Journal: Arteriosclerosis, Thrombosis, and Vascular Biology

Article Title: Temporal and Spatial Post-Transcriptional Regulation of Zebrafish tie1 mRNA by Long Noncoding RNA During Brain Vascular Assembly

doi: 10.1161/ATVBAHA.118.310848

Figure Lengend Snippet: Analysis of tyrosine kinase containing immunoglobulin and epidermal growth factor homology 1 ( tie1 ) mRNA and tie1 antisense ( tie1AS ) RNA levels in zebrafish embryos injected with tie1AS -Elavl-bMO comb . One-cell wild-type or Tg(Kdrl:eGFP ) zebrafish embryos were injected with control morpholino oligonucleotides (cMOs) or morpholinos targeting the embryonic lethal and abnormal vision Drosophila-like 1 (Elavl1)–binding sites in tie1AS ( tie1AS -Elavl-bMO comb ). The embryos were grown at 28.5°C, and at least 50 were collected at time points shown on the x axis. RNA was extracted from whole embryos ( A and D ), embryo heads ( B and E ), or trunk/tail ( C and F ) and used in RT-qPCR. Levels of tie1 and tie1AS RNA relative to gapdh mRNA expression are shown for embryos injected with cMO (blue open squares) or tie1AS -Elavl-bMO comb (red open squares). Error bars represent SDs. For each specified time point, the difference was analyzed for statistical significance. The asterisk denotes adj P <0.05 after multiple testing corrections. In A and D , n=≈50 embryos were analyzed per time point, with a total of 3 biological replicates. In B , C , E , and F , n=50 to 60 embryo heads or trunks/tails were analyzed per time point, with a total of 3 biological replicates.

Article Snippet: We performed quantitative real-time polymerase chain reaction (PCR) by mixing 1 μL cDNA with 10 μL 2× qPCR Buffer Mastermix iCycler (MidSci BEQPCR-IC) and 5 pmol of each forward and reverse tie1 , tie1AS , or gapdh primer.

Techniques: Injection, Control, Binding Assay, Quantitative RT-PCR, Expressing

Journal: Arteriosclerosis, Thrombosis, and Vascular Biology

Article Title: Temporal and Spatial Post-Transcriptional Regulation of Zebrafish tie1 mRNA by Long Noncoding RNA During Brain Vascular Assembly

doi: 10.1161/ATVBAHA.118.310848

Figure Lengend Snippet: Phenotypic evaluation and analysis of tyrosine kinase containing immunoglobulin and epidermal growth factor homology 1 ( tie1 ) mRNA levels in embryos treated with morpholino or dimethyl sulfoxide (DMSO)/SB-505124. One-cell Tg(kdrl:eGFP ) zebrafish embryos were injected with control morpholino oligonucleotides (cMOs) or morpholinos targeting embryonic lethal and abnormal vision Drosophila-like 1 (Elavl1)–binding sites in tie1AS ( tie1AS -Elavl-bMO comb ). They were then grown at 28.5°C in the dark and treated with 100 μm DMSO or 100 μm SB-505124 between somite stages 18 and 20. Around 28 hours post-fertilization (hpf), the embryos were imaged ( A – H ), and areas of eyes, ventricular space, and primordial midbrain channels (PMBCs) were quantified from 6 lateral images ( I – K ). Also, tie1 mRNA levels in some embryos collected between 28 and 31 hpf were determined ( L – N ). A , A representative (156/180) phase-contrast image of a 28 hpf embryo injected with cMO and treated with DMSO (cMO+DMSO). B , A fluorescence image corresponding to A . C , A representative (165/216) phase-contrast image of a 28 hpf embryo injected with cMO and treated with SB-505124 (cMO+SB-505124). D , A fluorescence image corresponding to C . E , A representative (98/200) phase-contrast image of a 28 hpf embryo injected with tie1AS -Elavl-bMO comb and treated with DMSO ( tie1AS -Elavl-bMO comb +DMSO). F , A fluorescence image corresponding to E . G , A representative (152/200) phase-contrast image of a 28 hpf embryo injected with tie1AS -Elavl-bMO comb and treated with SB-505124 ( tie1AS -Elavl-bMO comb +SB-505124). H , A fluorescence image corresponding to G . White dotted lines outline PMBCs (also denoted by P). Outlines of eyes, ventricular spaces, and PMBCs were traced in lateral images (phase-contrast or fluorescence) with Axiovision 4.8.2, and areas within the outlines were deduced with the Measure tool from Axiovision 4.8.2. Average areas of eyes ( I ), ventricular spaces ( J ), and PMBCs ( K ) were deduced for the cMO+DMSO group (blue bars), the cMO+SB-505124 group (light gray bars), the tie1AS -Elavl-bMO comb +DMSO group (red bars), and the tie1AS -Elavl-bMO comb +SB-505124 group (dark grey bars). Error bars represent SDs (n=6). cMO+DMSO embryos (blue bars), cMO+SB-505124 embryos (light gray bars), tie1AS -Elavl-bMO comb +DMSO embryos (red bars), and tie1AS -Elavl-bMO comb +SB-505124 embryos (dark gray bars) were collected between 28 and 31 hpf. Their RNA was extracted from whole embryo ( L ), embryo head ( M ), and trunk/tail ( N ), and used in RT-qPCR. Average tie1 mRNA levels (ratio to β-actin) were plotted in L , M . Error bars represent SDs. n=50 embryos or heads or trunks/tails per group, with a total of 3 biological replicates. Multi-group differences in I – N were analyzed using ANOVA followed by Tukey test. *Adj (adjusted after multiple testing corrections) P <0.5; **Adj P <0.01; and ***Adj P <0.001. We found significant differences between the cMO+DMSO group vs the tie1AS -Elavl-bMO comb +DMSO group (black braces), the cMO+DMSO group vs the cMO+SB-505124 group (blue lines), the cMO+SB-505124 group vs the tie1AS -Elavl-bMO comb +DMSO group (gray lines), and the tie1AS -Elavl-bMO comb +DMSO group vs the tie1AS -Elavl-bMO comb +SB-505124 group (red lines).

Article Snippet: We performed quantitative real-time polymerase chain reaction (PCR) by mixing 1 μL cDNA with 10 μL 2× qPCR Buffer Mastermix iCycler (MidSci BEQPCR-IC) and 5 pmol of each forward and reverse tie1 , tie1AS , or gapdh primer.

Techniques: Injection, Control, Binding Assay, Fluorescence, Quantitative RT-PCR

Journal: Arteriosclerosis, Thrombosis, and Vascular Biology

Article Title: Temporal and Spatial Post-Transcriptional Regulation of Zebrafish tie1 mRNA by Long Noncoding RNA During Brain Vascular Assembly

doi: 10.1161/ATVBAHA.118.310848

Figure Lengend Snippet: Identification of embryonic lethal and abnormal vision Drosophila-like 1 (Elavl1) interaction with unique sequences in tyrosine kinase containing immunoglobulin and epidermal growth factor homology 1 antisense ( tie1AS ) long noncoding RNA (lncRNA). A , Diagram of the convergent tie1 mRNA and tie1AS lncRNA hybrid. tie1AS lncRNA sequences noncomplementary to tie1 mRNA are shown as unique sequences. The unique sequences in tie1AS were subdivided into 3 probes with overlapping regions: tie1AS (1–70) [purple], tie1AS (45 – 105) [cyan], and tie1AS (88 – 151) [red]. These probes were used in RNA pull-down assays and ultraviolet (UV) cross-linking assays. Elavl1-binding sites in tie1AS are underlined in red. B , The 3 RNA probes described in A and a scrambled RNA were transcribed in vitro, biotinylated at the 3′ end, and used in RNA pull-down assays as described in Methods in the online-only Data Supplement . From left to right , scrambled RNA (negative control), tie1AS (1–70) , tie1AS (45 – 105) , and tie1AS (88–151 ) . The asterisk indicates the nonspecific ribonucleoprotein complex. The black arrow points to the tie1 AS -specific RNA-protein complex, which was excised and analyzed by mass spectrometry. C , Biotinylated RNAs ( B ) were incubated with zebrafish lysate (26–28 hours post-fertilization [hpf]), resolved by SDS-PAGE, and blotted onto a PVDF membrane. The membrane was probed with anti-Elav antibody (primary) and anti-mouse antibody (secondary), and developed by chemiluminescence. D , Zebrafish 26 to 28 hpf lysate was incubated with protein A-bound anti-Elav antibody, protein A-bound Tyrosine Hydroxylase (TH) antibody, or IgG, and immobilized on magnetic beads. The beads were isolated and washed, and the RNA was extracted. After reverse transcription, the cDNA obtained was used in quantitative PCR. The x axis shows the antibodies used in immunoprecipitation. The y axis shows the percentages of tie1AS lncRNA (dark gray) or tie1 mRNA (light gray) obtained relative to the input. E , UV cross-linking of RNA and zebrafish lysate. RNA labeled with [α]P 32 -UTP was incubated with zebrafish lysate (26–28 hpf) and cross-linked with UV for 12 minutes. After digestion with RNase I, the complexes were boiled in 2× SDS sample buffer and resolved by SDS-PAGE. The gel was visualized using a phosphorimager. RNA probes from left to right , tie1AS (1–70) , tie1AS (40–105) , wild-type tie1AS (88–151) in 2 successive lanes, and mutated tie1AS (88–151), tie1AS mut, UAAACUAACAGCAA GCUGCCUGGUC AGAGCAGAACAGAUGACUUUCAGUAAGGAUAGGAUAAUGCAUCGUUU (mutated sequences are underlined). The black arrow indicates that mutations within the adenosine uridine-rich element prevent the formation of the ribonucleoprotein complex.

Article Snippet: We performed quantitative real-time polymerase chain reaction (PCR) by mixing 1 μL cDNA with 10 μL 2× qPCR Buffer Mastermix iCycler (MidSci BEQPCR-IC) and 5 pmol of each forward and reverse tie1 , tie1AS , or gapdh primer.

Techniques: Binding Assay, In Vitro, Negative Control, Mass Spectrometry, Incubation, SDS Page, Membrane, Magnetic Beads, Isolation, Reverse Transcription, Real-time Polymerase Chain Reaction, Immunoprecipitation, Labeling