Journal: PLOS Pathogens

Article Title: IFITM1 enhances nonenveloped viral RNA replication by facilitating cholesterol transport to the Golgi

doi: 10.1371/journal.ppat.1011383

Figure Lengend Snippet: Vero (A), 293 (B), and HeLa (C) cells were incubated with the indicated concentrations of IFN-α for 24 h and then transfected with AiV replicon RNA. At the indicated time points after transfection, cell lysates were harvested, and luciferase activity was measured. Each right panel represents the protein levels of IFITM1, IFITM2, or IFITM3 by immunoblotting for cell lysates harvested from experiments shown in the left panels. Data are the means ±SD of at least three independent experiments. *, P < 0.05; **, P < 0.001; ***, P < 0.0001.

Article Snippet: The coding regions of IFITM1, IFITM2, and IFITM3 were amplified by PCR using primer pairs containing MluI – EcoRV sites from cDNA clones (OriGene; IFITM1: RC201617, IFITM2: RC202067, IFITM3: RC201635), respectively, and then inserted into the same sites of pACT and pBIND, resulting in pACT-IFITM1, pACT-IFITM2, pACT-IFITM3, pBIND-IFITM1, pBIND-IFITM2, and pBIND-IFITM3.

Techniques: Incubation, Transfection, Luciferase, Activity Assay, Western Blot

Journal: PLOS Pathogens

Article Title: IFITM1 enhances nonenveloped viral RNA replication by facilitating cholesterol transport to the Golgi

doi: 10.1371/journal.ppat.1011383

Figure Lengend Snippet: (A–C) 293 (A), HeLa (B), or Vero (C) cell lines stably expressing tetracycline (Tet)-inducible IFITM1, IFITM2 or IFITM3 were cultured with or without Tet for 72 h and then transfected with AiV replicon RNA. Cell lysates were harvested at the indicated time points after transfection and then assayed for luciferase activity. The peak activity obtained for cells in the absence of Tet was taken as 100%. Tet-induced IFITM1, IFITM2, or IFITM3 protein expression in each cell line was detected by Western blotting (bottom panels of (A) and right panel of (B) or right panel of (C)). (D) HeLa cells were transfected with the control, IFITM1, IFITM2, or IFITM3 siRNA for 72 h and then transfected with replicon RNA. At the indicated time points after replicon RNA transfection, cell lysates were harvested and subjected to the luciferase assay. The maximum value obtained for cells treated with control siRNA was taken as 100%. (E) IFITM1, IFITM2, or IFITM3 knockdown was confirmed by Western blotting. (F) Cell viability was determined by the CellTiter-Glo assay. Data are the means ± SD of at least three independent experiments. *, P < 0.05; **, P < 0.001; ***, P < 0.0001.

Article Snippet: The coding regions of IFITM1, IFITM2, and IFITM3 were amplified by PCR using primer pairs containing MluI – EcoRV sites from cDNA clones (OriGene; IFITM1: RC201617, IFITM2: RC202067, IFITM3: RC201635), respectively, and then inserted into the same sites of pACT and pBIND, resulting in pACT-IFITM1, pACT-IFITM2, pACT-IFITM3, pBIND-IFITM1, pBIND-IFITM2, and pBIND-IFITM3.

Techniques: Stable Transfection, Expressing, Cell Culture, Transfection, Luciferase, Activity Assay, Western Blot, Control, Knockdown, Glo Assay

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Δ20 IFITM2 differentially restricts X4 and R5 HIV-1

doi: 10.1073/pnas.1619640114

Figure Lengend Snippet: Characterization of Δ20 IFITM2. (A) Jurkat E6-1 or LCL cells carrying IFITM3 polymorphism rs12252-C/C, rs12252-T/C, or rs12252-T/T were treated with 1,000 units (U)/mL IFN-β. Two days later, cells were analyzed by quantitative RT-PCR (qRT-PCR) using specific primers for the indicated IFITM cDNA. DNA electrophoresis was performed to show that a specific Δ20 IFITM2, but not Δ21 IFITM3, transcript could be detected. PCR products of synthetic IFITM cDNA served as positive controls. (B) Schematic representation of three major IFITM2 transcripts. RNA expression of these transcripts in whole blood cells analyzed by RNA sequencing was adapted from ref. 21. RPKM, reads per kilobase per million mapped reads. Expression of IFITM mRNA transcripts in anti-CD3 and anti-CD28 antibody-activated CD4+ T cells (C) or moDCs (D) was analyzed by qRT-PCR. Expression of Δ20 IFITM2 transcript ENST00000602569 is shown. Error bars denote 1 SD (n = 3) (IFITM2 primers used for qRT-PCR are shown in Fig. S1A). (E) Anti-CD3 and anti-CD28 antibody-activated CD4+ T cells were treated with or without 1,000 U/mL IFN-β. Two days later, expression of IFITM proteins was analyzed by Western blotting using the indicated antibodies (details of these antibodies are shown in Fig. S2 A and B and Table S1). Protein bands from Jurkat E6-1 cells stably expressing the indicated IFITM proteins were used as size markers. Δ20 IFITM2 translates of both IFITM2 rs1059091-A and rs1059091-G polymorphisms, which have different migration, were included. The rs1059091-G Δ20 IFITM2 was used for our subsequent hyperexpression experiments. Δ20 IFITM2 indicates rs1059091-G Δ20 IFITM2 if there is no additional specification. Vector-transduced Jurkat E6-1 cells or Jurkat E6-1 cells expressing Δ20 IFITM2 (F) or FL IFITM2 (G) were labeled with an anti-IFITM2/3/Δ20 antibody and 4′,6-diamidino-2-phenylindole (DAPI) and imaged by confocal microscopy.

Article Snippet: For RNAi silencing, scrambled siRNA (CGUUAAUCGCGUAUAAUACGCGUAT; Origene) and siRNA targeting IFITM2 (CCAGGCCCAGCGAUAGAUCAGGAGG; Origene) were transfected into cells using RNAiMAX (Invitrogen) according to the manufacturer’s instructions.

Techniques: Quantitative RT-PCR, Nucleic Acid Electrophoresis, RNA Expression, RNA Sequencing Assay, Expressing, Western Blot, Stable Transfection, Migration, Plasmid Preparation, Labeling, Confocal Microscopy

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Δ20 IFITM2 differentially restricts X4 and R5 HIV-1

doi: 10.1073/pnas.1619640114

Figure Lengend Snippet: Characterization of expression of IFITM transcripts in human primary cells. (A) Schematic representation of three IFITM2 transcripts and primers used in our qRT-PCR analysis. Experiments were similar to the experiments in Fig. 1C except that expression of IFITM mRNA transcripts in anti-CD3 and anti-CD28 antibody-activated CD4+ T cells (B), unactivated CD4+ T cells (C), moDCs (D), M-CSF macrophages (E), or GM-CSF macrophages (F) from different donors was analyzed. In D–F, relative expression of the indicated IFITM transcripts to expression of Δ20 IFITM2 is shown. Expression of IFITM transcripts in CD4+ T cells and moDCs from donor 1 is shown in Fig. 1 C and D. Error bars denote 1 SD of triplicates or SEM of duplicates.

Article Snippet: For RNAi silencing, scrambled siRNA (CGUUAAUCGCGUAUAAUACGCGUAT; Origene) and siRNA targeting IFITM2 (CCAGGCCCAGCGAUAGAUCAGGAGG; Origene) were transfected into cells using RNAiMAX (Invitrogen) according to the manufacturer’s instructions.

Techniques: Expressing, Quantitative RT-PCR

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Δ20 IFITM2 differentially restricts X4 and R5 HIV-1

doi: 10.1073/pnas.1619640114

Figure Lengend Snippet: Characterization of expression of Δ20 IFITM2. (A) Schematic representation of amino acid sequences of IFITM1, IFITM2, IFITM3, and Δ20 IFITM2. Identical amino acid sequences among different IFITM proteins are colored in red. Immunogens of commercial antibodies used in our studies are shown. (B) Vector-transduced GHOST R5 cells or GHOST R5 cells expressing FLAG-tagged FL IFITM2, Δ20 IFITM2, or IFITM3 were analyzed by Western blotting using the indicated antibodies. Note that the anti-IFITM2/3/Δ20 antibody recognizes FL IFITM2, Δ20 IFITM2, and IFITM3. (C) Experiments were similar to the experiments in Fig. 1E except that Δ20 IFITM2 expression in anti-CD3 and anti-CD28 antibody-activated CD4+ T cells from three different donors was analyzed. (D) Vector-transduced and Δ20 IFITM2-expressing Jurkat E6-1 R5 cells were labeled with anti-IFITM2/3/Δ20 primary and Alexa 488-conjugated secondary antibodies. Cells were then analyzed by flow cytometry. The histogram images of the Alexa 488 signal in the indicated cells and in cells labeled with a secondary antibody alone are shown. (E) Experiments were similar to the experiments in D except that anti-CD3 and anti-CD28 antibody-activated CD4+ T cells were analyzed. Experiments were similar to the experiments in C except that Δ20 IFITM2 expression in monocytes (F) and moDCs (G) was analyzed. Arrows indicate Δ20 IFITM2 bands. Note that the upper bands detected by the anti-IFITM2/3/Δ20 antibody could be FL IFITM2 or IFITM3. (H) Experiments were similar to the experiments in C except that anti-CD3 and anti-CD28 antibody-activated CD4+ T cells were treated with media, 1,000 U/mL IFN-β, or 1 μg/mL PHA for 2 d.

Article Snippet: For RNAi silencing, scrambled siRNA (CGUUAAUCGCGUAUAAUACGCGUAT; Origene) and siRNA targeting IFITM2 (CCAGGCCCAGCGAUAGAUCAGGAGG; Origene) were transfected into cells using RNAiMAX (Invitrogen) according to the manufacturer’s instructions.

Techniques: Expressing, Plasmid Preparation, Western Blot, Labeling, Flow Cytometry

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Δ20 IFITM2 differentially restricts X4 and R5 HIV-1

doi: 10.1073/pnas.1619640114

Figure Lengend Snippet: Properties of anti-IFITM antibodies used in our studies

Article Snippet: For RNAi silencing, scrambled siRNA (CGUUAAUCGCGUAUAAUACGCGUAT; Origene) and siRNA targeting IFITM2 (CCAGGCCCAGCGAUAGAUCAGGAGG; Origene) were transfected into cells using RNAiMAX (Invitrogen) according to the manufacturer’s instructions.

Techniques:

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Δ20 IFITM2 differentially restricts X4 and R5 HIV-1

doi: 10.1073/pnas.1619640114

Figure Lengend Snippet: IFN enhances expression of Δ20 IFITM2. The moDCs (A), M-CSF macrophages (B), and GM-CSF macrophages (C) from different donors were treated with or without 1,000 U/mL IFN-β. Two days later, expression of IFITM mRNA transcripts was analyzed by qRT-PCR. Relative expression of the indicated IFITM mRNA in IFN-β–treated cells to expression in untreated controls is shown. Error bars denote 1 SD (n = 3). *P < 0.05 compared with controls.

Article Snippet: For RNAi silencing, scrambled siRNA (CGUUAAUCGCGUAUAAUACGCGUAT; Origene) and siRNA targeting IFITM2 (CCAGGCCCAGCGAUAGAUCAGGAGG; Origene) were transfected into cells using RNAiMAX (Invitrogen) according to the manufacturer’s instructions.

Techniques: Expressing, Quantitative RT-PCR

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Δ20 IFITM2 differentially restricts X4 and R5 HIV-1

doi: 10.1073/pnas.1619640114

Figure Lengend Snippet: Characterization of the subcellular distribution of Δ20 IFITM2. (A) A549 cells transduced to express the indicated IFITM proteins were labeled with anti-LAMP2, anti-IFITM1, or anti-IFITM2/3 antibodies. Labeled cells were imaged by confocal microscopy. (B) Percentages of voxels of IFITM proteins localizing to the plasma membrane are shown. Errors bars denote 1 SD (n = 20). (C) Experiments were similar to the experiments in Fig. 1 F and G except that vector-transduced, IFITM1-expressing, or IFITM3-expressing Jurkat E6-1 R5 cells were labeled with anti-IFITM1 or anti-IFITM2/3 antibodies. (D) Percentages of voxels of IFITM proteins localizing to the plasma membrane are shown. Errors bars denote 1 SD (n = 20). (E) Experiments were similar to the experiments in C except that unactivated and anti-CD3 and anti-CD28 antibody-activated CD4+ T cells were labeled with an anti-IFITM2/3/Δ20 antibody.

Article Snippet: For RNAi silencing, scrambled siRNA (CGUUAAUCGCGUAUAAUACGCGUAT; Origene) and siRNA targeting IFITM2 (CCAGGCCCAGCGAUAGAUCAGGAGG; Origene) were transfected into cells using RNAiMAX (Invitrogen) according to the manufacturer’s instructions.

Techniques: Labeling, Confocal Microscopy, Plasmid Preparation, Expressing

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Δ20 IFITM2 differentially restricts X4 and R5 HIV-1

doi: 10.1073/pnas.1619640114

Figure Lengend Snippet: Δ20 IFITM2 differentially restricts replication of X4 and R5 HIV-1. Jurkat E6-1 R5 cells expressing the indicated IFITM proteins were incubated with 100 ng of p24 antigen X4-tropic NL4-3 (A) or R5-tropic AD8 (B) virus. Supernatants were harvested at the indicated time points, and virus titers were measured by p24 ELISA. Numbers indicate p24 values (mean ± SD × 105; n = 3) detected in the supernatants of vector-transduced and Δ20 IFITM2-expressing cells. Experiments similar to the experiments in A and B, except that the indicated X4 (C) or R5 (D) viruses were used, were performed. Numbers indicate p24 values (mean ± SD; n = 3). Vector-transduced GHOST R5 cells or GHOST R5 cells expressing Δ20 IFITM2 were incubated with the indicated replicating X4 (E) or R5 (F) virus. Two days later, infected cells were harvested and analyzed by flow cytometry. The relative infectivity was determined as the percentage of GFP+ cells normalized to the percentage of vector-transduced cells. Error bars denote 1 SEM of duplicates.

Article Snippet: For RNAi silencing, scrambled siRNA (CGUUAAUCGCGUAUAAUACGCGUAT; Origene) and siRNA targeting IFITM2 (CCAGGCCCAGCGAUAGAUCAGGAGG; Origene) were transfected into cells using RNAiMAX (Invitrogen) according to the manufacturer’s instructions.

Techniques: Expressing, Incubation, Enzyme-linked Immunosorbent Assay, Plasmid Preparation, Infection, Flow Cytometry

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Δ20 IFITM2 differentially restricts X4 and R5 HIV-1

doi: 10.1073/pnas.1619640114

Figure Lengend Snippet: Δ20 IFITM2 differentially restricts X4 and R5 HIV-1 in Jurkat E6-1 R5 cells. (A) Expression of IFITM proteins in Jurkat E6-1 R5 cells used in Fig. 2 A–D was analyzed by Western blotting using the indicated antibodies. (B) Vector-transduced, rs1059091-A Δ20 IFITM2-expressing, or rs1059091-G Δ20 IFITM2-expressing Jurkat E6-1 R5 cells were infected with NL4-3-IeG (X4) or JRFL-IeG (R5) HIV-1. Three days later, cells were harvested and analyzed by flow cytometry. The relative infectivity was determined as the percentage of GFP+ cells normalized to the percentage of vector-transduced control cells. (C) Same aliquots of cells used in B were analyzed by Western blotting using the indicated antibodies. (D) Vector-transduced Jurkat E6-1 R5 cells or Jurkat E6-1 R5 cells stably expressing the indicated IFITM proteins were labeled with anti-CD4, anti-CXCR4, or anti-CCR5 antibodies and then analyzed by flow cytometry. Histogram images are shown. (E) Same aliquots of cells used in Fig. 2 E and F were analyzed by Western blotting using the indicated antibodies. (F) Same aliquots of cells used in Fig. 3 A and B were analyzed by Western blotting. (G) Same aliquots of cells used in Fig. 3D were analyzed by Western blotting using the indicated antibodies.

Article Snippet: For RNAi silencing, scrambled siRNA (CGUUAAUCGCGUAUAAUACGCGUAT; Origene) and siRNA targeting IFITM2 (CCAGGCCCAGCGAUAGAUCAGGAGG; Origene) were transfected into cells using RNAiMAX (Invitrogen) according to the manufacturer’s instructions.

Techniques: Expressing, Western Blot, Plasmid Preparation, Infection, Flow Cytometry, Stable Transfection, Labeling

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Δ20 IFITM2 differentially restricts X4 and R5 HIV-1

doi: 10.1073/pnas.1619640114

Figure Lengend Snippet: Δ20 IFITM2 differentially restricts entry of X4 and R5 HIV-1. (A and B) Vector-transduced GHOST R5 cells or GHOST R5 cells expressing Δ20 IFITM2 were incubated with NL4-3-ΔE pseudotyped with the indicated viral entry glycoproteins. Two days later, cells were harvested and analyzed by flow cytometry. The relative infectivity was determined as the percentage of GFP+ cells normalized to the percentage of vector-transduced control cells. LCMV, lymphocytic choriomeningitis virus. (C) Vector-transduced Jurkat E6-1 R5 cells or Jurkat E6-1 R5 cells stably expressing Δ20 IFITM2 were incubated with pLenti-based HIV-1–GFP pseudotyped with env proteins from the indicated HIV-1 strains. Two days later, cells were harvested and analyzed by flow cytometry. The relative infectivity was determined as the percentage of GFP+ cells normalized to the percentage of vector-transduced cells. MLV, murine leukemia virus. (D) Experiments similar to the experiments in C, except that cells expressing different amounts of Δ20 IFITM2, were used. Numbers indicate percentages of infected control cells. (E) Primary moDCs were transfected with scrambled siRNA or siRNA targeting IFITM2 transcripts. Two days later, cells were incubated with NL4-3-IeG (X4) or JRFL-IeG (R5). One day later, supernatants were harvested and virus titers were determined by p24 ELISA. Numbers indicate the p24 values detected in the supernatants of scrambled siRNA-transfected cells. Experiments were performed at least three times with similar results. (F) Same aliquots of cells used in E were analyzed for mRNA expression of the indicated IFITM transcripts using qRT-PCR. Expression of the indicated IFITM mRNA in IFITM2 siRNA-transfected cells relative to expression of the indicated IFITM mRNA in scrambled siRNA transfected controls is shown. Error bars denote 1 SD (n = 3). *P < 0.05 compared with controls.

Article Snippet: For RNAi silencing, scrambled siRNA (CGUUAAUCGCGUAUAAUACGCGUAT; Origene) and siRNA targeting IFITM2 (CCAGGCCCAGCGAUAGAUCAGGAGG; Origene) were transfected into cells using RNAiMAX (Invitrogen) according to the manufacturer’s instructions.

Techniques: Plasmid Preparation, Expressing, Incubation, Flow Cytometry, Infection, Stable Transfection, Transfection, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Δ20 IFITM2 differentially restricts X4 and R5 HIV-1

doi: 10.1073/pnas.1619640114

Figure Lengend Snippet: Infection of X4, but not R5, HIV-1 was enhanced upon depletion of IFITM2. Primary moDCs (A) or M-CSF–derived macrophages (C) were transfected with scrambled siRNA or siRNA targeting IFITM2 (both FL- and Δ20 IFITM2) transcripts. Two days later, cells were incubated with NL4-3-IeG (X4) or JRFL-IeG (R5) HIV-1. Cells were harvested 24 h after infection. HIV-1 early and late reverse transcripts were analyzed by real-time PCR. Reverse transcripts in IFITM2 siRNA-transfected cells relative to reverse transcripts in scrambled siRNA-transfected controls are shown. (B and D) Expression of IFITM2 (both FL- and Δ20 IFITM2) mRNA in cells used in A and C was assayed by qRT-PCR. Experiments were performed at least twice with similar results. Error bars denote 1 SEM of duplicates. (E) Same aliquots of cells used in Fig. 3 E and F were analyzed by Western blotting using the indicated antibodies.

Article Snippet: For RNAi silencing, scrambled siRNA (CGUUAAUCGCGUAUAAUACGCGUAT; Origene) and siRNA targeting IFITM2 (CCAGGCCCAGCGAUAGAUCAGGAGG; Origene) were transfected into cells using RNAiMAX (Invitrogen) according to the manufacturer’s instructions.

Techniques: Infection, Derivative Assay, Transfection, Incubation, Real-time Polymerase Chain Reaction, Expressing, Quantitative RT-PCR, Western Blot

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Δ20 IFITM2 differentially restricts X4 and R5 HIV-1

doi: 10.1073/pnas.1619640114

Figure Lengend Snippet: Δ20 IFITM2 colocalizes with CXCR4 and CCR5. (A) GHOST R5 cells expressing Δ20 IFITM2 were fixed and labeled with the indicated antibodies and DAPI. Cells were imaged by confocal microscopy. (Insets) Enlarged images are shown. (B) Expression of Δ20 IFITM2 and CCR5 variants in cells used in Fig. 4 D–F was analyzed by Western blotting. (C) Expression of Δ20 IFITM2 and CXCR4 variants in cells used in Fig. 4 B and C was analyzed by Western blotting.

Article Snippet: For RNAi silencing, scrambled siRNA (CGUUAAUCGCGUAUAAUACGCGUAT; Origene) and siRNA targeting IFITM2 (CCAGGCCCAGCGAUAGAUCAGGAGG; Origene) were transfected into cells using RNAiMAX (Invitrogen) according to the manufacturer’s instructions.

Techniques: Expressing, Labeling, Confocal Microscopy, Western Blot

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Δ20 IFITM2 differentially restricts X4 and R5 HIV-1

doi: 10.1073/pnas.1619640114

Figure Lengend Snippet: C-terminal region of CCR5 contributes to the resistance of HIV-1 to Δ20 IFITM2-mediated restriction. (A) Schematic representation of the CCR5 variant, CCR5DM, and CCR5/CXCR4 chimeras, CCR5CXCR4 and CXCR4CCR5, used in our experiments. Experiments were similar to the experiments in Fig. 3 A and B except that GHOST R5 cells expressing WT CXCR4 (B) or CXCR4CCR5 (C) were used. Experiments were similar to the experiments in Fig. 3 A and B except that GHOST X4 cells expressing WT CCR5 (D), CCR5DM (E), or CCR5CXCR4 (F) were used. Experiments were performed at least three times with similar results. Error bars denote 1 SD (n = 3). *P < 0.05 compared with controls.

Article Snippet: For RNAi silencing, scrambled siRNA (CGUUAAUCGCGUAUAAUACGCGUAT; Origene) and siRNA targeting IFITM2 (CCAGGCCCAGCGAUAGAUCAGGAGG; Origene) were transfected into cells using RNAiMAX (Invitrogen) according to the manufacturer’s instructions.

Techniques: Variant Assay, Expressing

Journal: The Journal of Experimental Medicine

Article Title: MYCT1–IFITM2/3 interaction links endothelial endolysosomal trafficking to white adipose tissue expansion

doi: 10.1084/jem.20251497

Figure Lengend Snippet: MYCT1 is a transmembrane phosphoglycoprotein that interacts with IFITM2/3, related to Fig. 5 . (A) The MYCT1 protein is highly conserved across vertebrates. An alignment of human MYCT1 protein sequence with those of the indicated species, amino acid conservation is color-coded as indicated in the legend below. Percentages next to species indicate amino acid sequence identity (left) and homology (right) in comparison with human sequence. (B) Short MYCT1 isoform is predominant in ECs. Cells were transduced with Ad- GFP (control) or Ad- MYCT1 (187-aa isoform with C-terminal V5 tag) adenoviruses. Western blot analysis for the indicated proteins. (C) Workflow for mass spectrometry experiments. MYCT1-negative SW480 colon cancer cells were used to exclude nonspecific interactors pulled down by MYCT1 IgG. n = 2 independent experiments. (D) Venn diagram showing how the short list of MYCT1 interactors was selected. (E) Interaction between MYCT1 and IFITM2/3 was analyzed by PLA in ECs. siRNA-mediated knockdown of either protein confirmed specificity of PLA signal. Staining of ECs for PLA dots (gray), VE-cadherin (magenta), and DNA (blue). Scale bar, 50 µm. (F) Quantification of the number of PLA dots per cell in control, MYCT1 KD , and IFITM2/3 KD cells. n = 3 independent experiments; 500–1,500 cells were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Dunnett’s multiple comparisons, P = 0.036 (*) for MYCT1 knockdown effect. (G) Positive control (VE-cadherin::β-catenin) and negative control (MYCT1 antibody alone) for PLA signal in human brain sections. PLA dots (gray) and staining of ECs for VE-cadherin or Pecam1 (magenta) and DNA (blue). Arrowhead, colocalization of PLA dots with vascular marker. Scale bar, 20 µm. Source data are available for this figure: .

Article Snippet: IFITM2 (human) reverse , Eurofins , 5′-CCC CCA GCA TAG CCA CTT CC-3′.

Techniques: Sequencing, Comparison, Transduction, Control, Western Blot, Mass Spectrometry, Knockdown, Staining, Positive Control, Negative Control, Marker

Journal: The Journal of Experimental Medicine

Article Title: MYCT1–IFITM2/3 interaction links endothelial endolysosomal trafficking to white adipose tissue expansion

doi: 10.1084/jem.20251497

Figure Lengend Snippet: MYCT1 is a transmembrane phosphoglycoprotein that interacts with IFITM2/3. (A) Endogenous MYCT1 is located at cell–cell junctions (arrow) and in puncta (arrowhead). Staining of human primary ECs for MYCT1 (black), VE-cadherin (magenta), and DNA (blue). Scale bar, 10 µm. (B) MYCT1 is a membrane protein. Western blot analysis of various EC fractions for MYCT1, GAPDH, PECAM1, H3K27ac, and vimentin proteins. Cy, cytoplasm; Mb, membrane; Nu, nucleus; Ck, cytoskeleton. (C) MYCT1 is glycosylated. Western blot analysis of MYCT1 protein electrophoretic mobility in control and PNGase-F–treated lysates. (D) Schematic model of MYCT1 structure and domains with phosphorylation sites, identified by mass spectrometry. MYCT1 phosphorylation sites are highly conserved as indicated by the color scale. Asterisks indicate sites also described at https://www.phosphosite.org/ . (E) Top five proteins interacting with MYCT1 as identified by mass spectrometry, among which IFITM2 and IFITM3. ECs were transduced with recombinant adenoviruses to transiently overexpress MYCT1 or GFP, as a control. Cell lysates were collected 48 h after transduction, immunoprecipitated using MYCT1 antibody or a control IgG, and analyzed by mass spectrometry. Proteins interacting with both endogenous and overexpressed MYCT1 were selected and ranked by normalized spectral abundance factor (NSAF) from two independent mass spectrometry (MS) experiments are shown (31 proteins); the top five proteins are highlighted in magenta. (F) GO terms of the cellular component and biological process overrepresented in the MYCT1 interactome. Fisher’s exact test with adjustment for false discovery rate (FDR). (G) Validation of IFITM2/3 and MYCT1 interaction by co-IP. EC lysates from confluent ECs were immunoprecipitated (IP) with MYCT1 or control IgG and blotted for IFITM2/3. H, IgG heavy chain; L, IgG light chain. (H) IFITM2/3 are constitutively expressed in ECs in vitro and in vivo . Staining of human primary ECs (upper panels), human brain and WAT sections (lower panels) for MYCT1 (gray), IFITM2/3 (green), VE-cadherin (magenta), and DNA (blue). Scale bar, 20 µm (brain) and 50 µm (adipose tissue). (I) MYCT1 and IFITM2/3 interact in brain ECs. Proximity ligation assay (PLA) in human brain sections. Detection of PLA dots (gray) in ECs and staining for VE-cadherin (magenta) and DNA (blue). Arrowheads, colocalization of MYCT1::IFITM2/3 PLA dots and VE-cadherin staining. Scale bar, 20 µm. See also . Source data are available for this figure: .

Article Snippet: IFITM2 (human) reverse , Eurofins , 5′-CCC CCA GCA TAG CCA CTT CC-3′.

Techniques: Staining, Membrane, Western Blot, Control, Phospho-proteomics, Mass Spectrometry, Transduction, Recombinant, Immunoprecipitation, Biomarker Discovery, Co-Immunoprecipitation Assay, In Vitro, In Vivo, Proximity Ligation Assay

Journal: The Journal of Experimental Medicine

Article Title: MYCT1–IFITM2/3 interaction links endothelial endolysosomal trafficking to white adipose tissue expansion

doi: 10.1084/jem.20251497

Figure Lengend Snippet: MYCT1 limits enlargement of IFITM2/3 + endosomes. (A) MYCT1 and IFITM2/3 display inverse regulatory dynamics. MYCT1 knockdown increases total IFITM2/3 protein levels, whereas IFITM2/3 knockdown reduces total MYCT1 protein levels. Western blot analysis of confluent ECs 48 h after siRNA transfection for the indicated proteins. Quantification of total MYCT1 and IFITM2/3 protein levels relative to the control is indicated as the average of all experiments under the respective blots. n = 4 independent experiments; one-way ANOVA with Dunnett’s multiple comparisons test; P < 0.0001 (*) for MYCT1 knockdown effect on MYCT1, P = 0.004 (*) for IFITM2/3 knockdown effect on MYCT1, P = 0.015 (*) for MYCT1 knockdown effect on IFITM2/3, and P = 0.0016 (*) for IFITM2/3 knockdown effect on IFITM2/3. (B) MYCT1 knockdown increases IFITM2/3 + vesicle volume. Staining of ECs for MYCT1 (gray), IFITM2/3 (green), VE-cadherin (magenta), and DNA (blue). Yellow box: magnification of IFITM2/3 from highlighted areas, shown below. Scale bar, 20 µm. (C) Quantification of the IFITM2/3 + vesicle volume in control and MYCT1 KD cells. n = 4 independent experiments; 500–1,500 vesicles from 15 to 20 cells were analyzed per condition for each experiment; mean ± SD; unpaired t test; P = 0.039 (*). (D) IFITM2/3 localize mainly to the RAB5 + early endosome in ECs, rather than to RAB7 + late endosome and LAMP1 + lysosome. Staining for IFITM2/3 (gray), RAB5 or RAB7 or LAMP1 (green), and DNA (blue). Yellow box: magnification of IFITM2/3 and endolysosomal markers from highlighted areas, shown below. Yellow arrows, IFITM2/3 + RAB5 + vesicles; magenta arrows, IFITM2/3 + RAB7 neg or IFITM2/3 + LAMP1 neg vesicles. Scale bar, 20 µm. (E) Quantification of colocalization of IFITM2/3 with RAB5, RAB7, and LAMP1 by Manders’ overlap coefficients. n = 2–4 independent experiments; 15–25 cells were analyzed per condition for each experiment; mean ± SD; two-way ANOVA with Tukey’s multiple comparisons test, P < 0.001 (*) for both RAB5 versus RAB7 and RAB5 versus LAMP1. (F) MYCT1 knockdown causes enlargement of RAB5 + early endosomes. Staining of ECs for RAB5 (gray/black), VE-cadherin (magenta), and DAPI (blue). Cyan box: magnification of RAB5 from highlighted areas, shown below. Scale bar, 10 μm. (G) Quantification of RAB5 + vesicle volume. n = 4 independent experiments; 400–800 vesicles were analyzed per condition for each experiment; mean ± SD; unpaired t test, P = 0.0133 (*). (H) Myct1 ablation enlarges Rab5 + early endosomes in aortic ECs. En face staining of aorta from wild-type or Myct1 ecKO mice for Rab5 (gray/black) and VE-cadherin (magenta). Cyan box: magnification of RAB5 from highlighted areas, shown below. Scale bar, 5 μm. (I) Quantification of Rab5 + vesicle volume in aortic ECs. n = 5 mice per genotype; 1,000–4,000 vesicles were analyzed per mouse; mean ± SD; unpaired t test, P = 0.0128 (*). (J) MYCT1 depletion leads to IFITM2/3 + early endosome enlargement. Icons used in J were created with BioRender.com and modified in Affinity. See also . Source data are available for this figure: .

Article Snippet: IFITM2 (human) reverse , Eurofins , 5′-CCC CCA GCA TAG CCA CTT CC-3′.

Techniques: Knockdown, Western Blot, Transfection, Control, Staining, Modification

Journal: The Journal of Experimental Medicine

Article Title: MYCT1–IFITM2/3 interaction links endothelial endolysosomal trafficking to white adipose tissue expansion

doi: 10.1084/jem.20251497

Figure Lengend Snippet: MYCT1 restricts endothelial endocytosis and IFITM2/3-dependent mTORC1 activation, related to Figs. 6 and 7. (A) IFITM2/3 antibody and siRNA validation for identification of endogenous human IFITM2/3 proteins. IFITM2/3 knockdown reduces MYCT1 protein levels. Staining of ECs for MYCT1 (gray), IFITM2/3 (green), and DNA (blue). Scale bar, 20 µm. (B) Quantification of MYCT1 protein levels in control and IFITM2/3 KD cells. n = 4 independent experiments; mean ± SD; Welch’s t test, P = 0.0014 (*). (C and D) MYCT1 knockdown does not affect IFITM2 (C) nor IFITM3 (D) mRNA levels in ECs. n = 3 independent experiments; mean ± SD; Welch’s t test, P > 0.05. (E) MYCT1 knockdown does not impact RAB7 + late endosomes nor LAMP1 + endolysosomes. Staining of ECs for RAB7 (gray), LAMP1 (green), VE-cadherin (magenta), and DNA (blue). Scale bar, 20 µm. (F and G) Quantification of RAB7 + (F) and LAMP1 + (G) areas per cell in control and MYCT1 KD cells. n = 3 independent experiments; 20–50 cells were analyzed per condition for each experiment; mean ± SD; Welch’s t test, P > 0.05. (H) MYCT1 knockdown increased FITC-dextran uptake. 2 days after siRNA transfection, cells were starved for 1 h in PBS, followed by a 30-min induction with amino acid solution together with 10-kDa FITC dextran. Detection of 10-kDa FITC-dextran (gray) and staining of ECs for VE-cadherin (magenta) and DAPI (blue). Arrow, dextran + puncta. Scale bar, 10 μm. (I) Quantification of the number of dextran + puncta per cell in control and MYCT1 KD cells. n = 3 independent experiments; 30–50 cells were analyzed per condition for each experiment; mean ± SD; Welch’s t test, P = 0.0016 (*). (J) Example of gating strategy (7-AAD neg CD45 neg CD31 + ) of ECs from gonadal fat pad by flow cytometry. (K) WAT ECs take up higher amounts of labeled plasma proteins compared with colon ECs. Quantification of labeled plasma protein uptake in ECs from s.c. and visceral WAT and colon normalized to plasma Atto-647 signal. n = 10 mice per organ; Friedman test with Dunn’s multiple comparisons test, P > 0.05 for scFAT versus visFAT, P = 0.0052 for scFAT versus colon, and P = 0.001 (*) for visFAT versus colon. (L) Endocytosis inhibition with dynasore rescues mTORC1 hyperactivation caused by knockdown of MYCT1 . Staining for p-S6 (gray), β-catenin (magenta), and DAPI (blue). Scale bar, 50 μm. (M) Quantification of mTORC1 activation by amino acid supplementation in control and MYCT1 KD cells in the absence or presence of dynasore. The percentage of p-S6 + cells was quantified in the indicated conditions. n = 3 independent experiments; 1,500–6,000 cells were analyzed per condition for each experiment; mean ± SD; two-way ANOVA with Tukey’s multiple comparisons test, P = 0.004 (*) for MYCT1 knockdown effect in control conditions and P < 0.001 (*) for its rescue by dynasore treatment. (N) RAB5 knockdown rescues mTORC1 hyperactivation in MYCT1 KD cells. Staining of ECs for p-S6 (gray), β-catenin (magenta), and DAPI (blue). Scale bar, 50 μm. (O) Quantification of mTORC1 activation in control, MYCT1 KD , and MYCT1-RAB5 KD cells. The percentage of p-S6 + cells was quantified in the indicated conditions. n = 3 independent experiments; 7,000-15,000 cells were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Tukey’s multiple comparisons test, P = 0.0021 (*) for MYCT1 knockdown effect and P = 0.0292 (*) for its rescue by RAB5 double knockdown. (P) IFITM2/3 knockdown rescues mTORC1 hyperactivation in MYCT1 -deficient human adipose ECs. Staining for p-S6 (gray), β-catenin (magenta), and DAPI (blue). Scale bar, 100 μm. (Q) Quantification of mTORC1 activation in control, MYCT1 KD , IFITM2/3 KD , and MYCT1 – IFITM2/3 KD cells. The percentage of p-S6 + cells was quantified in the indicated conditions. n = 2 independent experiments; 1,500–3,000 cells were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Tukey’s multiple comparisons test, P = 0.0168 (*) for MYCT1 knockdown effect and P = 0.0123 (*) for rescue effect by IFITM2/3 double knockdown.

Article Snippet: IFITM2 (human) reverse , Eurofins , 5′-CCC CCA GCA TAG CCA CTT CC-3′.

Techniques: Activation Assay, Biomarker Discovery, Knockdown, Staining, Control, Transfection, Flow Cytometry, Labeling, Clinical Proteomics, Inhibition

Journal: The Journal of Experimental Medicine

Article Title: MYCT1–IFITM2/3 interaction links endothelial endolysosomal trafficking to white adipose tissue expansion

doi: 10.1084/jem.20251497

Figure Lengend Snippet: MYCT1 restricts endothelial endocytosis and IFITM2/3-dependent mTORC1 activation. (A) Experimental workflow for in vivo Atto647–labeled plasma protein uptake experiment. (B) WAT ECs take up higher amounts of labeled plasma proteins compared with colon ECs. Representative flow cytometry histograms showing Atto647-MFI in ECs from s.c. (sc. fat), visceral (vis. fat) WAT, and colon of two wild-type mice, comparing an injected one (colored) and a non-injected control (gray). (C) Myct1 ablation increases labeled plasma protein uptake in WAT ECs. Atto647-MFI of ECs from visceral WAT of control mice or Myct1 ecKO mice, plotted as a function of corresponding plasma Atto647-fluorescence levels. Each dot corresponds to an individual mouse. Linear regression showing the 95% confidence bands of the best-fit line and the goodness of fit (R 2 ). a.u., arbitrary units, MFI, mean fluorescence intensity. Similar results were obtained for s.c. fat (data not shown). (D) MYCT1 knockdown promotes lysosomal degradation activity. Control and MYCT1 KD cells were treated for 1 h with DQ-BSA. DQ-BSA fluorescence (gray/black) and staining for β-catenin (magenta) and DNA (blue). Lower panels show DQ-BSA. Scale bar, 20 µm. (E) Quantification of the percentage of DQ-BSA signal per cell. n = 4 independent experiments; 60–100 cells were analyzed per condition for each experiment; mean ± SD; unpaired t test, P = 0.0059 (*). (F) IFITM2/3 knockdown rescues RAB5 + endosome enlargement in MYCT1 -deficient ECs. Staining of ECs for RAB5 (gray/black), VE-cadherin (magenta), and DAPI (blue). Lower panels show RAB5. Scale bar, 10 μm. (G) Quantification of RAB5 + vesicle volume in control, MYCT1 KD , IFITM2/3 KD , and MYCT1 – IFITM2/3 KD cells. n = 3 independent experiments; 1,000–3,000 vesicles were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Tukey’s multiple comparisons test, P = 0.028 (*) for MYCT1 knockdown effect, P = 0.0060 (*) for comparison between MYCT1 and IFITM2/3 knockdowns, and P = 0.0070 (*) for rescue effect by IFITM2/3 simultaneous knockdown. (H) IFITM2/3 knockdown rescues mTORC1 hyperactivation in MYCT1 -deficient ECs. Staining for p-S6 (gray), β-catenin (magenta), and DAPI (blue). Scale bar, 20 μm. (I) Quantification of mTORC1 activation in control, MYCT1 KD , IFITM2/3 KD , and MYCT1 – IFITM2/3 KD cells. The percentage of p-S6 + cells was quantified in the indicated conditions. n = 4 independent experiments; 1,500–8,000 cells were analyzed per condition for each experiment; mean ± SD; one-way ANOVA with Tukey’s multiple comparisons test, P = 0.0195 (*) for MYCT1 knockdown effect and P = 0.0118 (*) for rescue effect by IFITM2/3 simultaneous knockdown. (J) MYCT1 ablation leads to accumulation of IFITM2/3, which drives enlargement of early endosomes, increases cargo uptake, and enhances lysosomal degradation. This process results in greater amino acid delivery, thereby activating mTORC1. These phenotypes are reversed upon simultaneous knockdown of IFITM2/3 and MYCT1 . Icons used in A and J were created with BioRender.com and modified in Affinity. See also .

Article Snippet: IFITM2 (human) reverse , Eurofins , 5′-CCC CCA GCA TAG CCA CTT CC-3′.

Techniques: Activation Assay, In Vivo, Labeling, Clinical Proteomics, Flow Cytometry, Injection, Control, Fluorescence, Knockdown, Activity Assay, Staining, Comparison, Modification

Journal: The Journal of Experimental Medicine

Article Title: MYCT1–IFITM2/3 interaction links endothelial endolysosomal trafficking to white adipose tissue expansion

doi: 10.1084/jem.20251497

Figure Lengend Snippet: Endothelial-specific activation of mTORC1 signaling recapitulates adipose tissue phenotype of Myct1 ecKO mice. (A) Tsc1 ecKO mouse model. See Materials and methods for details. (B) Endothelial Tsc1 ablation activates sustained mTORC1 signaling in vivo . En face staining of aorta for p-S6 (gray) and VE-cadherin (magenta). Scale bar, 50 μm. (C) Quantification of mTORC1 activation in the aortic endothelium of wild-type and Tsc1 ecKO mice. The percentage of p-S6 + cells was quantified in n = 5 mice per genotype and conditions; 300–500 cells were analyzed per aorta; mean ± SD; Welch’s t test, P = 0.0121 (*). (D) Workflow of Tsc1 ecKO mouse analysis. (E) Wild-type and Tsc1 ecKO mice were analyzed before significant difference in body weight. Quantification of body weight at the start and end of experiment. n = 10–12 mice per genotype; mean ± SD; multiple unpaired t tests, P > 0.05 at start, P = 0.116 at end. (F) Quantification of fat pad weight to body weight ratio relative to wild-type mice. n = 9 mice per genotype; mean ± SD; multiple unpaired t tests, P = 0.001 (*) for interscapular WAT (IsWAT), P = 0.027 for interscapular BAT (IsBAT), P < 0.001 (*) for inguinal (Ing), P < 0.001 (*) for retroperitoneal (RP), P < 0.001 (*) for gonadal (Gon), and P < 0.001 (*) for mesenteric (Mes). (G) Tsc1 ablation reduces size of adipocytes. Retroperitoneal thick sections stained for Laminin α4 (gray) and Pecam1 (magenta). Scale bar, 50 μm. (H) Quantification of adipocyte size in wild-type and Tsc1 ecKO fat. n = 5 mice per genotype; mean ± SD; unpaired t test, P = 0.0056 (*). (I) Schematic view of the role of endothelial MYCT1–IFITM2/3 complexes in WAT homeostasis. MYCT1 interacts with IFITM2/3, limiting their function and allowing nutrient transport for energy storage. In the absence of MYCT1, IFITM2/3 accumulate in early endosomes and trigger continuous endolysosomal cargo degradation and hyperactivation of mTORC1 signaling in ECs, restricting energy storage in WAT. Icons used in A, D, and I were created with BioRender.com and modified in Affinity.

Article Snippet: IFITM2 (human) reverse , Eurofins , 5′-CCC CCA GCA TAG CCA CTT CC-3′.

Techniques: Activation Assay, In Vivo, Staining, Modification