removed by trypsin treatment. The cellular RNA was extracted, and RT‐qPCR was performed to quantify viral RNA. Mean ± SEM of three independent experiments. Data information: Statistical significance was determined using ANOVA test and Bonferroni post‐test. *** P < 0.001; * P < 0.05.

Journal: The EMBO Journal

Article Title: Zika virus induces massive cytoplasmic vacuolization and paraptosis‐like death in infected cells

doi: 10.15252/embj.201695597

Figure Lengend Snippet: Effect of IFITM3 in HDFa cells. Left panel: The levels of endogenous IFITM3 were assessed by flow cytometry in HDFa transfected with a control siRNA or siRNA targeting IFITM3. Black curve: isotype control. Right panel: The cells were pretreated or not with IFN‐α (1,000 IU/ml for 48 h) and infected with ZIKV HD78 (MOI 1) for 24 h. Infected cells were scored by 4G2 staining and flow cytometry (right panel). Mean ± SEM from three independent experiments is shown. IFITM3 does not affect virus attachment to target cells. HeLa sh‐SCR or sh‐IFITM3 were incubated with ZIKV for 1 h at 4°C. The mean fluorescence intensity (MFI) of 4G2 staining was determined by flow cytometry. Black curve: isotype control. IFITM3 prevents intracellular accumulation of viral RNA. HeLa sh‐SCR or sh‐IFITM3 were infected with ZIKV for 2 or 4 h at 37°C. The black triangle indicates increasing amounts of virus (MOI 3 and 10). Virus remaining at the cell surface was removed by trypsin treatment. The cellular RNA was extracted, and RT‐qPCR was performed to quantify viral RNA. Mean ± SEM of three independent experiments. Data information: Statistical significance was determined using ANOVA test and Bonferroni post‐test. *** P < 0.001; * P < 0.05.

Article Snippet: The following antibodies were used: IFITM1 (Proteintech, 60074‐1‐Ig), IFITM2 (Proteintech, 66137‐1‐Ig), IFITM3 (Abcam, EPR5242/ab109429), actin (Santa Cruz Biotechnology), tubulin (Santa Cruz Biotechnology), and LC3 (MBL International PM036).

Techniques: Flow Cytometry, Transfection, Infection, Staining, Incubation, Fluorescence, Quantitative RT-PCR

Time‐lapse analysis of the morphological changes observed in ZIKV‐infected cells. HeLa sh‐SCR and HeLa sh‐IFITM3 cells were infected with ZIKV HD78 (MOI 1) and recorded using time‐lapse microscopy. For each condition, about 20 individual cells that end up dying upon ZIKV infection were selected for further analysis. Morphological changes were visually scored for each cell. Results are representative of three independent experiments. HeLa sh‐SCR cells were infected or not with ZIKV HD78 (MOI 1) for 24 h, fixed, and stained to detect ZIKV E protein (red). One single Z slice representative of three independent experiments is shown. Scale bars: 5 μm.

Journal: The EMBO Journal

Article Title: Zika virus induces massive cytoplasmic vacuolization and paraptosis‐like death in infected cells

doi: 10.15252/embj.201695597

Figure Lengend Snippet: Time‐lapse analysis of the morphological changes observed in ZIKV‐infected cells. HeLa sh‐SCR and HeLa sh‐IFITM3 cells were infected with ZIKV HD78 (MOI 1) and recorded using time‐lapse microscopy. For each condition, about 20 individual cells that end up dying upon ZIKV infection were selected for further analysis. Morphological changes were visually scored for each cell. Results are representative of three independent experiments. HeLa sh‐SCR cells were infected or not with ZIKV HD78 (MOI 1) for 24 h, fixed, and stained to detect ZIKV E protein (red). One single Z slice representative of three independent experiments is shown. Scale bars: 5 μm.

Article Snippet: The following antibodies were used: IFITM1 (Proteintech, 60074‐1‐Ig), IFITM2 (Proteintech, 66137‐1‐Ig), IFITM3 (Abcam, EPR5242/ab109429), actin (Santa Cruz Biotechnology), tubulin (Santa Cruz Biotechnology), and LC3 (MBL International PM036).

Techniques: Infection, Time-lapse Microscopy, Staining

HeLa sh‐IFITM3 were infected with ZIKV HD78 or DV2 for 24 h or 5 days pi. Left panel: The levels of infection were determined by 4G2 staining and flow cytometry. Right panel: The proportion of cells displaying vacuoles was scored by visual examination of at least 200 cells at 24 h pi (right panel). Mean ± SEM of three independent experiments. One example of a representative field from (A) is shown for ZIKV (left) and DENV2 (right) infected cells at 24 h pi. Red arrows point to vacuole + cells. For each condition, an enlarged view of a vacuolated cell is shown. Examples of ZIKV‐ and DENV‐infected cells, with 4G2 staining and confocal microscopy analysis.

Journal: The EMBO Journal

Article Title: Zika virus induces massive cytoplasmic vacuolization and paraptosis‐like death in infected cells

doi: 10.15252/embj.201695597

Figure Lengend Snippet: HeLa sh‐IFITM3 were infected with ZIKV HD78 or DV2 for 24 h or 5 days pi. Left panel: The levels of infection were determined by 4G2 staining and flow cytometry. Right panel: The proportion of cells displaying vacuoles was scored by visual examination of at least 200 cells at 24 h pi (right panel). Mean ± SEM of three independent experiments. One example of a representative field from (A) is shown for ZIKV (left) and DENV2 (right) infected cells at 24 h pi. Red arrows point to vacuole + cells. For each condition, an enlarged view of a vacuolated cell is shown. Examples of ZIKV‐ and DENV‐infected cells, with 4G2 staining and confocal microscopy analysis.

Article Snippet: The following antibodies were used: IFITM1 (Proteintech, 60074‐1‐Ig), IFITM2 (Proteintech, 66137‐1‐Ig), IFITM3 (Abcam, EPR5242/ab109429), actin (Santa Cruz Biotechnology), tubulin (Santa Cruz Biotechnology), and LC3 (MBL International PM036).

Techniques: Infection, Staining, Flow Cytometry, Confocal Microscopy

HeLa sh‐SCR or sh‐IFITM3 cells were infected with ZIKV HD78 (MOI 1) for 24 h, fixed, and stained to detect E (red) and IFITM3 (yellow) proteins. The cells also expressed GFP to facilitate visualization of the cytoplasm and the vacuoles. One field representative of three independent experiments is shown. Detail of ZIKV‐infected cell in (A) showing large vacuoles and 4G2 staining (red). Images are average Z‐stacks of three consecutive slices. An additional example from a different field is also shown in the right panel. HeLa sh‐IFITM3 cells were infected with ZIKV HD78 (MOI 10) for 24 h, fixed, and subjected to FISH for the detection of viral ssRNA. Two examples from two fields are shown. A single Z slice is shown. Data information: Scale bars, 30 μm (A) and 5 μm (B, C).

Journal: The EMBO Journal

Article Title: Zika virus induces massive cytoplasmic vacuolization and paraptosis‐like death in infected cells

doi: 10.15252/embj.201695597

Figure Lengend Snippet: HeLa sh‐SCR or sh‐IFITM3 cells were infected with ZIKV HD78 (MOI 1) for 24 h, fixed, and stained to detect E (red) and IFITM3 (yellow) proteins. The cells also expressed GFP to facilitate visualization of the cytoplasm and the vacuoles. One field representative of three independent experiments is shown. Detail of ZIKV‐infected cell in (A) showing large vacuoles and 4G2 staining (red). Images are average Z‐stacks of three consecutive slices. An additional example from a different field is also shown in the right panel. HeLa sh‐IFITM3 cells were infected with ZIKV HD78 (MOI 10) for 24 h, fixed, and subjected to FISH for the detection of viral ssRNA. Two examples from two fields are shown. A single Z slice is shown. Data information: Scale bars, 30 μm (A) and 5 μm (B, C).

Article Snippet: The following antibodies were used: IFITM1 (Proteintech, 60074‐1‐Ig), IFITM2 (Proteintech, 66137‐1‐Ig), IFITM3 (Abcam, EPR5242/ab109429), actin (Santa Cruz Biotechnology), tubulin (Santa Cruz Biotechnology), and LC3 (MBL International PM036).

Techniques: Infection, Staining

Transmission electron microscopy (TEM) of non‐infected HeLa sh‐IFITM3 cells. TEM of ZIKV‐infected HeLa sh‐IFITM3 cells at 24 h pi displays cytoplasmic vacuolization (indicated with the letter V) and active virion production (enlarged on the right). Examples of ZIKV‐infected cells exhibiting large vacuoles. Enlarged views of dilated nuclear membranes in ZIKV‐infected cells. Data information: White arrows indicate the “membranous web” associated with viral production and/or accumulation.

Journal: The EMBO Journal

Article Title: Zika virus induces massive cytoplasmic vacuolization and paraptosis‐like death in infected cells

doi: 10.15252/embj.201695597

Figure Lengend Snippet: Transmission electron microscopy (TEM) of non‐infected HeLa sh‐IFITM3 cells. TEM of ZIKV‐infected HeLa sh‐IFITM3 cells at 24 h pi displays cytoplasmic vacuolization (indicated with the letter V) and active virion production (enlarged on the right). Examples of ZIKV‐infected cells exhibiting large vacuoles. Enlarged views of dilated nuclear membranes in ZIKV‐infected cells. Data information: White arrows indicate the “membranous web” associated with viral production and/or accumulation.

Article Snippet: The following antibodies were used: IFITM1 (Proteintech, 60074‐1‐Ig), IFITM2 (Proteintech, 66137‐1‐Ig), IFITM3 (Abcam, EPR5242/ab109429), actin (Santa Cruz Biotechnology), tubulin (Santa Cruz Biotechnology), and LC3 (MBL International PM036).

Techniques: Transmission Assay, Electron Microscopy, Infection

HeLa sh‐IFITM3 cells were infected with ZIKV HD78 (MOI 1) for 24 h, fixed, and stained for protein disulfide isomerase (PDI) (yellow). Two representative cells for each condition over three independent experiments are shown. Images are average Z‐stacks of three consecutive slices. Scale bars, 10 μm. HeLa sh‐IFITM3 cells stably expressing a fluorescent ER‐tracker (DsRed2‐ER) shown in red were infected with ZIKV HD78 (MOI 1) for 2 days for time‐lapse microscopy. Still images were extracted from at the indicated time points. HeLa sh‐IFITM3 were infected with ZIKV HD78 (MOI 0.1 or 1) for 2 h and then treated with or without mycolactone (20 nM), an inhibitor of the Sec61 translocon. After 24 h, cells were stained for viral E protein and analyzed by confocal microscopy (left panels). ZIKV E expression was determined by flow cytometry, and the proportion of cells displaying vacuoles was scored by visual examination of at least 200 cells (right). Results are mean ± SEM of three independent experiments. Statistical significance was determined by unpaired t ‐tests. *** P < 0.001. Scale bars, 10 μm. ZIKV‐induced ER stress. Levels of IRE‐I, PERK, and ATF6 mRNA were determined by RT–PCR at 24 and 48 h pi. Results are mean ± SEM for three independent experiments. Statistical significance was determined by unpaired t ‐tests. *** P < 0.001; ** P < 0.01; * P < 0.05; ns, P > 0.05.

Journal: The EMBO Journal

Article Title: Zika virus induces massive cytoplasmic vacuolization and paraptosis‐like death in infected cells

doi: 10.15252/embj.201695597

Figure Lengend Snippet: HeLa sh‐IFITM3 cells were infected with ZIKV HD78 (MOI 1) for 24 h, fixed, and stained for protein disulfide isomerase (PDI) (yellow). Two representative cells for each condition over three independent experiments are shown. Images are average Z‐stacks of three consecutive slices. Scale bars, 10 μm. HeLa sh‐IFITM3 cells stably expressing a fluorescent ER‐tracker (DsRed2‐ER) shown in red were infected with ZIKV HD78 (MOI 1) for 2 days for time‐lapse microscopy. Still images were extracted from at the indicated time points. HeLa sh‐IFITM3 were infected with ZIKV HD78 (MOI 0.1 or 1) for 2 h and then treated with or without mycolactone (20 nM), an inhibitor of the Sec61 translocon. After 24 h, cells were stained for viral E protein and analyzed by confocal microscopy (left panels). ZIKV E expression was determined by flow cytometry, and the proportion of cells displaying vacuoles was scored by visual examination of at least 200 cells (right). Results are mean ± SEM of three independent experiments. Statistical significance was determined by unpaired t ‐tests. *** P < 0.001. Scale bars, 10 μm. ZIKV‐induced ER stress. Levels of IRE‐I, PERK, and ATF6 mRNA were determined by RT–PCR at 24 and 48 h pi. Results are mean ± SEM for three independent experiments. Statistical significance was determined by unpaired t ‐tests. *** P < 0.001; ** P < 0.01; * P < 0.05; ns, P > 0.05.

Article Snippet: The following antibodies were used: IFITM1 (Proteintech, 60074‐1‐Ig), IFITM2 (Proteintech, 66137‐1‐Ig), IFITM3 (Abcam, EPR5242/ab109429), actin (Santa Cruz Biotechnology), tubulin (Santa Cruz Biotechnology), and LC3 (MBL International PM036).

Techniques: Infection, Staining, Stable Transfection, Expressing, Time-lapse Microscopy, Confocal Microscopy, Flow Cytometry, Reverse Transcription Polymerase Chain Reaction

HeLa sh‐IFITM3 were infected with ZIKV HD 78 (MOI 1) for 24 h in the presence or absence of mycolactone (20 nM) added at 2 h (mycolactone early) or 15 h pi (mycolactone late). Brefeldin A (0.5 μg/ml) was added during the 24 h of infection. The levels of infection were determined by 4G2 staining and flow cytometry. Results are mean ± SEM of three independent infections. 293T cells expressing WT Sec61 or a mutated Sec61 resistant to mycolactone (Sec61‐mut) were infected with ZIKV HD 78 (MOI 1) for 3 days in the presence or absence of mycolactone (20 nM). The levels of infection were determined by 4G2 staining and flow cytometry. Results are mean ± SEM of three independent infections. Data information: Statistical significance was determined using ANOVA and Bonferroni post‐tests. *** P < 0.001; ** P < 0.01; ns, P > 0.05.

Journal: The EMBO Journal

Article Title: Zika virus induces massive cytoplasmic vacuolization and paraptosis‐like death in infected cells

doi: 10.15252/embj.201695597

Figure Lengend Snippet: HeLa sh‐IFITM3 were infected with ZIKV HD 78 (MOI 1) for 24 h in the presence or absence of mycolactone (20 nM) added at 2 h (mycolactone early) or 15 h pi (mycolactone late). Brefeldin A (0.5 μg/ml) was added during the 24 h of infection. The levels of infection were determined by 4G2 staining and flow cytometry. Results are mean ± SEM of three independent infections. 293T cells expressing WT Sec61 or a mutated Sec61 resistant to mycolactone (Sec61‐mut) were infected with ZIKV HD 78 (MOI 1) for 3 days in the presence or absence of mycolactone (20 nM). The levels of infection were determined by 4G2 staining and flow cytometry. Results are mean ± SEM of three independent infections. Data information: Statistical significance was determined using ANOVA and Bonferroni post‐tests. *** P < 0.001; ** P < 0.01; ns, P > 0.05.

Article Snippet: The following antibodies were used: IFITM1 (Proteintech, 60074‐1‐Ig), IFITM2 (Proteintech, 66137‐1‐Ig), IFITM3 (Abcam, EPR5242/ab109429), actin (Santa Cruz Biotechnology), tubulin (Santa Cruz Biotechnology), and LC3 (MBL International PM036).

Techniques: Infection, Staining, Flow Cytometry, Expressing

A Comparison of large cytoplasmic vacuoles induced by ZIKV or cyclosporine A. HeLa sh‐IFITM3 expressing the fluorescent ER‐tracker were infected with ZIKV HD 78 (MOI 1) or treated with cyclosporin A (10 μM) for 2 days and analyzed by time‐lapse microscopy. Two representative still images for each condition are shown. B, C HeLa sh‐IFITM3 were infected with ZIKV HD 78 (MOI 1) for 24 h in the presence or absence of the pan PI3K inhibitor Wortmannin, the class 1‐specific PI3K inhibitor ZSTK474 (1 μM), the Akt inhibitor Triciribine (Akt V) (20 μM), the class 3‐specific PI3K (vps34) inhibitor SAR405 (1 μM), or the pan‐PI3K inhibitor 3MA (5 mM). (B) The percentage of E + cells was quantified with 4G2 staining and flow cytometry. (C) In parallel, the proportion of cells displaying vacuoles was scored by visual examination of at least 200 cells. Results are mean ± SEM for three independent experiments. Statistical significance was determined using unpaired t ‐tests. *** P < 0.001; ns, P > 0.05. D, E HeLa sh‐IFITM3 were infected with ZIKV HD 78 (MOI 1) for 24 or 48 h in the presence or absence of the pan‐caspase inhibitor ZVAD‐FMK. (D) The percentage of cells expressing activated caspase‐3 (left panel) and the percentage of dying cells quantified with live/dead staining (right panel) were measured by flow cytometry. The apoptosis inducer TRAIL was used as a control. (E) The percentage of E + cells was quantified with 4G2 staining and flow cytometry (left panel). In parallel, the proportion of cells displaying vacuoles was scored by visual examination of at least 200 cells (right panel). Results are mean ± SEM for three independent experiments. Statistical significance was determined using ANOVA and Bonferroni post‐tests (D) or unpaired t ‐tests (E).*** P < 0.001; * P < 0.05; ns, P > 0.05.

Journal: The EMBO Journal

Article Title: Zika virus induces massive cytoplasmic vacuolization and paraptosis‐like death in infected cells

doi: 10.15252/embj.201695597

Figure Lengend Snippet: A Comparison of large cytoplasmic vacuoles induced by ZIKV or cyclosporine A. HeLa sh‐IFITM3 expressing the fluorescent ER‐tracker were infected with ZIKV HD 78 (MOI 1) or treated with cyclosporin A (10 μM) for 2 days and analyzed by time‐lapse microscopy. Two representative still images for each condition are shown. B, C HeLa sh‐IFITM3 were infected with ZIKV HD 78 (MOI 1) for 24 h in the presence or absence of the pan PI3K inhibitor Wortmannin, the class 1‐specific PI3K inhibitor ZSTK474 (1 μM), the Akt inhibitor Triciribine (Akt V) (20 μM), the class 3‐specific PI3K (vps34) inhibitor SAR405 (1 μM), or the pan‐PI3K inhibitor 3MA (5 mM). (B) The percentage of E + cells was quantified with 4G2 staining and flow cytometry. (C) In parallel, the proportion of cells displaying vacuoles was scored by visual examination of at least 200 cells. Results are mean ± SEM for three independent experiments. Statistical significance was determined using unpaired t ‐tests. *** P < 0.001; ns, P > 0.05. D, E HeLa sh‐IFITM3 were infected with ZIKV HD 78 (MOI 1) for 24 or 48 h in the presence or absence of the pan‐caspase inhibitor ZVAD‐FMK. (D) The percentage of cells expressing activated caspase‐3 (left panel) and the percentage of dying cells quantified with live/dead staining (right panel) were measured by flow cytometry. The apoptosis inducer TRAIL was used as a control. (E) The percentage of E + cells was quantified with 4G2 staining and flow cytometry (left panel). In parallel, the proportion of cells displaying vacuoles was scored by visual examination of at least 200 cells (right panel). Results are mean ± SEM for three independent experiments. Statistical significance was determined using ANOVA and Bonferroni post‐tests (D) or unpaired t ‐tests (E).*** P < 0.001; * P < 0.05; ns, P > 0.05.

Article Snippet: The following antibodies were used: IFITM1 (Proteintech, 60074‐1‐Ig), IFITM2 (Proteintech, 66137‐1‐Ig), IFITM3 (Abcam, EPR5242/ab109429), actin (Santa Cruz Biotechnology), tubulin (Santa Cruz Biotechnology), and LC3 (MBL International PM036).

Techniques: Expressing, Infection, Time-lapse Microscopy, Staining, Flow Cytometry

The class 1 PI3K inhibitor blocks autophagy assessed by LC3 clustering in HeLa sh‐IFITM3 treated with rapamycin (5 mM) and concanamycin A (1 μM), which prevents fusion of phagosomes with lysosomes. HeLa cells expressing a shRNA control or a shRNA targeting LC3 were infected with ZIKV HD78 (moi 1) for 24 h, and the % of E + cells as well as the % of vacuole‐containing cells were quantified by flow cytometry and microscopy, respectively. The efficiency of silencing was assessed by Western blot (left panel). Results are shown as mean ± SEM from three independent experiments.

Journal: The EMBO Journal

Article Title: Zika virus induces massive cytoplasmic vacuolization and paraptosis‐like death in infected cells

doi: 10.15252/embj.201695597

Figure Lengend Snippet: The class 1 PI3K inhibitor blocks autophagy assessed by LC3 clustering in HeLa sh‐IFITM3 treated with rapamycin (5 mM) and concanamycin A (1 μM), which prevents fusion of phagosomes with lysosomes. HeLa cells expressing a shRNA control or a shRNA targeting LC3 were infected with ZIKV HD78 (moi 1) for 24 h, and the % of E + cells as well as the % of vacuole‐containing cells were quantified by flow cytometry and microscopy, respectively. The efficiency of silencing was assessed by Western blot (left panel). Results are shown as mean ± SEM from three independent experiments.

Article Snippet: The following antibodies were used: IFITM1 (Proteintech, 60074‐1‐Ig), IFITM2 (Proteintech, 66137‐1‐Ig), IFITM3 (Abcam, EPR5242/ab109429), actin (Santa Cruz Biotechnology), tubulin (Santa Cruz Biotechnology), and LC3 (MBL International PM036).

Techniques: Expressing, shRNA, Infection, Flow Cytometry, Microscopy, Western Blot

A Cell viability of siRNA‐transfected U87‐MG/CD4/CXCR4 cells was assessed 72 h post‐transfection by measuring ATP levels. Data represent the mean ± S.E.M of 3 biological replicates. B U87‐MG/CD4/CXR4 cells were transfected with siRNAs, pre‐treated or not with IFN and infected with WT HIV‐1 (NL4‐3) in the presence or not of reverse transcription inhibitors (AZT/3TC). 48 h later, cells were lysed, RNA extracted and RT‐qPCR analysis performed to measure HIV‐1 RNAs. Data represent the mean ± S.E.M of 4 biological replicates. Two‐way ANOVA on log‐transformed data with Sidak's test. C Supernatants from (B) were harvested 48 h post‐infection and AlphaLisa used to measure CA p24 Gag production. Data represent the mean ± S.E.M of 4 biological replicates. Two‐tailed, unpaired t test. D RT‐qPCR analysis was performed RNA samples from (B) to measure relative expression of the ISG OAS1, ISG15, and MX1 (normalized to actin and GAPDH). Data represent the mean ± S.E.M of 4 biological replicates. Two‐way ANOVA with Dunnett's test. E U87‐MG/CD4/CXCR4 cells were transduced to express Cas9 and sgRNAs either targeting nothing (CTRL) or IRF9 and STAT1 (IRF9/STAT1). After 2 weeks, cells were treated or not with IFN, and, 48 h later, IFITM3 and MX2 induction was analyzed by immunoblotting, Actin served as a loading control. A representative immunoblot is shown. F siRNA‐transfected MDMs were harvested 48 h post‐transfection for RNA extraction and quantification of DDX42 mRNA levels by RT‐qPCR. Actin and GAPDH were used as endogenous controls. Data represent the mean ± S.E.M of 3 biological replicates performed with cells from different blood donors (parallel samples from Fig ). One‐way ANOVA with Dunnett's test. G U87‐MG/CD4/CXCR4 cells were transduced with lentiviral vectors expressing either Firefly (negative control), WT DDX42 (WT) or a motif I point mutant, which has an impaired ATPase activity (K303E). Transduced cells were infected with HIV‐1 Renilla (NL4‐3/Nef‐IRES‐Renilla) and the infection efficiency was assessed 24 h later by measuring Renilla activity. Data represent the mean ± S.E.M of 3 biological replicates. Two‐way ANOVA on log‐transformed data with Dunnett's test. Data information: P values are denoted as follow: ns, not significant, * P < 0.05, ** P < 0.01, *** P < 0.001. Source data are available online for this figure.

Journal: EMBO Reports

Article Title: The DEAD box RNA helicase DDX42 is an intrinsic inhibitor of positive‐strand RNA viruses

doi: 10.15252/embr.202154061

Figure Lengend Snippet: A Cell viability of siRNA‐transfected U87‐MG/CD4/CXCR4 cells was assessed 72 h post‐transfection by measuring ATP levels. Data represent the mean ± S.E.M of 3 biological replicates. B U87‐MG/CD4/CXR4 cells were transfected with siRNAs, pre‐treated or not with IFN and infected with WT HIV‐1 (NL4‐3) in the presence or not of reverse transcription inhibitors (AZT/3TC). 48 h later, cells were lysed, RNA extracted and RT‐qPCR analysis performed to measure HIV‐1 RNAs. Data represent the mean ± S.E.M of 4 biological replicates. Two‐way ANOVA on log‐transformed data with Sidak's test. C Supernatants from (B) were harvested 48 h post‐infection and AlphaLisa used to measure CA p24 Gag production. Data represent the mean ± S.E.M of 4 biological replicates. Two‐tailed, unpaired t test. D RT‐qPCR analysis was performed RNA samples from (B) to measure relative expression of the ISG OAS1, ISG15, and MX1 (normalized to actin and GAPDH). Data represent the mean ± S.E.M of 4 biological replicates. Two‐way ANOVA with Dunnett's test. E U87‐MG/CD4/CXCR4 cells were transduced to express Cas9 and sgRNAs either targeting nothing (CTRL) or IRF9 and STAT1 (IRF9/STAT1). After 2 weeks, cells were treated or not with IFN, and, 48 h later, IFITM3 and MX2 induction was analyzed by immunoblotting, Actin served as a loading control. A representative immunoblot is shown. F siRNA‐transfected MDMs were harvested 48 h post‐transfection for RNA extraction and quantification of DDX42 mRNA levels by RT‐qPCR. Actin and GAPDH were used as endogenous controls. Data represent the mean ± S.E.M of 3 biological replicates performed with cells from different blood donors (parallel samples from Fig ). One‐way ANOVA with Dunnett's test. G U87‐MG/CD4/CXCR4 cells were transduced with lentiviral vectors expressing either Firefly (negative control), WT DDX42 (WT) or a motif I point mutant, which has an impaired ATPase activity (K303E). Transduced cells were infected with HIV‐1 Renilla (NL4‐3/Nef‐IRES‐Renilla) and the infection efficiency was assessed 24 h later by measuring Renilla activity. Data represent the mean ± S.E.M of 3 biological replicates. Two‐way ANOVA on log‐transformed data with Dunnett's test. Data information: P values are denoted as follow: ns, not significant, * P < 0.05, ** P < 0.01, *** P < 0.001. Source data are available online for this figure.

Article Snippet: Cell pellets were lysed in sample buffer (10 mM Tris–HCl pH7.6, 150 mM NaCl, 1% Triton X100, 1 mM EDTA, 0.1% deoxycholate, 2% SDS, 5% Glycerol, 100 mM DTT, 0.02% bromophenol blue), resolved by SDS–PAGE and analyzed by immunoblotting using primary antibodies specific for human DDX42 (HPA023571, Sigma‐Aldrich; dilution 1/300), Flag (M2, Sigma‐Aldrich; 1/1,000), MX1 (PA5‐22101, ThermoFisher Scientific; 1/1,000), MX2 (HPA030235, Sigma‐Aldrich; 1/1,000), IFITM3 (11714‐1‐AP, ProteinTech; 1/1,000), and Actin (A1978, Sigma‐Aldrich; 1/5,000), followed by secondary horseradish peroxidase‐conjugated anti‐mouse or anti‐rabbit immunoglobulin antibodies and chemiluminescence (Bio‐Rad).

Techniques: Transfection, Infection, Reverse Transcription, Quantitative RT-PCR, Transformation Assay, Two Tailed Test, Expressing, Western Blot, Control, RNA Extraction, Transduction, Negative Control, Mutagenesis, Activity Assay

A DDX42 silencing efficiency in U87‐MG, A549‐ACE2, Huh‐7 and Huh‐7.5.1 cells. B Relative ZIKV PF13 infection efficiency in siRNA‐transfected Huh‐7 cells analyzed by flow cytometry. Two‐way ANOVA with Sidak's test on log‐transformed data. C ZIKV PF13 infection efficiency in control (CTRL) and IFN‐treated, siRNA‐transfected U87‐MG cells analyzed by RT‐qPCR and expressed as genome equivalents (GE) per μg of total cellular RNA. Two‐way ANOVA with Sidak's test on log‐transformed data. D JEV infection efficiency in control (CTRL) and IFN‐treated, siRNA‐transfected U87‐MG cells analyzed by RT‐qPCR by RT‐qPCR and expressed as genome equivalents (GE) per μg of total cellular RNA. Two‐way ANOVA with Sidak's test on log‐transformed data. E Relative expression of the ISGs OAS1, ISG15, and MX1 (normalized to actin and GAPDH) measured by RT‐qPCR in parallel samples from (C) and (D). Two‐way ANOVA with Dunnett's test. F Relative YFV infection efficiency in siRNA‐transfected Huh‐7 cells analyzed by flow cytometry. Two‐way ANOVA with Sidak's test on log‐transformed data. G Relative DENV‐2 infection efficiency in siRNA‐transfected Huh‐7 cells analyzed by flow cytometry. Two‐way ANOVA with Sidak's test on log‐transformed data. H Relative expression of the ISGs OAS1, ISG15, and MX1 (normalized to actin and GAPDH) measured by RT‐qPCR in parallel samples from Fig . Two‐way ANOVA with Dunnett's test. I CTRL and IRF9/STAT1 KO A549‐ACE2 cells were pre‐treated or not with IFN for 24 h and lysed for immunoblot analysis to measure MX1 and IFITM3 induction, Actin served as a loading control. A representative immunoblot is shown. Data information: (A–H). Mean ± SEM of 3 biological replicates (4 for the silencing efficiency in A549‐ACE2 cells). P values are denoted as follow: ns, not significant, * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. Source data are available online for this figure.

Journal: EMBO Reports

Article Title: The DEAD box RNA helicase DDX42 is an intrinsic inhibitor of positive‐strand RNA viruses

doi: 10.15252/embr.202154061

Figure Lengend Snippet: A DDX42 silencing efficiency in U87‐MG, A549‐ACE2, Huh‐7 and Huh‐7.5.1 cells. B Relative ZIKV PF13 infection efficiency in siRNA‐transfected Huh‐7 cells analyzed by flow cytometry. Two‐way ANOVA with Sidak's test on log‐transformed data. C ZIKV PF13 infection efficiency in control (CTRL) and IFN‐treated, siRNA‐transfected U87‐MG cells analyzed by RT‐qPCR and expressed as genome equivalents (GE) per μg of total cellular RNA. Two‐way ANOVA with Sidak's test on log‐transformed data. D JEV infection efficiency in control (CTRL) and IFN‐treated, siRNA‐transfected U87‐MG cells analyzed by RT‐qPCR by RT‐qPCR and expressed as genome equivalents (GE) per μg of total cellular RNA. Two‐way ANOVA with Sidak's test on log‐transformed data. E Relative expression of the ISGs OAS1, ISG15, and MX1 (normalized to actin and GAPDH) measured by RT‐qPCR in parallel samples from (C) and (D). Two‐way ANOVA with Dunnett's test. F Relative YFV infection efficiency in siRNA‐transfected Huh‐7 cells analyzed by flow cytometry. Two‐way ANOVA with Sidak's test on log‐transformed data. G Relative DENV‐2 infection efficiency in siRNA‐transfected Huh‐7 cells analyzed by flow cytometry. Two‐way ANOVA with Sidak's test on log‐transformed data. H Relative expression of the ISGs OAS1, ISG15, and MX1 (normalized to actin and GAPDH) measured by RT‐qPCR in parallel samples from Fig . Two‐way ANOVA with Dunnett's test. I CTRL and IRF9/STAT1 KO A549‐ACE2 cells were pre‐treated or not with IFN for 24 h and lysed for immunoblot analysis to measure MX1 and IFITM3 induction, Actin served as a loading control. A representative immunoblot is shown. Data information: (A–H). Mean ± SEM of 3 biological replicates (4 for the silencing efficiency in A549‐ACE2 cells). P values are denoted as follow: ns, not significant, * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. Source data are available online for this figure.

Article Snippet: Cell pellets were lysed in sample buffer (10 mM Tris–HCl pH7.6, 150 mM NaCl, 1% Triton X100, 1 mM EDTA, 0.1% deoxycholate, 2% SDS, 5% Glycerol, 100 mM DTT, 0.02% bromophenol blue), resolved by SDS–PAGE and analyzed by immunoblotting using primary antibodies specific for human DDX42 (HPA023571, Sigma‐Aldrich; dilution 1/300), Flag (M2, Sigma‐Aldrich; 1/1,000), MX1 (PA5‐22101, ThermoFisher Scientific; 1/1,000), MX2 (HPA030235, Sigma‐Aldrich; 1/1,000), IFITM3 (11714‐1‐AP, ProteinTech; 1/1,000), and Actin (A1978, Sigma‐Aldrich; 1/5,000), followed by secondary horseradish peroxidase‐conjugated anti‐mouse or anti‐rabbit immunoglobulin antibodies and chemiluminescence (Bio‐Rad).

Techniques: Infection, Transfection, Flow Cytometry, Transformation Assay, Control, Quantitative RT-PCR, Expressing, Western Blot

MYCT1 is a transmembrane phosphoglycoprotein that interacts with IFITM2/3. (A) Endogenous MYCT1 is located at cell–cell junctions (arrow) and in puncta (arrowhead). Staining of human primary ECs for MYCT1 (black), VE-cadherin (magenta), and DNA (blue). Scale bar, 10 µm. (B) MYCT1 is a membrane protein. Western blot analysis of various EC fractions for MYCT1, GAPDH, PECAM1, H3K27ac, and vimentin proteins. Cy, cytoplasm; Mb, membrane; Nu, nucleus; Ck, cytoskeleton. (C) MYCT1 is glycosylated. Western blot analysis of MYCT1 protein electrophoretic mobility in control and PNGase-F–treated lysates. (D) Schematic model of MYCT1 structure and domains with phosphorylation sites, identified by mass spectrometry. MYCT1 phosphorylation sites are highly conserved as indicated by the color scale. Asterisks indicate sites also described at https://www.phosphosite.org/ . (E) Top five proteins interacting with MYCT1 as identified by mass spectrometry, among which IFITM2 and IFITM3. ECs were transduced with recombinant adenoviruses to transiently overexpress MYCT1 or GFP, as a control. Cell lysates were collected 48 h after transduction, immunoprecipitated using MYCT1 antibody or a control IgG, and analyzed by mass spectrometry. Proteins interacting with both endogenous and overexpressed MYCT1 were selected and ranked by normalized spectral abundance factor (NSAF) from two independent mass spectrometry (MS) experiments are shown (31 proteins); the top five proteins are highlighted in magenta. (F) GO terms of the cellular component and biological process overrepresented in the MYCT1 interactome. Fisher’s exact test with adjustment for false discovery rate (FDR). (G) Validation of IFITM2/3 and MYCT1 interaction by co-IP. EC lysates from confluent ECs were immunoprecipitated (IP) with MYCT1 or control IgG and blotted for IFITM2/3. H, IgG heavy chain; L, IgG light chain. (H) IFITM2/3 are constitutively expressed in ECs in vitro and in vivo . Staining of human primary ECs (upper panels), human brain and WAT sections (lower panels) for MYCT1 (gray), IFITM2/3 (green), VE-cadherin (magenta), and DNA (blue). Scale bar, 20 µm (brain) and 50 µm (adipose tissue). (I) MYCT1 and IFITM2/3 interact in brain ECs. Proximity ligation assay (PLA) in human brain sections. Detection of PLA dots (gray) in ECs and staining for VE-cadherin (magenta) and DNA (blue). Arrowheads, colocalization of MYCT1::IFITM2/3 PLA dots and VE-cadherin staining. Scale bar, 20 µm. See also . Source data are available for this figure: .

Journal: The Journal of Experimental Medicine

Article Title: MYCT1–IFITM2/3 interaction links endothelial endolysosomal trafficking to white adipose tissue expansion

doi: 10.1084/jem.20251497

Figure Lengend Snippet: MYCT1 is a transmembrane phosphoglycoprotein that interacts with IFITM2/3. (A) Endogenous MYCT1 is located at cell–cell junctions (arrow) and in puncta (arrowhead). Staining of human primary ECs for MYCT1 (black), VE-cadherin (magenta), and DNA (blue). Scale bar, 10 µm. (B) MYCT1 is a membrane protein. Western blot analysis of various EC fractions for MYCT1, GAPDH, PECAM1, H3K27ac, and vimentin proteins. Cy, cytoplasm; Mb, membrane; Nu, nucleus; Ck, cytoskeleton. (C) MYCT1 is glycosylated. Western blot analysis of MYCT1 protein electrophoretic mobility in control and PNGase-F–treated lysates. (D) Schematic model of MYCT1 structure and domains with phosphorylation sites, identified by mass spectrometry. MYCT1 phosphorylation sites are highly conserved as indicated by the color scale. Asterisks indicate sites also described at https://www.phosphosite.org/ . (E) Top five proteins interacting with MYCT1 as identified by mass spectrometry, among which IFITM2 and IFITM3. ECs were transduced with recombinant adenoviruses to transiently overexpress MYCT1 or GFP, as a control. Cell lysates were collected 48 h after transduction, immunoprecipitated using MYCT1 antibody or a control IgG, and analyzed by mass spectrometry. Proteins interacting with both endogenous and overexpressed MYCT1 were selected and ranked by normalized spectral abundance factor (NSAF) from two independent mass spectrometry (MS) experiments are shown (31 proteins); the top five proteins are highlighted in magenta. (F) GO terms of the cellular component and biological process overrepresented in the MYCT1 interactome. Fisher’s exact test with adjustment for false discovery rate (FDR). (G) Validation of IFITM2/3 and MYCT1 interaction by co-IP. EC lysates from confluent ECs were immunoprecipitated (IP) with MYCT1 or control IgG and blotted for IFITM2/3. H, IgG heavy chain; L, IgG light chain. (H) IFITM2/3 are constitutively expressed in ECs in vitro and in vivo . Staining of human primary ECs (upper panels), human brain and WAT sections (lower panels) for MYCT1 (gray), IFITM2/3 (green), VE-cadherin (magenta), and DNA (blue). Scale bar, 20 µm (brain) and 50 µm (adipose tissue). (I) MYCT1 and IFITM2/3 interact in brain ECs. Proximity ligation assay (PLA) in human brain sections. Detection of PLA dots (gray) in ECs and staining for VE-cadherin (magenta) and DNA (blue). Arrowheads, colocalization of MYCT1::IFITM2/3 PLA dots and VE-cadherin staining. Scale bar, 20 µm. See also . Source data are available for this figure: .

Article Snippet: IFITM3 (human) reverse , Eurofins , 5′-CCA GCA CAG CCA CCT CG-3′.

Techniques: Staining, Membrane, Western Blot, Control, Phospho-proteomics, Mass Spectrometry, Transduction, Recombinant, Immunoprecipitation, Biomarker Discovery, Co-Immunoprecipitation Assay, In Vitro, In Vivo, Proximity Ligation Assay

MYCT1 restricts endothelial endocytosis and IFITM2/3-dependent mTORC1 activation, related to Figs. 6 and 7. (A) IFITM2/3 antibody and siRNA validation for identification of endogenous human IFITM2/3 proteins. IFITM2/3 knockdown reduces MYCT1 protein levels. Staining of ECs for MYCT1 (gray), IFITM2/3 (green), and DNA (blue). Scale bar, 20 µm. (B) Quantification of MYCT1 protein levels in control and IFITM2/3 KD cells. n = 4 independent experiments; mean ± SD; Welch’s t test, P = 0.0014 (*). (C and D) MYCT1 knockdown does not affect IFITM2 (C) nor IFITM3 (D) mRNA levels in ECs. n = 3 independent experiments; mean ± SD; Welch’s t test, P > 0.05. (E) MYCT1 knockdown does not impact RAB7 + late endosomes nor LAMP1 + endolysosomes. Staining of ECs for RAB7 (gray), LAMP1 (green), VE-cadherin (magenta), and DNA (blue). Scale bar, 20 µm. (F and G) Quantification of RAB7 + (F) and LAMP1 + (G) areas per cell in control and MYCT1 KD cells. n = 3 independent experiments; 20–50 cells were analyzed per condition for each experiment; mean ± SD; Welch’s t test, P > 0.05. (H) MYCT1 knockdown increased FITC-dextran uptake. 2 days after siRNA transfection, cells were starved for 1 h in PBS, followed by a 30-min induction with amino acid solution together with 10-kDa FITC dextran. Detection of 10-kDa FITC-dextran (gray) and staining of ECs for VE-cadherin (magenta) and DAPI (blue). Arrow, dextran + puncta. Scale bar, 10 μm. (I) Quantification of the number of dextran + puncta per cell in control and MYCT1 KD cells. n = 3 independent experiments; 30–50 cells were analyzed per condition for each experiment; mean ± SD; Welch’s t test, P = 0.0016 (*). (J) Example of gating strategy (7-AAD neg CD45 neg CD31 + ) of ECs from gonadal fat pad by flow cytometry. (K) WAT ECs take up higher amounts of labeled plasma proteins compared with colon ECs. Quantification of labeled plasma protein uptake in ECs from s.c. and visceral WAT and colon normalized to plasma Atto-647 signal. n = 10 mice per organ; Friedman test with Dunn’s multiple comparisons test, P > 0.05 for scFAT versus visFAT, P = 0.0052 for scFAT versus colon, and P = 0.001 (*) for visFAT versus colon. (L) Endocytosis inhibition with dynasore rescues mTORC1 hyperactivation caused by knockdown of MYCT1 . Staining for p-S6 (gray), β-catenin (magenta), and DAPI (blue). Scale bar, 50 μm. (M) Quantification of mTORC1 activation by amino acid supplementation in control and MYCT1 KD cells in the absence or presence of dynasore. The percentage of p-S6 + cells was quantified in the indicated conditions. n = 3 independent experiments; 1,500–6,000 cells were analyzed per condition for each experiment; mean ± SD; two-way ANOVA with Tukey’s multiple comparisons test, P = 0.004 (*) for MYCT1 knockdown effect in control conditions and P < 0.001 (*) for its rescue by dynasore treatment. (N) RAB5 knockdown rescues mTORC1 hyperactivation in MYCT1 KD cells. Staining of ECs for p-S6 (gray), β-catenin (magenta), and DAPI (blue). Scale bar, 50 μm. (O) Quantification of mTORC1 activation in control, MYCT1 KD , and MYCT1-RAB5 KD cells. The percentage of p-S6 + cells was quantified in the indicated conditions. n = 3 independent experiments; 7,000-15,000 cells were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Tukey’s multiple comparisons test, P = 0.0021 (*) for MYCT1 knockdown effect and P = 0.0292 (*) for its rescue by RAB5 double knockdown. (P) IFITM2/3 knockdown rescues mTORC1 hyperactivation in MYCT1 -deficient human adipose ECs. Staining for p-S6 (gray), β-catenin (magenta), and DAPI (blue). Scale bar, 100 μm. (Q) Quantification of mTORC1 activation in control, MYCT1 KD , IFITM2/3 KD , and MYCT1 – IFITM2/3 KD cells. The percentage of p-S6 + cells was quantified in the indicated conditions. n = 2 independent experiments; 1,500–3,000 cells were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Tukey’s multiple comparisons test, P = 0.0168 (*) for MYCT1 knockdown effect and P = 0.0123 (*) for rescue effect by IFITM2/3 double knockdown.

Journal: The Journal of Experimental Medicine

Article Title: MYCT1–IFITM2/3 interaction links endothelial endolysosomal trafficking to white adipose tissue expansion

doi: 10.1084/jem.20251497

Figure Lengend Snippet: MYCT1 restricts endothelial endocytosis and IFITM2/3-dependent mTORC1 activation, related to Figs. 6 and 7. (A) IFITM2/3 antibody and siRNA validation for identification of endogenous human IFITM2/3 proteins. IFITM2/3 knockdown reduces MYCT1 protein levels. Staining of ECs for MYCT1 (gray), IFITM2/3 (green), and DNA (blue). Scale bar, 20 µm. (B) Quantification of MYCT1 protein levels in control and IFITM2/3 KD cells. n = 4 independent experiments; mean ± SD; Welch’s t test, P = 0.0014 (*). (C and D) MYCT1 knockdown does not affect IFITM2 (C) nor IFITM3 (D) mRNA levels in ECs. n = 3 independent experiments; mean ± SD; Welch’s t test, P > 0.05. (E) MYCT1 knockdown does not impact RAB7 + late endosomes nor LAMP1 + endolysosomes. Staining of ECs for RAB7 (gray), LAMP1 (green), VE-cadherin (magenta), and DNA (blue). Scale bar, 20 µm. (F and G) Quantification of RAB7 + (F) and LAMP1 + (G) areas per cell in control and MYCT1 KD cells. n = 3 independent experiments; 20–50 cells were analyzed per condition for each experiment; mean ± SD; Welch’s t test, P > 0.05. (H) MYCT1 knockdown increased FITC-dextran uptake. 2 days after siRNA transfection, cells were starved for 1 h in PBS, followed by a 30-min induction with amino acid solution together with 10-kDa FITC dextran. Detection of 10-kDa FITC-dextran (gray) and staining of ECs for VE-cadherin (magenta) and DAPI (blue). Arrow, dextran + puncta. Scale bar, 10 μm. (I) Quantification of the number of dextran + puncta per cell in control and MYCT1 KD cells. n = 3 independent experiments; 30–50 cells were analyzed per condition for each experiment; mean ± SD; Welch’s t test, P = 0.0016 (*). (J) Example of gating strategy (7-AAD neg CD45 neg CD31 + ) of ECs from gonadal fat pad by flow cytometry. (K) WAT ECs take up higher amounts of labeled plasma proteins compared with colon ECs. Quantification of labeled plasma protein uptake in ECs from s.c. and visceral WAT and colon normalized to plasma Atto-647 signal. n = 10 mice per organ; Friedman test with Dunn’s multiple comparisons test, P > 0.05 for scFAT versus visFAT, P = 0.0052 for scFAT versus colon, and P = 0.001 (*) for visFAT versus colon. (L) Endocytosis inhibition with dynasore rescues mTORC1 hyperactivation caused by knockdown of MYCT1 . Staining for p-S6 (gray), β-catenin (magenta), and DAPI (blue). Scale bar, 50 μm. (M) Quantification of mTORC1 activation by amino acid supplementation in control and MYCT1 KD cells in the absence or presence of dynasore. The percentage of p-S6 + cells was quantified in the indicated conditions. n = 3 independent experiments; 1,500–6,000 cells were analyzed per condition for each experiment; mean ± SD; two-way ANOVA with Tukey’s multiple comparisons test, P = 0.004 (*) for MYCT1 knockdown effect in control conditions and P < 0.001 (*) for its rescue by dynasore treatment. (N) RAB5 knockdown rescues mTORC1 hyperactivation in MYCT1 KD cells. Staining of ECs for p-S6 (gray), β-catenin (magenta), and DAPI (blue). Scale bar, 50 μm. (O) Quantification of mTORC1 activation in control, MYCT1 KD , and MYCT1-RAB5 KD cells. The percentage of p-S6 + cells was quantified in the indicated conditions. n = 3 independent experiments; 7,000-15,000 cells were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Tukey’s multiple comparisons test, P = 0.0021 (*) for MYCT1 knockdown effect and P = 0.0292 (*) for its rescue by RAB5 double knockdown. (P) IFITM2/3 knockdown rescues mTORC1 hyperactivation in MYCT1 -deficient human adipose ECs. Staining for p-S6 (gray), β-catenin (magenta), and DAPI (blue). Scale bar, 100 μm. (Q) Quantification of mTORC1 activation in control, MYCT1 KD , IFITM2/3 KD , and MYCT1 – IFITM2/3 KD cells. The percentage of p-S6 + cells was quantified in the indicated conditions. n = 2 independent experiments; 1,500–3,000 cells were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Tukey’s multiple comparisons test, P = 0.0168 (*) for MYCT1 knockdown effect and P = 0.0123 (*) for rescue effect by IFITM2/3 double knockdown.

Article Snippet: IFITM3 (human) reverse , Eurofins , 5′-CCA GCA CAG CCA CCT CG-3′.

Techniques: Activation Assay, Biomarker Discovery, Knockdown, Staining, Control, Transfection, Flow Cytometry, Labeling, Clinical Proteomics, Inhibition

qPCR analysis. Cells were infected or mock-infected with rAd5-IFITM3 or wtAd5 at an MOI of 100 for 24 h, followed by infection of H5N1 with 10-fold dilution (MOI = 1). Total RNA was extracted from the cells at 0, 6, 12 and 24 hpi of H5N1 infection and reverse transcribed. Thereafter, the qPCR was performed using specific primer targeting M2 gene of H5N1. (A) A549, (B) MDCK.

Journal: International Journal of Biological Macromolecules

Article Title: Construction, expression and antiviral activity analysis of recombinant adenovirus expressing human IFITM3 in vitro

doi: 10.1016/j.ijbiomac.2019.03.161

Figure Lengend Snippet: qPCR analysis. Cells were infected or mock-infected with rAd5-IFITM3 or wtAd5 at an MOI of 100 for 24 h, followed by infection of H5N1 with 10-fold dilution (MOI = 1). Total RNA was extracted from the cells at 0, 6, 12 and 24 hpi of H5N1 infection and reverse transcribed. Thereafter, the qPCR was performed using specific primer targeting M2 gene of H5N1. (A) A549, (B) MDCK.

Article Snippet: Real time PCR was performed using GoTaq qPCR Master Mix (Promega, USA) with primers targeting human IFITM3 (qFp3: 5′-ATGTCGTCTGGTCCCTGTTC-3′; qRp3: 5′-GTCATGAGGATGCCCAGAAT-3′), H5N1 M2 gene (F: CTCTTGTTGCCACAAGTAT; R: TCCGTAGAAGGCCCTCTTTTC) and GAPDH (qFp: 5′-ACCCACTCCTCCACCTTTG AC-3′; qRp:5′-TGTTGCTGTAGCCAAATTCGTT-3′), respectively, described previously [ , ].

Techniques: Infection, Reverse Transcription

Subcellular quantitative proteomic analysis of herpes simplex virus type 1 (HSV-1)-infected HEK 293T cells. ( A ) Intracellular levels of HSV-1 genome DNA and IFNB1 and ISG56 mRNAs in HSV-1 infected HEK 293T cells. Mock- or HSV-1 (MOI = 5)-infected HEK 293T cells were harvested at 4 h p.i. and 20 h p.i. Total RNA was extracted and reverse transcribed into the cDNA to quantify the intracellular mRNA level of IFNB1 and ISG56 using quantitative RT-PCR. The total DNA was extracted, and the intracellular DNA level of the HSV-1 genome was measured with quantitative RT-PCR. ( B ) The MS analysis workflow of the stable isotope-labeled amino acid culture (SILAC). ( C ) Confirming the subcellular fractionation efficiency by Western blot. Cytoplasmic and nuclear fractions from the three biological replicates (R1, R2, and R3) were subjected to Western blot analyses. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and lamin B1 were used as markers of cytoplasmic and nuclear proteins, respectively. H: hours.

Journal: Molecules

Article Title: A Subcellular Quantitative Proteomic Analysis of Herpes Simplex Virus Type 1-Infected HEK 293T Cells

doi: 10.3390/molecules24234215

Figure Lengend Snippet: Subcellular quantitative proteomic analysis of herpes simplex virus type 1 (HSV-1)-infected HEK 293T cells. ( A ) Intracellular levels of HSV-1 genome DNA and IFNB1 and ISG56 mRNAs in HSV-1 infected HEK 293T cells. Mock- or HSV-1 (MOI = 5)-infected HEK 293T cells were harvested at 4 h p.i. and 20 h p.i. Total RNA was extracted and reverse transcribed into the cDNA to quantify the intracellular mRNA level of IFNB1 and ISG56 using quantitative RT-PCR. The total DNA was extracted, and the intracellular DNA level of the HSV-1 genome was measured with quantitative RT-PCR. ( B ) The MS analysis workflow of the stable isotope-labeled amino acid culture (SILAC). ( C ) Confirming the subcellular fractionation efficiency by Western blot. Cytoplasmic and nuclear fractions from the three biological replicates (R1, R2, and R3) were subjected to Western blot analyses. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and lamin B1 were used as markers of cytoplasmic and nuclear proteins, respectively. H: hours.

Article Snippet: A mouse monoclonal antibody against GAPDH (ABclonal, Wuhan, China), a rabbit monoclonal antibody against IFITM3 (CST, Danvers, MA, USA), and a rabbit polyclonal antibody against IRF3 (Proteintech) and Lamin B1 (Proteintech) were purchased from indicated companies.

Techniques: Virus, Infection, Reverse Transcription, Quantitative RT-PCR, Labeling, Multiplex sample analysis, Fractionation, Western Blot

Validation of the protein regulation data by quantitative RT-PCR and Western blots. ( A ) Western blot analysis of the host proteins. Proteins from the cytoplasmic and nuclear fractions of the mock- or HSV-1-infected (MOI = 5) HEK 293T cells were extracted for Western blot analysis. Lamin B1 and GAPDH were used as internal controls for nuclear (nucleo) and cytoplasmic (cyto) proteins, respectively. ( B ) Quantitative RT-PCR analysis of the intracellular mRNA level of selected proteins. Mock- or HSV-1-infected (MOI = 5) HEK 293T cells were harvested, and the total mRNA was extracted and reverse transcribed into cDNA for quantitative RT-PCR analysis. The values are presented as the mean ± SD of three replicates. ( C ) SILAC-MS data for selected proteins. ND: not detected; H: hours.

Journal: Molecules

Article Title: A Subcellular Quantitative Proteomic Analysis of Herpes Simplex Virus Type 1-Infected HEK 293T Cells

doi: 10.3390/molecules24234215

Figure Lengend Snippet: Validation of the protein regulation data by quantitative RT-PCR and Western blots. ( A ) Western blot analysis of the host proteins. Proteins from the cytoplasmic and nuclear fractions of the mock- or HSV-1-infected (MOI = 5) HEK 293T cells were extracted for Western blot analysis. Lamin B1 and GAPDH were used as internal controls for nuclear (nucleo) and cytoplasmic (cyto) proteins, respectively. ( B ) Quantitative RT-PCR analysis of the intracellular mRNA level of selected proteins. Mock- or HSV-1-infected (MOI = 5) HEK 293T cells were harvested, and the total mRNA was extracted and reverse transcribed into cDNA for quantitative RT-PCR analysis. The values are presented as the mean ± SD of three replicates. ( C ) SILAC-MS data for selected proteins. ND: not detected; H: hours.

Article Snippet: A mouse monoclonal antibody against GAPDH (ABclonal, Wuhan, China), a rabbit monoclonal antibody against IFITM3 (CST, Danvers, MA, USA), and a rabbit polyclonal antibody against IRF3 (Proteintech) and Lamin B1 (Proteintech) were purchased from indicated companies.

Techniques: Biomarker Discovery, Quantitative RT-PCR, Western Blot, Infection, Reverse Transcription, Multiplex sample analysis