human rrm2 Search Results


94
Genecopoeia rrm2 promoter reporters
(A) dNTP production in small interfering RNA (siRNA)-transfected cells. dNTP was detected at both 48 hours and 72 hours post-transfection of siRNAs in C4-2 cells. siNS, nonspecific siRNA. (B) siRRM2-induced DNA damage. DNA damage marker activation was monitored in LNCaP and C4-2 cells using Muse multi-color DNA damage kit. (C) Activation of H2A.X was confirmed by immunoblotting. (D) and (E) Analysis of cell proliferation (D) and cell cycle (E) in transfected cells. (F) Apoptosis detected by Annexin V assays and immunoblots. (G) dNTP production in empty vector <t>(EV)/RRM2-overexpressing</t> PC-3 cells (PC3-EV; <t>PC3-RRM2).</t> (H) Cell proliferation in stable cells. (I) soft agar assays of stable PC-3 cells. The colony numbers were normalized to those in the control cells. (J) Wound healing assays after the scratch done for 24 hours. (K) Invasion assays after cells were plated for 48 hours. (L) and (M) EMT marker expression detected by qPCR (L) and immunoblots (M) in both EV- and RRM2-expressing PC-3 cells. (N) Invasion assays after multiple siRNAs were transfected in PC3-RRM2 cells. Figure 1 values represent the mean ± S.E. of three independent experiments. *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001 vs control groups treated with empty vector (EV) or with nonspecific (siNS) siRNA.
Rrm2 Promoter Reporters, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rrm2 promoter reporters/product/Genecopoeia
Average 94 stars, based on 1 article reviews
rrm2 promoter reporters - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

93
Sino Biological small cdna library
(A) dNTP production in small interfering RNA (siRNA)-transfected cells. dNTP was detected at both 48 hours and 72 hours post-transfection of siRNAs in C4-2 cells. siNS, nonspecific siRNA. (B) siRRM2-induced DNA damage. DNA damage marker activation was monitored in LNCaP and C4-2 cells using Muse multi-color DNA damage kit. (C) Activation of H2A.X was confirmed by immunoblotting. (D) and (E) Analysis of cell proliferation (D) and cell cycle (E) in transfected cells. (F) Apoptosis detected by Annexin V assays and immunoblots. (G) dNTP production in empty vector <t>(EV)/RRM2-overexpressing</t> PC-3 cells (PC3-EV; <t>PC3-RRM2).</t> (H) Cell proliferation in stable cells. (I) soft agar assays of stable PC-3 cells. The colony numbers were normalized to those in the control cells. (J) Wound healing assays after the scratch done for 24 hours. (K) Invasion assays after cells were plated for 48 hours. (L) and (M) EMT marker expression detected by qPCR (L) and immunoblots (M) in both EV- and RRM2-expressing PC-3 cells. (N) Invasion assays after multiple siRNAs were transfected in PC3-RRM2 cells. Figure 1 values represent the mean ± S.E. of three independent experiments. *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001 vs control groups treated with empty vector (EV) or with nonspecific (siNS) siRNA.
Small Cdna Library, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/small cdna library/product/Sino Biological
Average 93 stars, based on 1 article reviews
small cdna library - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
OriGene rrm2 truclone rrm2 nm 001165931 human cdna
A, <t>RRM2</t> mRNA expression in pancreatic cancer cell lines relative to expression identified in HPDE. Columns, mean of triplicate; bars, SD. n = 3. B, Western blotting analysis of RRM2 (∼45 kDa) and β-actin (45 kDa) in whole cell lysates of HPDE and pancreatic cancer cell lines. C, Expression of let- 7 family members in pancreatic cancer cell lines relative to expression in HPDE. Columns , mean of triplicate; bars , SD. n = 3; * P <0.05. D, RRM2 is a direct target of let-7 . 293TA and MIA PaCa-2 cells were virally infected for expression of precursors of let-7a-1 , let-7a-2 , let-7a-3 , let-7b , and miR-214 ( negative control ) and subsequently transfected with a RRM2 3′ UTR luciferase reporter construct. Luciferase activities measured 36 h after transfection (normalized relative to renilla activity) were plotted. Columns , mean of triplicate; bars , SD. n = 3. * p <0.05, ** p <0.01.
Rrm2 Truclone Rrm2 Nm 001165931 Human Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rrm2 truclone rrm2 nm 001165931 human cdna/product/OriGene
Average 90 stars, based on 1 article reviews
rrm2 truclone rrm2 nm 001165931 human cdna - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
OriGene rrm2 gfp
( A ) Line graphs showing mean abundance profiles for Cyclin A2 (CycA), Cyclin B1, Cyclin B2, and GAPDH. Grey ribbons indicate 1 standard deviation from the mean. ( B ) Mean abundance profile for <t>RRM2.</t> ( C ) Flow cytometry analysis <t>RRM2</t> levels vs. DNA content. ( D ) Flow cytometry-based comparison of beta-tubulin (negative control, left) and RRM2 (right) levels in CycA+ (red) vs. CycA- (blue) prometaphase cells. ( E ) Violin plots showing CycA, histone H3, and RRM2 levels in cells treated with either DMSO or microtubule drugs that activate the spindle assembly checkpoint (nocodazole, monastrol, taxol). ( F ) Violin plots showing levels of RRM2 in cells treated with either vehicle control (DMSO), MG132, apcin + proTAME, or MLN4924.
Rrm2 Gfp, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rrm2 gfp/product/OriGene
Average 90 stars, based on 1 article reviews
rrm2 gfp - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

86
Bio-Rad mouse monoclonal anti rrm2 clone 1e1
Effects of RRM2B Depletion in Hypoxia (A) Immunoprecipitation of RRM1 followed by immunoblotting for RRM2B and <t>RRM2</t> in normoxia and <0.1% O 2 (18 hr). (B) dNTP levels in RKO cells treated with non-specific (siCTL) or siRRM2B and exposed to <0.1% O 2 (16 hr). (C) FACS analysis of U2OS cells treated with siCTL or siRRM2B and exposed to normoxia or <0.1% O 2 (3 hr). Cells were pulsed with bromodeoxyuridine (BrdU) (20 μM) 30 min before collection. (D) RPA32 foci in RKO RRM2B+/+ and RKO RRM2B−/− cells after exposure to <0.1% O 2 . (E) 53BP1 foci in RKO RRM2B+/+ and RKO RRM2B−/− cells exposed to normoxia or <0.1% O 2 (6 hr). (F) Representative images of 53BP1 foci in RRM2B-negative RKO cells treated with siRRM2B and exposed to normoxia or <0.1% O 2 (6 hr). Scale bar, 20 μm. (G) Colony survival assay in RKO cells treated with siCTL or siRRM2B and exposed to normoxia or <0.1% O 2 (24 hr). (H) Apoptosis detected morphologically in RKO cells treated with siCTL or siRRM2B and exposed to normoxia or <0.1% O 2 (19 hr). (I) RKO RRM2B+/+ and RKO RRM2B−/− cells were grown as xenografts in mice (n = 4 mice per each group). Where indicated, irradiation (10 Gy) was given when tumors reached ∼100 mm 3 . (J) Representative images of co-localization of cleaved caspase-3 (apoptosis) with PIMO (hypoxic areas) in RKO RRM2B+/+ or RKO RRM2B−/− xenografts. Scale bars, 50 μm. (K and L) Tumors were removed on day 28 post-implantation (from H), and the level of apoptosis was quantified in normoxic areas (PIMO negative) (K) and hypoxic areas (PIMO positive) (L). Images from three different tumors (n = 3) per group were counted. For all panels, n = 3 (biological replicates) unless otherwise stated. Data show mean ± SEM and two-tailed Student’s t test was applied, except in (D), where one-way ANOVA analysis was applied, and (I), where two-way ANOVA analysis was applied. (ns) indicates a non-significant change. See also and .
Mouse Monoclonal Anti Rrm2 Clone 1e1, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse monoclonal anti rrm2 clone 1e1/product/Bio-Rad
Average 86 stars, based on 1 article reviews
mouse monoclonal anti rrm2 clone 1e1 - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier

93
Sino Biological rrm2 lentiviral copy dna open reading frame
A. The expression of <t>RRM2</t> was detected via western blotting in synovial specimens from patients with RA and normal controls. The relative expression of RRM2 was shown in histogram. **p<0.01, compared to normal controls. B. MH7A cells were treated with TNF-α (10 ng/mL) and IL-1β (10 mg/L) for 24 h, and the expression of RRM2 was determined via western blotting. The relative expression of RRM2 was shown in histogram. **p<0.01, compared with untreated group. ##p<0.01, compared with untreated group. C. MH7A cells were treated with RRM2 shRNA lentivirus and <t>lentiviral</t> controls for 24 h. The relative expression of RRM2 was determined via western blotting and shown in histogram. **p<0.01, compared with control lentivirus group. D. MTT assay. MH7A cells were infected with RRM2 shRNA lentivirus and lentiviral controls for 24, 48, and 72 h, and cell viability was determined via MTT assay. **p<0.01. E. Clone formation assay. MH7A cells were infected with RRM2 shRNA and control shRNA lentivirus and cultured for 2 weeks. Colony formation assay was performed as described in Materials and Methods. The colony number was shown in histogram. **p<0.01, compared with control shRNA group. F. Migration and invasion assays. MH7A cells were infected with RRM2 shRNA and control shRNA lentiviruses and treated with 10 ng/mL of TNF-α. The migratory and invasive abilities were detected using transwell Boyden chamber coated without or with a Matrigel basement membrane matrix after 48 h. Original magnification ×100.
Rrm2 Lentiviral Copy Dna Open Reading Frame, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rrm2 lentiviral copy dna open reading frame/product/Sino Biological
Average 93 stars, based on 1 article reviews
rrm2 lentiviral copy dna open reading frame - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

91
OriGene human rrm2 reverse
MTT viability assay for different dosages of the drug combination cisplatin and gemcitabine after 24 h of incubation for NCI-H295R ( A ) and MUC-1 ( B ) cell lines. Pictures from NCI-H295R ( C ) and MUC-1 ( D ) clonogenic assays for different concentrations of gemcitabine (left) and cisplatin (right) treatment after 24 h incubation. Real-time PCR analysis of RRM1 for NCI-H295R ( E ) and MUC-1 ( F ), as well as <t>RRM2</t> ( G , H ) and RRM2B ( I , K ). dATP levels for NCI-H295R ( J ) and MUC-1 ( L ) upon different treatments. Quantification of RRM2 protein levels for NCI-H295R ( M ) and MUC-1 ( O ) and RRM2 immunofluorescence (40x) for NCI-H295R ( N ) and MUC-1 ( P ). A representative Western blot used for RRM2 protein expression quantification in NCI-H295R ( Q ) and MUC-1 ( R ) cells. Stars represent significance vs. nontreated for both treatments (*, p < 0.05; **, p < 0.01; ***, p < 0.001).
Human Rrm2 Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human rrm2 reverse/product/OriGene
Average 91 stars, based on 1 article reviews
human rrm2 reverse - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

90
Panomics Inc probes corresponding to rrm1, rrm2, ctnnb1, and human cyclophilin (ppib)
siRNA multiplex screen and follow-up deconvolution analysis. A, results from the CPT chemosensitization RNAi screen conducted in MDA-MB-231 breast cancer cells. The y axis represents the normalized activity of each siRNA multiplex in the presence of CPT (EC50) minus the normalized activity of each siRNA multiplex in the absence of CPT. Plate median values were used for normalization. B, deconvolution of the top seven sensitizing multiplexes (designate A–G), with values greater than 2 S.D. from the median, identified <t>RRM1</t> and RRM2 as gene targets whose silencing significantly enhanced the cytotoxicity of CPT. Targets known to be associated with cellular response to CPT-induced DNA damage were also identified (BRCA1 and ATR) (33).
Probes Corresponding To Rrm1, Rrm2, Ctnnb1, And Human Cyclophilin (Ppib), supplied by Panomics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/probes corresponding to rrm1, rrm2, ctnnb1, and human cyclophilin (ppib)/product/Panomics Inc
Average 90 stars, based on 1 article reviews
probes corresponding to rrm1, rrm2, ctnnb1, and human cyclophilin (ppib) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Human Protein Atlas protein expressions of rrm1, rrm2, and rrm2b
siRNA multiplex screen and follow-up deconvolution analysis. A, results from the CPT chemosensitization RNAi screen conducted in MDA-MB-231 breast cancer cells. The y axis represents the normalized activity of each siRNA multiplex in the presence of CPT (EC50) minus the normalized activity of each siRNA multiplex in the absence of CPT. Plate median values were used for normalization. B, deconvolution of the top seven sensitizing multiplexes (designate A–G), with values greater than 2 S.D. from the median, identified <t>RRM1</t> and RRM2 as gene targets whose silencing significantly enhanced the cytotoxicity of CPT. Targets known to be associated with cellular response to CPT-induced DNA damage were also identified (BRCA1 and ATR) (33).
Protein Expressions Of Rrm1, Rrm2, And Rrm2b, supplied by Human Protein Atlas, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/protein expressions of rrm1, rrm2, and rrm2b/product/Human Protein Atlas
Average 90 stars, based on 1 article reviews
protein expressions of rrm1, rrm2, and rrm2b - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

93
Sino Biological human rrm2 gene orf cdna clone in cloning vector
siRNA multiplex screen and follow-up deconvolution analysis. A, results from the CPT chemosensitization RNAi screen conducted in MDA-MB-231 breast cancer cells. The y axis represents the normalized activity of each siRNA multiplex in the presence of CPT (EC50) minus the normalized activity of each siRNA multiplex in the absence of CPT. Plate median values were used for normalization. B, deconvolution of the top seven sensitizing multiplexes (designate A–G), with values greater than 2 S.D. from the median, identified <t>RRM1</t> and RRM2 as gene targets whose silencing significantly enhanced the cytotoxicity of CPT. Targets known to be associated with cellular response to CPT-induced DNA damage were also identified (BRCA1 and ATR) (33).
Human Rrm2 Gene Orf Cdna Clone In Cloning Vector, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human rrm2 gene orf cdna clone in cloning vector/product/Sino Biological
Average 93 stars, based on 1 article reviews
human rrm2 gene orf cdna clone in cloning vector - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
OriGene rrm2 (nm_001034) human recombinant protein
siRNA multiplex screen and follow-up deconvolution analysis. A, results from the CPT chemosensitization RNAi screen conducted in MDA-MB-231 breast cancer cells. The y axis represents the normalized activity of each siRNA multiplex in the presence of CPT (EC50) minus the normalized activity of each siRNA multiplex in the absence of CPT. Plate median values were used for normalization. B, deconvolution of the top seven sensitizing multiplexes (designate A–G), with values greater than 2 S.D. from the median, identified <t>RRM1</t> and RRM2 as gene targets whose silencing significantly enhanced the cytotoxicity of CPT. Targets known to be associated with cellular response to CPT-induced DNA damage were also identified (BRCA1 and ATR) (33).
Rrm2 (Nm 001034) Human Recombinant Protein, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rrm2 (nm_001034) human recombinant protein/product/OriGene
Average 90 stars, based on 1 article reviews
rrm2 (nm_001034) human recombinant protein - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

93
Genecopoeia mirna 3´utr target expression clone for human rrm2
siRNA multiplex screen and follow-up deconvolution analysis. A, results from the CPT chemosensitization RNAi screen conducted in MDA-MB-231 breast cancer cells. The y axis represents the normalized activity of each siRNA multiplex in the presence of CPT (EC50) minus the normalized activity of each siRNA multiplex in the absence of CPT. Plate median values were used for normalization. B, deconvolution of the top seven sensitizing multiplexes (designate A–G), with values greater than 2 S.D. from the median, identified <t>RRM1</t> and RRM2 as gene targets whose silencing significantly enhanced the cytotoxicity of CPT. Targets known to be associated with cellular response to CPT-induced DNA damage were also identified (BRCA1 and ATR) (33).
Mirna 3´Utr Target Expression Clone For Human Rrm2, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mirna 3´utr target expression clone for human rrm2/product/Genecopoeia
Average 93 stars, based on 1 article reviews
mirna 3´utr target expression clone for human rrm2 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

Image Search Results


(A) dNTP production in small interfering RNA (siRNA)-transfected cells. dNTP was detected at both 48 hours and 72 hours post-transfection of siRNAs in C4-2 cells. siNS, nonspecific siRNA. (B) siRRM2-induced DNA damage. DNA damage marker activation was monitored in LNCaP and C4-2 cells using Muse multi-color DNA damage kit. (C) Activation of H2A.X was confirmed by immunoblotting. (D) and (E) Analysis of cell proliferation (D) and cell cycle (E) in transfected cells. (F) Apoptosis detected by Annexin V assays and immunoblots. (G) dNTP production in empty vector (EV)/RRM2-overexpressing PC-3 cells (PC3-EV; PC3-RRM2). (H) Cell proliferation in stable cells. (I) soft agar assays of stable PC-3 cells. The colony numbers were normalized to those in the control cells. (J) Wound healing assays after the scratch done for 24 hours. (K) Invasion assays after cells were plated for 48 hours. (L) and (M) EMT marker expression detected by qPCR (L) and immunoblots (M) in both EV- and RRM2-expressing PC-3 cells. (N) Invasion assays after multiple siRNAs were transfected in PC3-RRM2 cells. Figure 1 values represent the mean ± S.E. of three independent experiments. *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001 vs control groups treated with empty vector (EV) or with nonspecific (siNS) siRNA.

Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

Article Title: A novel mechanism driving poor-prognosis prostate cancer: overexpression of the DNA repair gene, ribonucleotide reductase small subunit M2 (RRM2)

doi: 10.1158/1078-0432.CCR-18-4046

Figure Lengend Snippet: (A) dNTP production in small interfering RNA (siRNA)-transfected cells. dNTP was detected at both 48 hours and 72 hours post-transfection of siRNAs in C4-2 cells. siNS, nonspecific siRNA. (B) siRRM2-induced DNA damage. DNA damage marker activation was monitored in LNCaP and C4-2 cells using Muse multi-color DNA damage kit. (C) Activation of H2A.X was confirmed by immunoblotting. (D) and (E) Analysis of cell proliferation (D) and cell cycle (E) in transfected cells. (F) Apoptosis detected by Annexin V assays and immunoblots. (G) dNTP production in empty vector (EV)/RRM2-overexpressing PC-3 cells (PC3-EV; PC3-RRM2). (H) Cell proliferation in stable cells. (I) soft agar assays of stable PC-3 cells. The colony numbers were normalized to those in the control cells. (J) Wound healing assays after the scratch done for 24 hours. (K) Invasion assays after cells were plated for 48 hours. (L) and (M) EMT marker expression detected by qPCR (L) and immunoblots (M) in both EV- and RRM2-expressing PC-3 cells. (N) Invasion assays after multiple siRNAs were transfected in PC3-RRM2 cells. Figure 1 values represent the mean ± S.E. of three independent experiments. *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001 vs control groups treated with empty vector (EV) or with nonspecific (siNS) siRNA.

Article Snippet: For luciferase reporter assays, siRNAs were transfected in cells for 24 hours and 500 ng of RRM2 promoter reporters (GeneCopoeia) containing 0kb or 3kb promoter sequence of human RRM2 were cotransfected with Lipofectamine 2000 (Invitrogen).

Techniques: Small Interfering RNA, Transfection, Marker, Activation Assay, Western Blot, Plasmid Preparation, Control, Expressing

(A)-(C) The correlation of gene alteration with the fraction of genome altered (FGA) and Gleason grades in TCGA cohort was visualized in (A). The statistical quantitation was shown in (B) and (C). (D) The correlation of RRM2 level with Gleason grade in tumor and matched normal tissues in the PHS/HPFS cohorts. (E) and (F) The correlation of RRM2 expression with tumor progression in Taylor and Grasso cohorts. RRM2 levels were analyzed in prostate gland (PG), primary (Pri), and metastasis (Met) tissue samples. (G) The association of RRM2 expression and the disease-free survival in the TCGA, Taylor, and Glinsky cohorts. (H) The correlation of RRM2 with the risk of lethal prostate cancer over long-term follow-up, independent from clinical characteristics and Gleason grade, in the combined HPFS and PHS prostate cancer cohorts. The odd ratios for lethal disease were adjusted for Gleason score. ****, p<0.0001 vs comparator groups.

Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

Article Title: A novel mechanism driving poor-prognosis prostate cancer: overexpression of the DNA repair gene, ribonucleotide reductase small subunit M2 (RRM2)

doi: 10.1158/1078-0432.CCR-18-4046

Figure Lengend Snippet: (A)-(C) The correlation of gene alteration with the fraction of genome altered (FGA) and Gleason grades in TCGA cohort was visualized in (A). The statistical quantitation was shown in (B) and (C). (D) The correlation of RRM2 level with Gleason grade in tumor and matched normal tissues in the PHS/HPFS cohorts. (E) and (F) The correlation of RRM2 expression with tumor progression in Taylor and Grasso cohorts. RRM2 levels were analyzed in prostate gland (PG), primary (Pri), and metastasis (Met) tissue samples. (G) The association of RRM2 expression and the disease-free survival in the TCGA, Taylor, and Glinsky cohorts. (H) The correlation of RRM2 with the risk of lethal prostate cancer over long-term follow-up, independent from clinical characteristics and Gleason grade, in the combined HPFS and PHS prostate cancer cohorts. The odd ratios for lethal disease were adjusted for Gleason score. ****, p<0.0001 vs comparator groups.

Article Snippet: For luciferase reporter assays, siRNAs were transfected in cells for 24 hours and 500 ng of RRM2 promoter reporters (GeneCopoeia) containing 0kb or 3kb promoter sequence of human RRM2 were cotransfected with Lipofectamine 2000 (Invitrogen).

Techniques: Quantitation Assay, Expressing

(A) Gene set enrichment analysis (GSEA) of transcriptomic changes. The histograms showed the distribution of select top GSEA molecular signatures: MYC targets (MYC_up_V1_up gene set); E2F targets (hallmark_E2F_targets gene set), cell cycle (Module_54 gene set), p53 pathway (hallmark_p53_pathway), and apoptosis (hallmark apoptosis). Up-gene (up-regulated genes); Down-gene (down-regulated genes). (B) Multiple targets of pathways were validated by quantitative reverse transcription PCR (qRT-PCR). (C) siRRM2-regulated gene profiling and the correlation of these genes with disease-free survival (DFS) in Taylor cohort. (D) Significant enrichment in EMT and Angiogenesis gene sets in RRM2-overexpressing PC-3 cells. (E) RRM2-regulated 126-gene profiling and correlation with the clinical outcome in clinical cohorts. 126 genes were revealed by overlapping 1230 up-regulated genes in PC3-RRM2 cells with 627 common genes positively correlated with RRM2 overexpression in three prostate cancer cohorts (TCGA, Kumar, and SU2C/PCF). The correlation of these genes with disease-free survival was analyzed in the Taylor cohort.

Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

Article Title: A novel mechanism driving poor-prognosis prostate cancer: overexpression of the DNA repair gene, ribonucleotide reductase small subunit M2 (RRM2)

doi: 10.1158/1078-0432.CCR-18-4046

Figure Lengend Snippet: (A) Gene set enrichment analysis (GSEA) of transcriptomic changes. The histograms showed the distribution of select top GSEA molecular signatures: MYC targets (MYC_up_V1_up gene set); E2F targets (hallmark_E2F_targets gene set), cell cycle (Module_54 gene set), p53 pathway (hallmark_p53_pathway), and apoptosis (hallmark apoptosis). Up-gene (up-regulated genes); Down-gene (down-regulated genes). (B) Multiple targets of pathways were validated by quantitative reverse transcription PCR (qRT-PCR). (C) siRRM2-regulated gene profiling and the correlation of these genes with disease-free survival (DFS) in Taylor cohort. (D) Significant enrichment in EMT and Angiogenesis gene sets in RRM2-overexpressing PC-3 cells. (E) RRM2-regulated 126-gene profiling and correlation with the clinical outcome in clinical cohorts. 126 genes were revealed by overlapping 1230 up-regulated genes in PC3-RRM2 cells with 627 common genes positively correlated with RRM2 overexpression in three prostate cancer cohorts (TCGA, Kumar, and SU2C/PCF). The correlation of these genes with disease-free survival was analyzed in the Taylor cohort.

Article Snippet: For luciferase reporter assays, siRNAs were transfected in cells for 24 hours and 500 ng of RRM2 promoter reporters (GeneCopoeia) containing 0kb or 3kb promoter sequence of human RRM2 were cotransfected with Lipofectamine 2000 (Invitrogen).

Techniques: Reverse Transcription, Quantitative RT-PCR, Over Expression

(A) dNTP production in COH29-treated C4-2 cells. Two doses of COH29 were used in C4-2 cells, and dNTP production was detected after 24 hours of treatment. (B) and (C) Activation of DNA damage markers. (D) Cell proliferation assay. (E) Cell cycle analysis after 48 hours of COH29 treatment. (F) COH29-induced apoptosis. (G) The global mRNA changes induced by COH29 in C4-2 cells, after 48 hours of treatment. (H) GSEA analysis of mRNA profiling in 20 μM of COH29-treated cells. The histograms showed the distribution of select top GSEA molecular signatures. Up-gene (COH29-induced up-regulated genes); Down-gene (COH29-induced down-regulated genes). NES, normalized enrichment score; FDR, false discovery rate. (I) and (J) Identification of targeted genes by inhibition of RRM2. Genes affected by inhibition of RRM2 in cells were overlapped with genes correlated with RRM2 overexpression in Taylor cohort to reveal 33 down-regulated genes and 12 up-regulated genes (I). These gene panels were validated in three additional prostate cancer cohorts (J). The Figure 4 values represent the mean ± S.E. of three independent experiments. *, p<0.05; **, p<0.01; ***, p<0.001 vs control groups.

Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

Article Title: A novel mechanism driving poor-prognosis prostate cancer: overexpression of the DNA repair gene, ribonucleotide reductase small subunit M2 (RRM2)

doi: 10.1158/1078-0432.CCR-18-4046

Figure Lengend Snippet: (A) dNTP production in COH29-treated C4-2 cells. Two doses of COH29 were used in C4-2 cells, and dNTP production was detected after 24 hours of treatment. (B) and (C) Activation of DNA damage markers. (D) Cell proliferation assay. (E) Cell cycle analysis after 48 hours of COH29 treatment. (F) COH29-induced apoptosis. (G) The global mRNA changes induced by COH29 in C4-2 cells, after 48 hours of treatment. (H) GSEA analysis of mRNA profiling in 20 μM of COH29-treated cells. The histograms showed the distribution of select top GSEA molecular signatures. Up-gene (COH29-induced up-regulated genes); Down-gene (COH29-induced down-regulated genes). NES, normalized enrichment score; FDR, false discovery rate. (I) and (J) Identification of targeted genes by inhibition of RRM2. Genes affected by inhibition of RRM2 in cells were overlapped with genes correlated with RRM2 overexpression in Taylor cohort to reveal 33 down-regulated genes and 12 up-regulated genes (I). These gene panels were validated in three additional prostate cancer cohorts (J). The Figure 4 values represent the mean ± S.E. of three independent experiments. *, p<0.05; **, p<0.01; ***, p<0.001 vs control groups.

Article Snippet: For luciferase reporter assays, siRNAs were transfected in cells for 24 hours and 500 ng of RRM2 promoter reporters (GeneCopoeia) containing 0kb or 3kb promoter sequence of human RRM2 were cotransfected with Lipofectamine 2000 (Invitrogen).

Techniques: Activation Assay, Proliferation Assay, Cell Cycle Assay, Inhibition, Over Expression, Control

(A)-(B) Phospho-kinase array analysis after 24-hour COH29 treatment in C4-2 cells. The whole-cell lysates were collected for human phospho-kinase array analysis. Each membrane contains kinase-specific antibodies (number indicated). Relative phosphorylation of spots was quantified by Image J software and the value of vehicle (0 μM) was set up as “1” (B). (C) Validation of phospho-kinase array by immunoblots. For siRNA-treated groups, cell lysates were collected after transfection for 48 hours. The representative blots for each condition are shown and the values represent the mean ± S.E. of two independent experiments. (D) Druggable RRM2 signatures. Top three drugs from ToppGene analysis and COH29 are shown (left panel). Numbers of genes down-regulated by docetaxel (in PC-3 cells) and docetaxel + ADT (in patients) are shown (right panel). (E)-(F) Antitumor effects of COH29 in vivo. Tumor volumes and weights were measured following oral administration of COH29 (200 mg/kg) in established C4-2 xenograft tumors (n=6 per group). Values are means ± S.E. ***P<0.001 versus vehicle mice. (G)-(H) Regulation of key genes by COH29 in vivo. Multiple genes regulated by COH29 were assessed in xenograft tumors by immunohistochemistry staining (G) or immunoblotting (H).

Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

Article Title: A novel mechanism driving poor-prognosis prostate cancer: overexpression of the DNA repair gene, ribonucleotide reductase small subunit M2 (RRM2)

doi: 10.1158/1078-0432.CCR-18-4046

Figure Lengend Snippet: (A)-(B) Phospho-kinase array analysis after 24-hour COH29 treatment in C4-2 cells. The whole-cell lysates were collected for human phospho-kinase array analysis. Each membrane contains kinase-specific antibodies (number indicated). Relative phosphorylation of spots was quantified by Image J software and the value of vehicle (0 μM) was set up as “1” (B). (C) Validation of phospho-kinase array by immunoblots. For siRNA-treated groups, cell lysates were collected after transfection for 48 hours. The representative blots for each condition are shown and the values represent the mean ± S.E. of two independent experiments. (D) Druggable RRM2 signatures. Top three drugs from ToppGene analysis and COH29 are shown (left panel). Numbers of genes down-regulated by docetaxel (in PC-3 cells) and docetaxel + ADT (in patients) are shown (right panel). (E)-(F) Antitumor effects of COH29 in vivo. Tumor volumes and weights were measured following oral administration of COH29 (200 mg/kg) in established C4-2 xenograft tumors (n=6 per group). Values are means ± S.E. ***P<0.001 versus vehicle mice. (G)-(H) Regulation of key genes by COH29 in vivo. Multiple genes regulated by COH29 were assessed in xenograft tumors by immunohistochemistry staining (G) or immunoblotting (H).

Article Snippet: For luciferase reporter assays, siRNAs were transfected in cells for 24 hours and 500 ng of RRM2 promoter reporters (GeneCopoeia) containing 0kb or 3kb promoter sequence of human RRM2 were cotransfected with Lipofectamine 2000 (Invitrogen).

Techniques: Membrane, Phospho-proteomics, Software, Biomarker Discovery, Western Blot, Transfection, In Vivo, Immunohistochemistry, Staining

(A) H3K27Ac ChIP-Seq in tissues. The binding signal on RRM2 enhancer (1Mb region) was quantified. (B) The strategy to identify RRM2-targeting transcription factors (TFs). Human TFs were selected in the genes positively correlated with RRM2 expression in prostate cancer cohorts. Yellow/orange/pink bars indicate that TFs appear in four/three/two cohorts. (C) The correlation of FOXM1 and RRM2 in PHS/HPFS cohorts. (D) FOXM1 binding on RRM2 promoter in cancer cells. The overview of multiple ChIP-Seq datasets were extracted from Cistrome Data browser. P1-P3 primers were designed for FOXM1 ChIP-PCR. (E) FOXM1 or H3K4me3-ChIP-PCR on RRM2 promoter. (F) RRM2 promoter activity regulated by FOXM1. The reporters without (R2-0K) or with (R2-3K) 3kb RRM2 promoter sequence were transfected in siRNA-treated 22Rv1 cells. (G) and (H) Inhibition of RRM2 expression by siFOXM1 in 22Rv1 and C4-2 cells. (I) Inhibition of FOXM1 targets by FDI-6 (20 μM) in 22Rv1 cells. The Figure 6 values represent the mean ± S.E. of three independent experiments. *, p<0.05; **, p<0.01; ***, p<0.001 vs control groups.

Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

Article Title: A novel mechanism driving poor-prognosis prostate cancer: overexpression of the DNA repair gene, ribonucleotide reductase small subunit M2 (RRM2)

doi: 10.1158/1078-0432.CCR-18-4046

Figure Lengend Snippet: (A) H3K27Ac ChIP-Seq in tissues. The binding signal on RRM2 enhancer (1Mb region) was quantified. (B) The strategy to identify RRM2-targeting transcription factors (TFs). Human TFs were selected in the genes positively correlated with RRM2 expression in prostate cancer cohorts. Yellow/orange/pink bars indicate that TFs appear in four/three/two cohorts. (C) The correlation of FOXM1 and RRM2 in PHS/HPFS cohorts. (D) FOXM1 binding on RRM2 promoter in cancer cells. The overview of multiple ChIP-Seq datasets were extracted from Cistrome Data browser. P1-P3 primers were designed for FOXM1 ChIP-PCR. (E) FOXM1 or H3K4me3-ChIP-PCR on RRM2 promoter. (F) RRM2 promoter activity regulated by FOXM1. The reporters without (R2-0K) or with (R2-3K) 3kb RRM2 promoter sequence were transfected in siRNA-treated 22Rv1 cells. (G) and (H) Inhibition of RRM2 expression by siFOXM1 in 22Rv1 and C4-2 cells. (I) Inhibition of FOXM1 targets by FDI-6 (20 μM) in 22Rv1 cells. The Figure 6 values represent the mean ± S.E. of three independent experiments. *, p<0.05; **, p<0.01; ***, p<0.001 vs control groups.

Article Snippet: For luciferase reporter assays, siRNAs were transfected in cells for 24 hours and 500 ng of RRM2 promoter reporters (GeneCopoeia) containing 0kb or 3kb promoter sequence of human RRM2 were cotransfected with Lipofectamine 2000 (Invitrogen).

Techniques: ChIP-sequencing, Binding Assay, Expressing, Activity Assay, Sequencing, Transfection, Inhibition, Control

A, RRM2 mRNA expression in pancreatic cancer cell lines relative to expression identified in HPDE. Columns, mean of triplicate; bars, SD. n = 3. B, Western blotting analysis of RRM2 (∼45 kDa) and β-actin (45 kDa) in whole cell lysates of HPDE and pancreatic cancer cell lines. C, Expression of let- 7 family members in pancreatic cancer cell lines relative to expression in HPDE. Columns , mean of triplicate; bars , SD. n = 3; * P <0.05. D, RRM2 is a direct target of let-7 . 293TA and MIA PaCa-2 cells were virally infected for expression of precursors of let-7a-1 , let-7a-2 , let-7a-3 , let-7b , and miR-214 ( negative control ) and subsequently transfected with a RRM2 3′ UTR luciferase reporter construct. Luciferase activities measured 36 h after transfection (normalized relative to renilla activity) were plotted. Columns , mean of triplicate; bars , SD. n = 3. * p <0.05, ** p <0.01.

Journal: PLoS ONE

Article Title: Differential Processing of let-7 a Precursors Influences RRM2 Expression and Chemosensitivity in Pancreatic Cancer: Role of LIN-28 and SET Oncoprotein

doi: 10.1371/journal.pone.0053436

Figure Lengend Snippet: A, RRM2 mRNA expression in pancreatic cancer cell lines relative to expression identified in HPDE. Columns, mean of triplicate; bars, SD. n = 3. B, Western blotting analysis of RRM2 (∼45 kDa) and β-actin (45 kDa) in whole cell lysates of HPDE and pancreatic cancer cell lines. C, Expression of let- 7 family members in pancreatic cancer cell lines relative to expression in HPDE. Columns , mean of triplicate; bars , SD. n = 3; * P <0.05. D, RRM2 is a direct target of let-7 . 293TA and MIA PaCa-2 cells were virally infected for expression of precursors of let-7a-1 , let-7a-2 , let-7a-3 , let-7b , and miR-214 ( negative control ) and subsequently transfected with a RRM2 3′ UTR luciferase reporter construct. Luciferase activities measured 36 h after transfection (normalized relative to renilla activity) were plotted. Columns , mean of triplicate; bars , SD. n = 3. * p <0.05, ** p <0.01.

Article Snippet: RRM2 cDNA without the 3′ UTR region was constructed from RRM2 truclone (RRM2 (NM_001165931) Human cDNA Clone; Product ID: SC326997; Origene, MD) using PCR-based methods.

Techniques: Expressing, Western Blot, Infection, Negative Control, Transfection, Luciferase, Construct, Activity Assay

A , Western blotting analysis of RRM2 (∼45 kDa) and β-actin (45 kDA) in whole cell lysates of MIA PaCa-2 overexpressing precursors of let-7 family members. Ratios of RRM2 to β-actin band intensities (normalized to control) from three experiments are indicated ( top ). Asterisks indicate significant reductions ( p <0.05) in RRM2 levels compared with control. B , Immunocytochemical detection of RRM2 in exponentially growing MIA PaCa-2 overexpressing pre- let-7 family members. Original magnification, x20. C , MIA PaCa-2 cells stably overexpressing pre- let-7 family members ( red ) or vector alone ( blue ) were treated with gemcitabine (0.1 nM to 100 µM), and percent inhibition of cellular proliferation was measured using an MTT assay. Points , mean of triplicate; bars , SE. n = 3. Gemcitabine IC 50 estimations indicated ( parentheses ).

Journal: PLoS ONE

Article Title: Differential Processing of let-7 a Precursors Influences RRM2 Expression and Chemosensitivity in Pancreatic Cancer: Role of LIN-28 and SET Oncoprotein

doi: 10.1371/journal.pone.0053436

Figure Lengend Snippet: A , Western blotting analysis of RRM2 (∼45 kDa) and β-actin (45 kDA) in whole cell lysates of MIA PaCa-2 overexpressing precursors of let-7 family members. Ratios of RRM2 to β-actin band intensities (normalized to control) from three experiments are indicated ( top ). Asterisks indicate significant reductions ( p <0.05) in RRM2 levels compared with control. B , Immunocytochemical detection of RRM2 in exponentially growing MIA PaCa-2 overexpressing pre- let-7 family members. Original magnification, x20. C , MIA PaCa-2 cells stably overexpressing pre- let-7 family members ( red ) or vector alone ( blue ) were treated with gemcitabine (0.1 nM to 100 µM), and percent inhibition of cellular proliferation was measured using an MTT assay. Points , mean of triplicate; bars , SE. n = 3. Gemcitabine IC 50 estimations indicated ( parentheses ).

Article Snippet: RRM2 cDNA without the 3′ UTR region was constructed from RRM2 truclone (RRM2 (NM_001165931) Human cDNA Clone; Product ID: SC326997; Origene, MD) using PCR-based methods.

Techniques: Western Blot, Stable Transfection, Plasmid Preparation, Inhibition, MTT Assay

A, Western blotting analysis of hENT1 (∼50–55 kDa), hENT2 (50 kDa), hCNT1 (72 kDa), hCNT3 (77 kDa), CDA (55 kDa), dCK (30 kDa), RRM1 (94 kDa), RRM2 (45 kDa), and β-actin (45 kDA) levels in whole cell lysates of Capan-1 and Capan-1-GR cells. B , RRM2 protein increased in a gemcitabine dose-dependent fashion in Capan-1-GR cells. C, Western blotting analysis of RRM2 (∼45 kDa) and β-actin (45 kDA) levels in cells with acquired gemcitabine resistance. Ratios of RRM2 to β-actin band intensities (normalized to untreated cells) from three experiments are indicated ( top ). Asterisk indicates significantly higher RRM2 expression in gemcitabine-resistant cells ( p <0.05) compared with untreated cells. D and E, Relative expression of precursor and mature let-7a in Capan-1 ( D ) and L3.6pl ( E ) cells induced to acquire gemcitabine resistance. Columns, mean of triplicate; bars, SD. n = 3. F , Differential miRNA expression in Capan-1-GR compared with Capan-1. Putative RRM2-modulating miRNAs and their extent of reduction in Capan-1-GR cells are shown ( right ).

Journal: PLoS ONE

Article Title: Differential Processing of let-7 a Precursors Influences RRM2 Expression and Chemosensitivity in Pancreatic Cancer: Role of LIN-28 and SET Oncoprotein

doi: 10.1371/journal.pone.0053436

Figure Lengend Snippet: A, Western blotting analysis of hENT1 (∼50–55 kDa), hENT2 (50 kDa), hCNT1 (72 kDa), hCNT3 (77 kDa), CDA (55 kDa), dCK (30 kDa), RRM1 (94 kDa), RRM2 (45 kDa), and β-actin (45 kDA) levels in whole cell lysates of Capan-1 and Capan-1-GR cells. B , RRM2 protein increased in a gemcitabine dose-dependent fashion in Capan-1-GR cells. C, Western blotting analysis of RRM2 (∼45 kDa) and β-actin (45 kDA) levels in cells with acquired gemcitabine resistance. Ratios of RRM2 to β-actin band intensities (normalized to untreated cells) from three experiments are indicated ( top ). Asterisk indicates significantly higher RRM2 expression in gemcitabine-resistant cells ( p <0.05) compared with untreated cells. D and E, Relative expression of precursor and mature let-7a in Capan-1 ( D ) and L3.6pl ( E ) cells induced to acquire gemcitabine resistance. Columns, mean of triplicate; bars, SD. n = 3. F , Differential miRNA expression in Capan-1-GR compared with Capan-1. Putative RRM2-modulating miRNAs and their extent of reduction in Capan-1-GR cells are shown ( right ).

Article Snippet: RRM2 cDNA without the 3′ UTR region was constructed from RRM2 truclone (RRM2 (NM_001165931) Human cDNA Clone; Product ID: SC326997; Origene, MD) using PCR-based methods.

Techniques: Western Blot, Expressing

A and B, Relative expression of primary let-7a transcripts ( A ) and mature let-7a ( B ) in 2 normal pancreatic tissues and 10 PDAC samples representing various tumor stages. C , Ratios of mature to precursor let-7a transcripts calculated from data points in A and B . D, Western blotting analysis of RRM2 (45 kDa) in total lysates (50 µg) of 6 matched normal-PDAC pairs. Ratios of RRM2 band intensities in PDACs compared to matched normal tissues indicated ( top ). Asterisk indicates significantly higher RRM2 expression in PDAC tissues ( p <0.05) compared with matched normal tissues. E and F, Relative expression of primary let-7a transcripts ( E ) and mature let-7a ( F ) in matched normal-PDAC pairs. G , Ratios of mature to precursor let-7a transcripts calculated from data points in E and F . Asterisk indicates significantly lower mature to precursor let-7a ratio in PDAC tissues ( p <0.05) compared with matched normal tissues.

Journal: PLoS ONE

Article Title: Differential Processing of let-7 a Precursors Influences RRM2 Expression and Chemosensitivity in Pancreatic Cancer: Role of LIN-28 and SET Oncoprotein

doi: 10.1371/journal.pone.0053436

Figure Lengend Snippet: A and B, Relative expression of primary let-7a transcripts ( A ) and mature let-7a ( B ) in 2 normal pancreatic tissues and 10 PDAC samples representing various tumor stages. C , Ratios of mature to precursor let-7a transcripts calculated from data points in A and B . D, Western blotting analysis of RRM2 (45 kDa) in total lysates (50 µg) of 6 matched normal-PDAC pairs. Ratios of RRM2 band intensities in PDACs compared to matched normal tissues indicated ( top ). Asterisk indicates significantly higher RRM2 expression in PDAC tissues ( p <0.05) compared with matched normal tissues. E and F, Relative expression of primary let-7a transcripts ( E ) and mature let-7a ( F ) in matched normal-PDAC pairs. G , Ratios of mature to precursor let-7a transcripts calculated from data points in E and F . Asterisk indicates significantly lower mature to precursor let-7a ratio in PDAC tissues ( p <0.05) compared with matched normal tissues.

Article Snippet: RRM2 cDNA without the 3′ UTR region was constructed from RRM2 truclone (RRM2 (NM_001165931) Human cDNA Clone; Product ID: SC326997; Origene, MD) using PCR-based methods.

Techniques: Expressing, Western Blot

( A ) Line graphs showing mean abundance profiles for Cyclin A2 (CycA), Cyclin B1, Cyclin B2, and GAPDH. Grey ribbons indicate 1 standard deviation from the mean. ( B ) Mean abundance profile for RRM2. ( C ) Flow cytometry analysis RRM2 levels vs. DNA content. ( D ) Flow cytometry-based comparison of beta-tubulin (negative control, left) and RRM2 (right) levels in CycA+ (red) vs. CycA- (blue) prometaphase cells. ( E ) Violin plots showing CycA, histone H3, and RRM2 levels in cells treated with either DMSO or microtubule drugs that activate the spindle assembly checkpoint (nocodazole, monastrol, taxol). ( F ) Violin plots showing levels of RRM2 in cells treated with either vehicle control (DMSO), MG132, apcin + proTAME, or MLN4924.

Journal: eLife

Article Title: Proteomic analysis of cell cycle progression in asynchronous cultures, including mitotic subphases, using PRIMMUS

doi: 10.7554/eLife.27574

Figure Lengend Snippet: ( A ) Line graphs showing mean abundance profiles for Cyclin A2 (CycA), Cyclin B1, Cyclin B2, and GAPDH. Grey ribbons indicate 1 standard deviation from the mean. ( B ) Mean abundance profile for RRM2. ( C ) Flow cytometry analysis RRM2 levels vs. DNA content. ( D ) Flow cytometry-based comparison of beta-tubulin (negative control, left) and RRM2 (right) levels in CycA+ (red) vs. CycA- (blue) prometaphase cells. ( E ) Violin plots showing CycA, histone H3, and RRM2 levels in cells treated with either DMSO or microtubule drugs that activate the spindle assembly checkpoint (nocodazole, monastrol, taxol). ( F ) Violin plots showing levels of RRM2 in cells treated with either vehicle control (DMSO), MG132, apcin + proTAME, or MLN4924.

Article Snippet: DNA, Expression construct , RRM2-GFP , Origene , RG205718 , .

Techniques: Standard Deviation, Flow Cytometry, Negative Control

Flow cytometry analysis of cells treated either with non-targeting siRNA (siJumble), or siRNA against RRM2 and stained either with secondary antibody only ( A ), or anti-RRM2 antibody ( B ). ( C ) Immunoblot analysis of siJumble vs. siRRM2 cell lysates. ( D ) Overexpression of GFP-Fibrillarin (top) and RRM2-GFP (bottom). GFP and anti-RRM2 staining shows high correlation.

Journal: eLife

Article Title: Proteomic analysis of cell cycle progression in asynchronous cultures, including mitotic subphases, using PRIMMUS

doi: 10.7554/eLife.27574

Figure Lengend Snippet: Flow cytometry analysis of cells treated either with non-targeting siRNA (siJumble), or siRNA against RRM2 and stained either with secondary antibody only ( A ), or anti-RRM2 antibody ( B ). ( C ) Immunoblot analysis of siJumble vs. siRRM2 cell lysates. ( D ) Overexpression of GFP-Fibrillarin (top) and RRM2-GFP (bottom). GFP and anti-RRM2 staining shows high correlation.

Article Snippet: DNA, Expression construct , RRM2-GFP , Origene , RG205718 , .

Techniques: Flow Cytometry, Staining, Western Blot, Over Expression

( A ) A representative image of FUCCI U2OS cells immunostained for RRM2. ( B ) A psuedocolour scatter plot with x- and y- axes representing the two proteins used in the FUCCI cell cycle reporter system (Red: Cdt1, Green: Geminin) with colour indicating anti-RRM2 signal. ( C ) Bar chart summarising ( B ).

Journal: eLife

Article Title: Proteomic analysis of cell cycle progression in asynchronous cultures, including mitotic subphases, using PRIMMUS

doi: 10.7554/eLife.27574

Figure Lengend Snippet: ( A ) A representative image of FUCCI U2OS cells immunostained for RRM2. ( B ) A psuedocolour scatter plot with x- and y- axes representing the two proteins used in the FUCCI cell cycle reporter system (Red: Cdt1, Green: Geminin) with colour indicating anti-RRM2 signal. ( C ) Bar chart summarising ( B ).

Article Snippet: DNA, Expression construct , RRM2-GFP , Origene , RG205718 , .

Techniques:

Anti-Cyclin B1 and anti-RRM2 signals were measured in U2OS cells by immunofluorescence microscopy. Representative images of cyclin B (A, left) and RRM2 (A, right) staining. (B) Quantitation of immunofluorescence with cells ranked ordered based on Cyclin B1 signal. The arrow indicates nuclear concentration of Cyclin B1 signal, which marks mitotic entry.

Journal: eLife

Article Title: Proteomic analysis of cell cycle progression in asynchronous cultures, including mitotic subphases, using PRIMMUS

doi: 10.7554/eLife.27574

Figure Lengend Snippet: Anti-Cyclin B1 and anti-RRM2 signals were measured in U2OS cells by immunofluorescence microscopy. Representative images of cyclin B (A, left) and RRM2 (A, right) staining. (B) Quantitation of immunofluorescence with cells ranked ordered based on Cyclin B1 signal. The arrow indicates nuclear concentration of Cyclin B1 signal, which marks mitotic entry.

Article Snippet: DNA, Expression construct , RRM2-GFP , Origene , RG205718 , .

Techniques: Immunofluorescence, Microscopy, Staining, Quantitation Assay, Concentration Assay

A) Data from proteomic datasets from the Lamond laboratory can be easily visualised for the same proteins using the navigation bubble map. User interface features include: B) specifying type of search, including search for individual proteins, GO term, and CORUM complex membership, (C) an input box for protein and other identifiers (e.g. GO term), (D) a ribbon graph showing plots for input protein identifiers (here for illustration are shown RRM2 and CCNB1) with lines indicating mean profile and ribbons indicating s.e.m., (E) an interactive legend to show more information on individual proteins, and F) options to output visualisation as an SVG file or underlying data in CSV format. ( G ) An example plot correlating protein abundance and phosphorylation changes. Several proteins containing ‘early rising’ phosphorylation sites are highlighted: CENPF, TMPO, and RIF1.

Journal: eLife

Article Title: Proteomic analysis of cell cycle progression in asynchronous cultures, including mitotic subphases, using PRIMMUS

doi: 10.7554/eLife.27574

Figure Lengend Snippet: A) Data from proteomic datasets from the Lamond laboratory can be easily visualised for the same proteins using the navigation bubble map. User interface features include: B) specifying type of search, including search for individual proteins, GO term, and CORUM complex membership, (C) an input box for protein and other identifiers (e.g. GO term), (D) a ribbon graph showing plots for input protein identifiers (here for illustration are shown RRM2 and CCNB1) with lines indicating mean profile and ribbons indicating s.e.m., (E) an interactive legend to show more information on individual proteins, and F) options to output visualisation as an SVG file or underlying data in CSV format. ( G ) An example plot correlating protein abundance and phosphorylation changes. Several proteins containing ‘early rising’ phosphorylation sites are highlighted: CENPF, TMPO, and RIF1.

Article Snippet: DNA, Expression construct , RRM2-GFP , Origene , RG205718 , .

Techniques:

Journal: eLife

Article Title: Proteomic analysis of cell cycle progression in asynchronous cultures, including mitotic subphases, using PRIMMUS

doi: 10.7554/eLife.27574

Figure Lengend Snippet:

Article Snippet: DNA, Expression construct , RRM2-GFP , Origene , RG205718 , .

Techniques: Expressing, Construct

Effects of RRM2B Depletion in Hypoxia (A) Immunoprecipitation of RRM1 followed by immunoblotting for RRM2B and RRM2 in normoxia and <0.1% O 2 (18 hr). (B) dNTP levels in RKO cells treated with non-specific (siCTL) or siRRM2B and exposed to <0.1% O 2 (16 hr). (C) FACS analysis of U2OS cells treated with siCTL or siRRM2B and exposed to normoxia or <0.1% O 2 (3 hr). Cells were pulsed with bromodeoxyuridine (BrdU) (20 μM) 30 min before collection. (D) RPA32 foci in RKO RRM2B+/+ and RKO RRM2B−/− cells after exposure to <0.1% O 2 . (E) 53BP1 foci in RKO RRM2B+/+ and RKO RRM2B−/− cells exposed to normoxia or <0.1% O 2 (6 hr). (F) Representative images of 53BP1 foci in RRM2B-negative RKO cells treated with siRRM2B and exposed to normoxia or <0.1% O 2 (6 hr). Scale bar, 20 μm. (G) Colony survival assay in RKO cells treated with siCTL or siRRM2B and exposed to normoxia or <0.1% O 2 (24 hr). (H) Apoptosis detected morphologically in RKO cells treated with siCTL or siRRM2B and exposed to normoxia or <0.1% O 2 (19 hr). (I) RKO RRM2B+/+ and RKO RRM2B−/− cells were grown as xenografts in mice (n = 4 mice per each group). Where indicated, irradiation (10 Gy) was given when tumors reached ∼100 mm 3 . (J) Representative images of co-localization of cleaved caspase-3 (apoptosis) with PIMO (hypoxic areas) in RKO RRM2B+/+ or RKO RRM2B−/− xenografts. Scale bars, 50 μm. (K and L) Tumors were removed on day 28 post-implantation (from H), and the level of apoptosis was quantified in normoxic areas (PIMO negative) (K) and hypoxic areas (PIMO positive) (L). Images from three different tumors (n = 3) per group were counted. For all panels, n = 3 (biological replicates) unless otherwise stated. Data show mean ± SEM and two-tailed Student’s t test was applied, except in (D), where one-way ANOVA analysis was applied, and (I), where two-way ANOVA analysis was applied. (ns) indicates a non-significant change. See also and .

Journal: Molecular Cell

Article Title: Ribonucleotide Reductase Requires Subunit Switching in Hypoxia to Maintain DNA Replication

doi: 10.1016/j.molcel.2017.03.005

Figure Lengend Snippet: Effects of RRM2B Depletion in Hypoxia (A) Immunoprecipitation of RRM1 followed by immunoblotting for RRM2B and RRM2 in normoxia and <0.1% O 2 (18 hr). (B) dNTP levels in RKO cells treated with non-specific (siCTL) or siRRM2B and exposed to <0.1% O 2 (16 hr). (C) FACS analysis of U2OS cells treated with siCTL or siRRM2B and exposed to normoxia or <0.1% O 2 (3 hr). Cells were pulsed with bromodeoxyuridine (BrdU) (20 μM) 30 min before collection. (D) RPA32 foci in RKO RRM2B+/+ and RKO RRM2B−/− cells after exposure to <0.1% O 2 . (E) 53BP1 foci in RKO RRM2B+/+ and RKO RRM2B−/− cells exposed to normoxia or <0.1% O 2 (6 hr). (F) Representative images of 53BP1 foci in RRM2B-negative RKO cells treated with siRRM2B and exposed to normoxia or <0.1% O 2 (6 hr). Scale bar, 20 μm. (G) Colony survival assay in RKO cells treated with siCTL or siRRM2B and exposed to normoxia or <0.1% O 2 (24 hr). (H) Apoptosis detected morphologically in RKO cells treated with siCTL or siRRM2B and exposed to normoxia or <0.1% O 2 (19 hr). (I) RKO RRM2B+/+ and RKO RRM2B−/− cells were grown as xenografts in mice (n = 4 mice per each group). Where indicated, irradiation (10 Gy) was given when tumors reached ∼100 mm 3 . (J) Representative images of co-localization of cleaved caspase-3 (apoptosis) with PIMO (hypoxic areas) in RKO RRM2B+/+ or RKO RRM2B−/− xenografts. Scale bars, 50 μm. (K and L) Tumors were removed on day 28 post-implantation (from H), and the level of apoptosis was quantified in normoxic areas (PIMO negative) (K) and hypoxic areas (PIMO positive) (L). Images from three different tumors (n = 3) per group were counted. For all panels, n = 3 (biological replicates) unless otherwise stated. Data show mean ± SEM and two-tailed Student’s t test was applied, except in (D), where one-way ANOVA analysis was applied, and (I), where two-way ANOVA analysis was applied. (ns) indicates a non-significant change. See also and .

Article Snippet: Mouse monoclonal anti-RRM2 Clone 1E1 , Bio-Rad , Cat# MCA3434Z.

Techniques: Immunoprecipitation, Western Blot, Clonogenic Cell Survival Assay, Irradiation, Two Tailed Test

RRM2B Retains Activity in Hypoxia (A) Product formation (percentage of the maximum, where maximum is the dCDP levels at 30 min in normoxia) for R1/R2B enzyme in normoxia and <0.1% O 2 . (B) dCDP (μM) in <0.1% O 2 for R1/R2B for the times indicated. Activity of R1/R2B enzyme at 37°C at 5 min in <0.1% O 2 was 19.57 nmol/min/mg RRM2B protein. Gray columns indicate the amount of dCDP formed up to 15 min in <0.1% O 2 , and red columns indicate the amount of dCDP formed after 15 min in <0.1% O 2. (C) Product formation (percentage of the maximum, where maximum is the dCDP levels at 30 min in normoxia) for R1/R2 enzyme in normoxia and <0.1% O 2 . (D) dCDP (μM) in <0.1% O 2 for R1/R2 for the times indicated. Activity of R1/R2 enzyme at 37°C at 5 min in <0.1% O 2 was 97.74 nmol/min/mg RRM2 protein. Gray columns indicate the amount of dCDP formed up to 15 min in <0.1% O 2 , and red columns indicate the amount of dCDP formed after 15 min in <0.1% O 2. (E and F) Characterization of the oxygen tunnels (T1–T3) of RRM2B (E) and RRM2 (F). (G and H) EPR spectra of the tyrosyl radical of RRM2B (G) and RRM2 (H) in normoxia and <0.1% O 2 , respectively. (I) Quantification of (G) and (H). Data present electron spins per β subunit. For all panels, n = 3 (biological replicates); for (A) and (C), data represent mean ± SEM and two-way ANOVA was applied; for (B) and (D), data represent mean ± SEM and two-tailed Student’s t test was applied; (ns) indicates non significant change. See also <xref ref-type=Figure S5 . " width="100%" height="100%">

Journal: Molecular Cell

Article Title: Ribonucleotide Reductase Requires Subunit Switching in Hypoxia to Maintain DNA Replication

doi: 10.1016/j.molcel.2017.03.005

Figure Lengend Snippet: RRM2B Retains Activity in Hypoxia (A) Product formation (percentage of the maximum, where maximum is the dCDP levels at 30 min in normoxia) for R1/R2B enzyme in normoxia and <0.1% O 2 . (B) dCDP (μM) in <0.1% O 2 for R1/R2B for the times indicated. Activity of R1/R2B enzyme at 37°C at 5 min in <0.1% O 2 was 19.57 nmol/min/mg RRM2B protein. Gray columns indicate the amount of dCDP formed up to 15 min in <0.1% O 2 , and red columns indicate the amount of dCDP formed after 15 min in <0.1% O 2. (C) Product formation (percentage of the maximum, where maximum is the dCDP levels at 30 min in normoxia) for R1/R2 enzyme in normoxia and <0.1% O 2 . (D) dCDP (μM) in <0.1% O 2 for R1/R2 for the times indicated. Activity of R1/R2 enzyme at 37°C at 5 min in <0.1% O 2 was 97.74 nmol/min/mg RRM2 protein. Gray columns indicate the amount of dCDP formed up to 15 min in <0.1% O 2 , and red columns indicate the amount of dCDP formed after 15 min in <0.1% O 2. (E and F) Characterization of the oxygen tunnels (T1–T3) of RRM2B (E) and RRM2 (F). (G and H) EPR spectra of the tyrosyl radical of RRM2B (G) and RRM2 (H) in normoxia and <0.1% O 2 , respectively. (I) Quantification of (G) and (H). Data present electron spins per β subunit. For all panels, n = 3 (biological replicates); for (A) and (C), data represent mean ± SEM and two-way ANOVA was applied; for (B) and (D), data represent mean ± SEM and two-tailed Student’s t test was applied; (ns) indicates non significant change. See also Figure S5 .

Article Snippet: Mouse monoclonal anti-RRM2 Clone 1E1 , Bio-Rad , Cat# MCA3434Z.

Techniques: Activity Assay, Two Tailed Test

O 2 Residence Times around the Fe Metallocenter for RRM2B and  RRM2  Proteins

Journal: Molecular Cell

Article Title: Ribonucleotide Reductase Requires Subunit Switching in Hypoxia to Maintain DNA Replication

doi: 10.1016/j.molcel.2017.03.005

Figure Lengend Snippet: O 2 Residence Times around the Fe Metallocenter for RRM2B and RRM2 Proteins

Article Snippet: Mouse monoclonal anti-RRM2 Clone 1E1 , Bio-Rad , Cat# MCA3434Z.

Techniques:

Critical Roles of K37/K151 and Y164 in RRM2B (A and B) Product formation (percentage of the maximum, where maximum is the dCDP levels at 30 min in normoxia) for K37E/K151E (A) and Y164C (B) in normoxia and <0.1% O 2 . (C) EPR spectra of the tyrosyl radical of Y164C, K37E/K151E, and Q127K (as a negative control) in normoxia and <0.1% O 2 . (D) Quantification of (C). Data present electron spins per β subunit. (E) The RRM2B phenylalanine network around Y164 and phenylalanine conformation in Y164C mutation. Distance plot reveals the effect of Y164C in F95-F197 distance. Color code: WT (black), Y164C (red). (F and G) dATP (F) and dTTP (G) levels in RKO RRM2B−/− cells transfected with CTL, WT, Y164C, or K37E/K151E and exposed to <0.1% O 2 (16 hr). (H) Immunoblot for PARP cleavage in RKO RRM2B−/− cells treated as in (F) and (G) plus Q127K and exposed to <0.1% O 2 (19 hr). (I) Apoptosis detected morphologically in RKO RRM2B−/− cells treated as in (H). (J) Schematic representation of our proposed model. Hypoxia leads to severely compromised activity of RRM2, leading to replication stress. RRM2B is then induced through the DDR pathway to maintain ongoing replication. However, insufficient dNTPs are generated by R1/R2B, and replication stress is unresolved. The importance of RRM2B activity is that while it does not resolve replication stress, it does maintain replication fork integrity and prevents the accumulation of DNA damage and loss of genome stability. For (A), n = 3; for (B), n = 4 (biological replicates) and two-way ANOVA was applied; for (C), n = 2 (biological replicates); for (F)–(I), n = 3 (biological replicates); data represent means ± SEM and two-tailed Student’s t test was applied. See also and .

Journal: Molecular Cell

Article Title: Ribonucleotide Reductase Requires Subunit Switching in Hypoxia to Maintain DNA Replication

doi: 10.1016/j.molcel.2017.03.005

Figure Lengend Snippet: Critical Roles of K37/K151 and Y164 in RRM2B (A and B) Product formation (percentage of the maximum, where maximum is the dCDP levels at 30 min in normoxia) for K37E/K151E (A) and Y164C (B) in normoxia and <0.1% O 2 . (C) EPR spectra of the tyrosyl radical of Y164C, K37E/K151E, and Q127K (as a negative control) in normoxia and <0.1% O 2 . (D) Quantification of (C). Data present electron spins per β subunit. (E) The RRM2B phenylalanine network around Y164 and phenylalanine conformation in Y164C mutation. Distance plot reveals the effect of Y164C in F95-F197 distance. Color code: WT (black), Y164C (red). (F and G) dATP (F) and dTTP (G) levels in RKO RRM2B−/− cells transfected with CTL, WT, Y164C, or K37E/K151E and exposed to <0.1% O 2 (16 hr). (H) Immunoblot for PARP cleavage in RKO RRM2B−/− cells treated as in (F) and (G) plus Q127K and exposed to <0.1% O 2 (19 hr). (I) Apoptosis detected morphologically in RKO RRM2B−/− cells treated as in (H). (J) Schematic representation of our proposed model. Hypoxia leads to severely compromised activity of RRM2, leading to replication stress. RRM2B is then induced through the DDR pathway to maintain ongoing replication. However, insufficient dNTPs are generated by R1/R2B, and replication stress is unresolved. The importance of RRM2B activity is that while it does not resolve replication stress, it does maintain replication fork integrity and prevents the accumulation of DNA damage and loss of genome stability. For (A), n = 3; for (B), n = 4 (biological replicates) and two-way ANOVA was applied; for (C), n = 2 (biological replicates); for (F)–(I), n = 3 (biological replicates); data represent means ± SEM and two-tailed Student’s t test was applied. See also and .

Article Snippet: Mouse monoclonal anti-RRM2 Clone 1E1 , Bio-Rad , Cat# MCA3434Z.

Techniques: Negative Control, Mutagenesis, Transfection, Western Blot, Activity Assay, Generated, Two Tailed Test

Journal: Molecular Cell

Article Title: Ribonucleotide Reductase Requires Subunit Switching in Hypoxia to Maintain DNA Replication

doi: 10.1016/j.molcel.2017.03.005

Figure Lengend Snippet:

Article Snippet: Mouse monoclonal anti-RRM2 Clone 1E1 , Bio-Rad , Cat# MCA3434Z.

Techniques: Transduction, Recombinant, Protease Inhibitor, SYBR Green Assay, Mutagenesis, Purification, Gel Extraction, Imaging, Sequencing, Negative Control, Real-time Polymerase Chain Reaction, Software, Expressing

A. The expression of RRM2 was detected via western blotting in synovial specimens from patients with RA and normal controls. The relative expression of RRM2 was shown in histogram. **p<0.01, compared to normal controls. B. MH7A cells were treated with TNF-α (10 ng/mL) and IL-1β (10 mg/L) for 24 h, and the expression of RRM2 was determined via western blotting. The relative expression of RRM2 was shown in histogram. **p<0.01, compared with untreated group. ##p<0.01, compared with untreated group. C. MH7A cells were treated with RRM2 shRNA lentivirus and lentiviral controls for 24 h. The relative expression of RRM2 was determined via western blotting and shown in histogram. **p<0.01, compared with control lentivirus group. D. MTT assay. MH7A cells were infected with RRM2 shRNA lentivirus and lentiviral controls for 24, 48, and 72 h, and cell viability was determined via MTT assay. **p<0.01. E. Clone formation assay. MH7A cells were infected with RRM2 shRNA and control shRNA lentivirus and cultured for 2 weeks. Colony formation assay was performed as described in Materials and Methods. The colony number was shown in histogram. **p<0.01, compared with control shRNA group. F. Migration and invasion assays. MH7A cells were infected with RRM2 shRNA and control shRNA lentiviruses and treated with 10 ng/mL of TNF-α. The migratory and invasive abilities were detected using transwell Boyden chamber coated without or with a Matrigel basement membrane matrix after 48 h. Original magnification ×100.

Journal: PLOS ONE

Article Title: IGF2BP3 regulates the expression of RRM2 and promotes the progression of rheumatoid arthritis via RRM2/Akt/MMP-9 pathway

doi: 10.1371/journal.pone.0303593

Figure Lengend Snippet: A. The expression of RRM2 was detected via western blotting in synovial specimens from patients with RA and normal controls. The relative expression of RRM2 was shown in histogram. **p<0.01, compared to normal controls. B. MH7A cells were treated with TNF-α (10 ng/mL) and IL-1β (10 mg/L) for 24 h, and the expression of RRM2 was determined via western blotting. The relative expression of RRM2 was shown in histogram. **p<0.01, compared with untreated group. ##p<0.01, compared with untreated group. C. MH7A cells were treated with RRM2 shRNA lentivirus and lentiviral controls for 24 h. The relative expression of RRM2 was determined via western blotting and shown in histogram. **p<0.01, compared with control lentivirus group. D. MTT assay. MH7A cells were infected with RRM2 shRNA lentivirus and lentiviral controls for 24, 48, and 72 h, and cell viability was determined via MTT assay. **p<0.01. E. Clone formation assay. MH7A cells were infected with RRM2 shRNA and control shRNA lentivirus and cultured for 2 weeks. Colony formation assay was performed as described in Materials and Methods. The colony number was shown in histogram. **p<0.01, compared with control shRNA group. F. Migration and invasion assays. MH7A cells were infected with RRM2 shRNA and control shRNA lentiviruses and treated with 10 ng/mL of TNF-α. The migratory and invasive abilities were detected using transwell Boyden chamber coated without or with a Matrigel basement membrane matrix after 48 h. Original magnification ×100.

Article Snippet: RRM2 Lentiviral copy DNA Open Reading Frame Clone, Human, C-GFPSpark® tag (Cat: HG18284-ACGLN) and pLV-C-GFPSpark lentivirus control plasmid (Cat: LVCV-35) were purchased from SinoBiological corporation (Beijing, China).

Techniques: Expressing, Western Blot, shRNA, MTT Assay, Infection, Tube Formation Assay, Cell Culture, Colony Assay, Migration, Membrane

 IGF2BP3-RRM2  association.

Journal: PLOS ONE

Article Title: IGF2BP3 regulates the expression of RRM2 and promotes the progression of rheumatoid arthritis via RRM2/Akt/MMP-9 pathway

doi: 10.1371/journal.pone.0303593

Figure Lengend Snippet: IGF2BP3-RRM2 association.

Article Snippet: RRM2 Lentiviral copy DNA Open Reading Frame Clone, Human, C-GFPSpark® tag (Cat: HG18284-ACGLN) and pLV-C-GFPSpark lentivirus control plasmid (Cat: LVCV-35) were purchased from SinoBiological corporation (Beijing, China).

Techniques:

A. IGF2BP3 RIP assay. IGF2BP3 immunoprecipitation was performed and detected by Western blotting in TNF-α or IL-1β-treated MH7A cells. GAPDH and IgG was used as the negative control. B. RIP-qPCR assay demonstrated the enrichment of RRM2 mRNA in in anti-IGF2BP3 precipitates of TNF-α or IL-1β-treated MH7A cells(**p<0.01). C. MeRIP-qPCR assay. The m6A enrichment of RRM2 mRNA was shown by using anti-IgG and anti-m6A antibodies in TNF-α or IL-1β-treated MH7A cells after knocking down IGF2BP3. **P < 0.01.

Journal: PLOS ONE

Article Title: IGF2BP3 regulates the expression of RRM2 and promotes the progression of rheumatoid arthritis via RRM2/Akt/MMP-9 pathway

doi: 10.1371/journal.pone.0303593

Figure Lengend Snippet: A. IGF2BP3 RIP assay. IGF2BP3 immunoprecipitation was performed and detected by Western blotting in TNF-α or IL-1β-treated MH7A cells. GAPDH and IgG was used as the negative control. B. RIP-qPCR assay demonstrated the enrichment of RRM2 mRNA in in anti-IGF2BP3 precipitates of TNF-α or IL-1β-treated MH7A cells(**p<0.01). C. MeRIP-qPCR assay. The m6A enrichment of RRM2 mRNA was shown by using anti-IgG and anti-m6A antibodies in TNF-α or IL-1β-treated MH7A cells after knocking down IGF2BP3. **P < 0.01.

Article Snippet: RRM2 Lentiviral copy DNA Open Reading Frame Clone, Human, C-GFPSpark® tag (Cat: HG18284-ACGLN) and pLV-C-GFPSpark lentivirus control plasmid (Cat: LVCV-35) were purchased from SinoBiological corporation (Beijing, China).

Techniques: Immunoprecipitation, Western Blot, Negative Control

A. MH7A cells were treated with TNF-α (10 ng/mL) and IL-1β (10 mg/L) for 24 h, and the expression of RRM2 was determined via western blotting. B. The relative expression of IGF2BP3, RRM2, MMP-9 and MMP-1 was shown in histogram. **p<0.01, compared with control group. C. MH7A cells were infected with IGF2BP3 shRNA and control shRNA lentiviruses and treated with 10 ng/mL of TNF-α for 24 h. The expression of IGF2BP3, RRM2, MMP-9, and MMP-1 was detected via western blotting. D. The relative expression of IGF2BP3, RRM2, MMP-9 and MMP-1 was shown in histogram. **p<0.01, compared with control shRNA group.

Journal: PLOS ONE

Article Title: IGF2BP3 regulates the expression of RRM2 and promotes the progression of rheumatoid arthritis via RRM2/Akt/MMP-9 pathway

doi: 10.1371/journal.pone.0303593

Figure Lengend Snippet: A. MH7A cells were treated with TNF-α (10 ng/mL) and IL-1β (10 mg/L) for 24 h, and the expression of RRM2 was determined via western blotting. B. The relative expression of IGF2BP3, RRM2, MMP-9 and MMP-1 was shown in histogram. **p<0.01, compared with control group. C. MH7A cells were infected with IGF2BP3 shRNA and control shRNA lentiviruses and treated with 10 ng/mL of TNF-α for 24 h. The expression of IGF2BP3, RRM2, MMP-9, and MMP-1 was detected via western blotting. D. The relative expression of IGF2BP3, RRM2, MMP-9 and MMP-1 was shown in histogram. **p<0.01, compared with control shRNA group.

Article Snippet: RRM2 Lentiviral copy DNA Open Reading Frame Clone, Human, C-GFPSpark® tag (Cat: HG18284-ACGLN) and pLV-C-GFPSpark lentivirus control plasmid (Cat: LVCV-35) were purchased from SinoBiological corporation (Beijing, China).

Techniques: Expressing, Western Blot, Infection, shRNA

A. MTT assay. MH7A cells were infected with IGF2BP3 shRNA lentivirus and control shRNA lentivirus was treated with TNF-α (10 ng/mL) for 24, 48, and 72 h. The cell viability was determined using MTT assay. **p<0.01, compared with control shRNA group. B. Clone formation assay. MH7A cells were infected with IGF2BP3 shRNA and control shRNA lentivirus and cultured for 2 weeks. The colony number was shown in histogram. **p<0.01, compared with control shRNA group. C. Migration and invasion assays. The effects of IGF2BP3 knockdown on invasion and migration were detected using transwell Boyden chamber coated with or without a Matrigel basement membrane matrix after 48 h. Original magnification ×100. D. MTT assay. MH7A cells were treated with IGF2BP3 shRNA lentivirus and overexpressed control lentivirus, control shRNA lentivirus and overexpressed RRM2 lentivirus, IGF2BP3 shRNA lentivirus and overexpressed control lentivirus, and IGF2BP3 shRNA lentivirus and overexpressed RRM2 lentivirus for 24, 48, and 72 h. Cell viability was determined using MTT assay. **p<0.01, compared with control group.

Journal: PLOS ONE

Article Title: IGF2BP3 regulates the expression of RRM2 and promotes the progression of rheumatoid arthritis via RRM2/Akt/MMP-9 pathway

doi: 10.1371/journal.pone.0303593

Figure Lengend Snippet: A. MTT assay. MH7A cells were infected with IGF2BP3 shRNA lentivirus and control shRNA lentivirus was treated with TNF-α (10 ng/mL) for 24, 48, and 72 h. The cell viability was determined using MTT assay. **p<0.01, compared with control shRNA group. B. Clone formation assay. MH7A cells were infected with IGF2BP3 shRNA and control shRNA lentivirus and cultured for 2 weeks. The colony number was shown in histogram. **p<0.01, compared with control shRNA group. C. Migration and invasion assays. The effects of IGF2BP3 knockdown on invasion and migration were detected using transwell Boyden chamber coated with or without a Matrigel basement membrane matrix after 48 h. Original magnification ×100. D. MTT assay. MH7A cells were treated with IGF2BP3 shRNA lentivirus and overexpressed control lentivirus, control shRNA lentivirus and overexpressed RRM2 lentivirus, IGF2BP3 shRNA lentivirus and overexpressed control lentivirus, and IGF2BP3 shRNA lentivirus and overexpressed RRM2 lentivirus for 24, 48, and 72 h. Cell viability was determined using MTT assay. **p<0.01, compared with control group.

Article Snippet: RRM2 Lentiviral copy DNA Open Reading Frame Clone, Human, C-GFPSpark® tag (Cat: HG18284-ACGLN) and pLV-C-GFPSpark lentivirus control plasmid (Cat: LVCV-35) were purchased from SinoBiological corporation (Beijing, China).

Techniques: MTT Assay, Infection, shRNA, Tube Formation Assay, Cell Culture, Migration, Membrane

A. MH7A cells were infected with RRM2 shRNA or control shRNA lentiviruses for 48 h. The expression of RRM2, phosphorylated Akt, total Akt, and MMP-9 was detected via western blotting. The relative expression of RRM2, p-Akt, Akt and MMP-9 was shown in histogram. **p<0.01, compared with control shRNA group. B. The MH7A cells infected with RRM2 shRNA or control shRNA lentiviruses were treated with Akt inhibitor for 24 h. The expression of pAkt-S473, total Akt, and MMP-9 was detected via western blotting. The relative expression of RRM2, p-Akt, Akt, MMP-1 and MMP-9 was shown in histogram. **p<0.01, ##p<0.01, compared with control group.

Journal: PLOS ONE

Article Title: IGF2BP3 regulates the expression of RRM2 and promotes the progression of rheumatoid arthritis via RRM2/Akt/MMP-9 pathway

doi: 10.1371/journal.pone.0303593

Figure Lengend Snippet: A. MH7A cells were infected with RRM2 shRNA or control shRNA lentiviruses for 48 h. The expression of RRM2, phosphorylated Akt, total Akt, and MMP-9 was detected via western blotting. The relative expression of RRM2, p-Akt, Akt and MMP-9 was shown in histogram. **p<0.01, compared with control shRNA group. B. The MH7A cells infected with RRM2 shRNA or control shRNA lentiviruses were treated with Akt inhibitor for 24 h. The expression of pAkt-S473, total Akt, and MMP-9 was detected via western blotting. The relative expression of RRM2, p-Akt, Akt, MMP-1 and MMP-9 was shown in histogram. **p<0.01, ##p<0.01, compared with control group.

Article Snippet: RRM2 Lentiviral copy DNA Open Reading Frame Clone, Human, C-GFPSpark® tag (Cat: HG18284-ACGLN) and pLV-C-GFPSpark lentivirus control plasmid (Cat: LVCV-35) were purchased from SinoBiological corporation (Beijing, China).

Techniques: Infection, shRNA, Expressing, Western Blot

MTT viability assay for different dosages of the drug combination cisplatin and gemcitabine after 24 h of incubation for NCI-H295R ( A ) and MUC-1 ( B ) cell lines. Pictures from NCI-H295R ( C ) and MUC-1 ( D ) clonogenic assays for different concentrations of gemcitabine (left) and cisplatin (right) treatment after 24 h incubation. Real-time PCR analysis of RRM1 for NCI-H295R ( E ) and MUC-1 ( F ), as well as RRM2 ( G , H ) and RRM2B ( I , K ). dATP levels for NCI-H295R ( J ) and MUC-1 ( L ) upon different treatments. Quantification of RRM2 protein levels for NCI-H295R ( M ) and MUC-1 ( O ) and RRM2 immunofluorescence (40x) for NCI-H295R ( N ) and MUC-1 ( P ). A representative Western blot used for RRM2 protein expression quantification in NCI-H295R ( Q ) and MUC-1 ( R ) cells. Stars represent significance vs. nontreated for both treatments (*, p < 0.05; **, p < 0.01; ***, p < 0.001).

Journal: Cancers

Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment

doi: 10.3390/cancers13164200

Figure Lengend Snippet: MTT viability assay for different dosages of the drug combination cisplatin and gemcitabine after 24 h of incubation for NCI-H295R ( A ) and MUC-1 ( B ) cell lines. Pictures from NCI-H295R ( C ) and MUC-1 ( D ) clonogenic assays for different concentrations of gemcitabine (left) and cisplatin (right) treatment after 24 h incubation. Real-time PCR analysis of RRM1 for NCI-H295R ( E ) and MUC-1 ( F ), as well as RRM2 ( G , H ) and RRM2B ( I , K ). dATP levels for NCI-H295R ( J ) and MUC-1 ( L ) upon different treatments. Quantification of RRM2 protein levels for NCI-H295R ( M ) and MUC-1 ( O ) and RRM2 immunofluorescence (40x) for NCI-H295R ( N ) and MUC-1 ( P ). A representative Western blot used for RRM2 protein expression quantification in NCI-H295R ( Q ) and MUC-1 ( R ) cells. Stars represent significance vs. nontreated for both treatments (*, p < 0.05; **, p < 0.01; ***, p < 0.001).

Article Snippet: The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).

Techniques: MTT Viability Assay, Incubation, Real-time Polymerase Chain Reaction, Immunofluorescence, Western Blot, Expressing

Relative RRM1 and RRM2 gene expression in normal adrenal (NA), adrenocortical adenoma (ACA), and adrenocortical carcinoma (ACC) samples of an available series form the literature ( A , B ) and of our cohort ( C , D ). Kaplan–Meier survival curves for patients with ACC from our cohort according to low or high expression levels of RRM1 ( E ) or RRM2 ( F ). Correlation between the tumor size and the RRM2 expression levels ( G ).

Journal: Cancers

Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment

doi: 10.3390/cancers13164200

Figure Lengend Snippet: Relative RRM1 and RRM2 gene expression in normal adrenal (NA), adrenocortical adenoma (ACA), and adrenocortical carcinoma (ACC) samples of an available series form the literature ( A , B ) and of our cohort ( C , D ). Kaplan–Meier survival curves for patients with ACC from our cohort according to low or high expression levels of RRM1 ( E ) or RRM2 ( F ). Correlation between the tumor size and the RRM2 expression levels ( G ).

Article Snippet: The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).

Techniques: Expressing

Real-time PCR analysis of RRM2 ( A , D ) gene expression and number of surviving cells ( B , E ) under RRM2 siRNA knockdown for NCI-H295R and MUC-1, respectively. RRM2 gene expression upon etoposide and doxorubicin treatment for NCI-H295R and MUC-1 ( C , F ). Quantification of Western blots for p-Chk1 ( G ), p-Chk2 ( H ), and p-H2AX ( I ) for no treatment, gemcitabine, cisplatin, and combination of both (gemcitabine and cisplatin) 24 h after treatment. Schematic illustration of the related DNA damage–repair pathway, including relevant therapeutic inhibitors ( J ). Stars represent significance vs. nontreated (*, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001); ns, non-significant.

Journal: Cancers

Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment

doi: 10.3390/cancers13164200

Figure Lengend Snippet: Real-time PCR analysis of RRM2 ( A , D ) gene expression and number of surviving cells ( B , E ) under RRM2 siRNA knockdown for NCI-H295R and MUC-1, respectively. RRM2 gene expression upon etoposide and doxorubicin treatment for NCI-H295R and MUC-1 ( C , F ). Quantification of Western blots for p-Chk1 ( G ), p-Chk2 ( H ), and p-H2AX ( I ) for no treatment, gemcitabine, cisplatin, and combination of both (gemcitabine and cisplatin) 24 h after treatment. Schematic illustration of the related DNA damage–repair pathway, including relevant therapeutic inhibitors ( J ). Stars represent significance vs. nontreated (*, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001); ns, non-significant.

Article Snippet: The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).

Techniques: Real-time Polymerase Chain Reaction, Expressing, Western Blot

siRNA multiplex screen and follow-up deconvolution analysis. A, results from the CPT chemosensitization RNAi screen conducted in MDA-MB-231 breast cancer cells. The y axis represents the normalized activity of each siRNA multiplex in the presence of CPT (EC50) minus the normalized activity of each siRNA multiplex in the absence of CPT. Plate median values were used for normalization. B, deconvolution of the top seven sensitizing multiplexes (designate A–G), with values greater than 2 S.D. from the median, identified RRM1 and RRM2 as gene targets whose silencing significantly enhanced the cytotoxicity of CPT. Targets known to be associated with cellular response to CPT-induced DNA damage were also identified (BRCA1 and ATR) (33).

Journal: The Journal of Biological Chemistry

Article Title: Implication of Checkpoint Kinase-dependent Up-regulation of Ribonucleotide Reductase R2 in DNA Damage Response *

doi: 10.1074/jbc.M109.003020

Figure Lengend Snippet: siRNA multiplex screen and follow-up deconvolution analysis. A, results from the CPT chemosensitization RNAi screen conducted in MDA-MB-231 breast cancer cells. The y axis represents the normalized activity of each siRNA multiplex in the presence of CPT (EC50) minus the normalized activity of each siRNA multiplex in the absence of CPT. Plate median values were used for normalization. B, deconvolution of the top seven sensitizing multiplexes (designate A–G), with values greater than 2 S.D. from the median, identified RRM1 and RRM2 as gene targets whose silencing significantly enhanced the cytotoxicity of CPT. Targets known to be associated with cellular response to CPT-induced DNA damage were also identified (BRCA1 and ATR) (33).

Article Snippet: In this study probes corresponding to RRM1 , RRM2 , or CTNNB1 (control) and human cyclophilin ( PPIB ) (for normalization) (Panomics) were used.

Techniques: Multiplex Assay, Activity Assay