human pyk2 Search Results


93
Bio-Techne corporation human pyk2/fak2 antibody
Human Pyk2/Fak2 Antibody, supplied by Bio-Techne corporation, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+pyk2/Human+PYK2%2FFAK2+Antibody/bio-techne+corporation___af4589
Average 93 stars, based on 1 article reviews
human pyk2/fak2 antibody - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

91
R&D Systems py402 pyk2 mab6210 r d systems western blot
Py402 Pyk2 Mab6210 R D Systems Western Blot, supplied by R&D Systems, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+pyk2/Human+Phospho-PYK2%2FFAK2+(Y402)+Antibody/pmc06527705__41598_2019_44098_MOESM1_ESM-106-152-155
Average 91 stars, based on 1 article reviews
py402 pyk2 mab6210 r d systems western blot - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

90
OriGene human pyk2
Fig.1. Detection of <t>PYK2</t> in the oocyte plasma membrane; effect of fertilization. Plasma membrane fractions prepared at 7.5 min post-fertilization were analyzed by western blot and probed with an antibody to the mammalian PYK2 protein, anti-PY402, anti-PY579, or with control rabbit IgG as described in ‘Materials and Methods’ (panel A). To detect changes in PYK2 phosphorylation after fertilization, plasma membrane samples prepared before (UF) and at 1, 2.5, and 10 min post-insemination (m.p.i.), were probed with the anti-PYK2 protein antibody and with the anti-PY579 antibody (panel B) to establish whether the amount or activation state of PYK2 associated with the plasma membrane changed in response to fertilization. Band intensity (‘Materials and Methods’) of the PYK2 PY579 labeled material in panel B was normalized to the PYK2 labeled bands in samples from five membrane preparations and is presented as a bar graph in panel C þ/ S.E.M.
Human Pyk2, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+pyk2/PYK2+(PTK2B)+(NM_004103)+Human+Untagged+Clone/pm23084926-79-10-26
Average 90 stars, based on 1 article reviews
human pyk2 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
OriGene human pyk2 transcript variant 1 cdna
Fig. 1. <t>PYK2</t> recruitment at the site of sperm-oocyte contact. Zona-free oocytes were incubated with a limiting concentration of sperm and samples were fixed at 30 (A, A′), 45 (B, C), and 60 (D) m.p.i., then processed for confocal immunofluorescence. The distribution of anti-PYK2 protein (green) is shown in the top panels, while f-actin detected by alexa 568- phalloidin (red) is shown in the middle row. Sperm chromatin was detected with DRAQ5 (blue) and the combined images containing all three channels are displayed in the bottom row. Specificity of the anit-PYK2 antibody is seen in column (E) where a pyk2 -/- oocyte collected at 45 m.p.i. was labeled under identical conditions. Magnification is indicated by the bar, which represents 5 µm.
Human Pyk2 Transcript Variant 1 Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+pyk2/PYK2+(PTK2B)+(NM_173174)+Human+Tagged+ORF+Clone/pm28527703-57-16-22
Average 90 stars, based on 1 article reviews
human pyk2 transcript variant 1 cdna - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
OriGene pcmv6 entry pyk2 plasmid
Fig. 1. <t>PYK2</t> recruitment at the site of sperm-oocyte contact. Zona-free oocytes were incubated with a limiting concentration of sperm and samples were fixed at 30 (A, A′), 45 (B, C), and 60 (D) m.p.i., then processed for confocal immunofluorescence. The distribution of anti-PYK2 protein (green) is shown in the top panels, while f-actin detected by alexa 568- phalloidin (red) is shown in the middle row. Sperm chromatin was detected with DRAQ5 (blue) and the combined images containing all three channels are displayed in the bottom row. Specificity of the anit-PYK2 antibody is seen in column (E) where a pyk2 -/- oocyte collected at 45 m.p.i. was labeled under identical conditions. Magnification is indicated by the bar, which represents 5 µm.
Pcmv6 Entry Pyk2 Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+pyk2/PYK2+(PTK2B)+(NM_004103)+Human+Tagged+ORF+Clone/pm31994829-321-3-6
Average 90 stars, based on 1 article reviews
pcmv6 entry pyk2 plasmid - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

92
R&D Systems phosphorpyk2
Fig. 1. <t>PYK2</t> recruitment at the site of sperm-oocyte contact. Zona-free oocytes were incubated with a limiting concentration of sperm and samples were fixed at 30 (A, A′), 45 (B, C), and 60 (D) m.p.i., then processed for confocal immunofluorescence. The distribution of anti-PYK2 protein (green) is shown in the top panels, while f-actin detected by alexa 568- phalloidin (red) is shown in the middle row. Sperm chromatin was detected with DRAQ5 (blue) and the combined images containing all three channels are displayed in the bottom row. Specificity of the anit-PYK2 antibody is seen in column (E) where a pyk2 -/- oocyte collected at 45 m.p.i. was labeled under identical conditions. Magnification is indicated by the bar, which represents 5 µm.
Phosphorpyk2, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+pyk2/Human+Phospho-PYK2%2FFAK2+(Y402)+Antibody/pm37055381-42-17-59
Average 92 stars, based on 1 article reviews
phosphorpyk2 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

90
R&D Systems human pyk2
Fig. 1. <t>PYK2</t> recruitment at the site of sperm-oocyte contact. Zona-free oocytes were incubated with a limiting concentration of sperm and samples were fixed at 30 (A, A′), 45 (B, C), and 60 (D) m.p.i., then processed for confocal immunofluorescence. The distribution of anti-PYK2 protein (green) is shown in the top panels, while f-actin detected by alexa 568- phalloidin (red) is shown in the middle row. Sperm chromatin was detected with DRAQ5 (blue) and the combined images containing all three channels are displayed in the bottom row. Specificity of the anit-PYK2 antibody is seen in column (E) where a pyk2 -/- oocyte collected at 45 m.p.i. was labeled under identical conditions. Magnification is indicated by the bar, which represents 5 µm.
Human Pyk2, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+pyk2/Recombinant+Human+Active+PYK2%2FFAK2+Protein%2C+CF/pmc05621916-391-4-10
Average 90 stars, based on 1 article reviews
human pyk2 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
OriGene pyk2
Fig. 1. <t>PYK2</t> recruitment at the site of sperm-oocyte contact. Zona-free oocytes were incubated with a limiting concentration of sperm and samples were fixed at 30 (A, A′), 45 (B, C), and 60 (D) m.p.i., then processed for confocal immunofluorescence. The distribution of anti-PYK2 protein (green) is shown in the top panels, while f-actin detected by alexa 568- phalloidin (red) is shown in the middle row. Sperm chromatin was detected with DRAQ5 (blue) and the combined images containing all three channels are displayed in the bottom row. Specificity of the anit-PYK2 antibody is seen in column (E) where a pyk2 -/- oocyte collected at 45 m.p.i. was labeled under identical conditions. Magnification is indicated by the bar, which represents 5 µm.
Pyk2, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+pyk2/PYK2+(PTK2B)+Human+qPCR+Template+Standard/10__1523_slash_jneurosci__1192___16__2016-107-21-26
Average 93 stars, based on 1 article reviews
pyk2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
OriGene pyk2 (ptk2b) human shrna plasmid kit
Fig. 1. <t>PYK2</t> recruitment at the site of sperm-oocyte contact. Zona-free oocytes were incubated with a limiting concentration of sperm and samples were fixed at 30 (A, A′), 45 (B, C), and 60 (D) m.p.i., then processed for confocal immunofluorescence. The distribution of anti-PYK2 protein (green) is shown in the top panels, while f-actin detected by alexa 568- phalloidin (red) is shown in the middle row. Sperm chromatin was detected with DRAQ5 (blue) and the combined images containing all three channels are displayed in the bottom row. Specificity of the anit-PYK2 antibody is seen in column (E) where a pyk2 -/- oocyte collected at 45 m.p.i. was labeled under identical conditions. Magnification is indicated by the bar, which represents 5 µm.
Pyk2 (Ptk2b) Human Shrna Plasmid Kit, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+pyk2/PYK2+(PTK2B)+Human+shRNA+Plasmid+Kit/origene___tg320352
Average 90 stars, based on 1 article reviews
pyk2 (ptk2b) human shrna plasmid kit - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

99
Bio-Techne corporation human/mouse/rat catalase antibody
Fig. 1. <t>PYK2</t> recruitment at the site of sperm-oocyte contact. Zona-free oocytes were incubated with a limiting concentration of sperm and samples were fixed at 30 (A, A′), 45 (B, C), and 60 (D) m.p.i., then processed for confocal immunofluorescence. The distribution of anti-PYK2 protein (green) is shown in the top panels, while f-actin detected by alexa 568- phalloidin (red) is shown in the middle row. Sperm chromatin was detected with DRAQ5 (blue) and the combined images containing all three channels are displayed in the bottom row. Specificity of the anit-PYK2 antibody is seen in column (E) where a pyk2 -/- oocyte collected at 45 m.p.i. was labeled under identical conditions. Magnification is indicated by the bar, which represents 5 µm.
Human/Mouse/Rat Catalase Antibody, supplied by Bio-Techne corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+pyk2/Human%2FMouse%2FRat+Catalase+Antibody/custom%40af3398%4033535532
Average 99 stars, based on 1 article reviews
human/mouse/rat catalase antibody - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

N/A
Lenti ORF particles PTK2B Myc DDK tagged Human PTK2B protein tyrosine kinase 2 beta PTK2B transcript variant 1 200ul 10 7 TU mL
  Buy from Supplier

Image Search Results


Fig.1. Detection of PYK2 in the oocyte plasma membrane; effect of fertilization. Plasma membrane fractions prepared at 7.5 min post-fertilization were analyzed by western blot and probed with an antibody to the mammalian PYK2 protein, anti-PY402, anti-PY579, or with control rabbit IgG as described in ‘Materials and Methods’ (panel A). To detect changes in PYK2 phosphorylation after fertilization, plasma membrane samples prepared before (UF) and at 1, 2.5, and 10 min post-insemination (m.p.i.), were probed with the anti-PYK2 protein antibody and with the anti-PY579 antibody (panel B) to establish whether the amount or activation state of PYK2 associated with the plasma membrane changed in response to fertilization. Band intensity (‘Materials and Methods’) of the PYK2 PY579 labeled material in panel B was normalized to the PYK2 labeled bands in samples from five membrane preparations and is presented as a bar graph in panel C þ/ S.E.M.

Journal: Developmental biology

Article Title: PYK2: a calcium-sensitive protein tyrosine kinase activated in response to fertilization of the zebrafish oocyte.

doi: 10.1016/j.ydbio.2012.10.015

Figure Lengend Snippet: Fig.1. Detection of PYK2 in the oocyte plasma membrane; effect of fertilization. Plasma membrane fractions prepared at 7.5 min post-fertilization were analyzed by western blot and probed with an antibody to the mammalian PYK2 protein, anti-PY402, anti-PY579, or with control rabbit IgG as described in ‘Materials and Methods’ (panel A). To detect changes in PYK2 phosphorylation after fertilization, plasma membrane samples prepared before (UF) and at 1, 2.5, and 10 min post-insemination (m.p.i.), were probed with the anti-PYK2 protein antibody and with the anti-PY579 antibody (panel B) to establish whether the amount or activation state of PYK2 associated with the plasma membrane changed in response to fertilization. Band intensity (‘Materials and Methods’) of the PYK2 PY579 labeled material in panel B was normalized to the PYK2 labeled bands in samples from five membrane preparations and is presented as a bar graph in panel C þ/ S.E.M.

Article Snippet: A GST fusion protein encoding the N-terminal ERM domain of human PYK2 (PERM domain) was prepared by PCR amplification from a kinase inactive human PYK2 plasmid (Origene catalog #SC323519).

Techniques: Clinical Proteomics, Membrane, Western Blot, Control, Phospho-proteomics, Activation Assay, Labeling

Fig. 2. Localization of activated PYK2 in the fertilized oocyte. Oocytes were fixed before and 2.5, 4.5, and 10 m.p.i., then processed for immunofluorescence, labeled with anti-PYK2-PY579 (upper panels) which would detect the activated form of PYK2 or with anti-PYK2 peptide (lower panels) which would detect the total pool of PYK2 protein. Bound antibody was detected with alexa 488-coupled secondary antibody (green) as described in ‘‘Materials and Methods’’. Since the chorion formed a barrier to antibody diffusion, it was punctured multiple times with a micropipette after fixation or removed by dissection in samples fixed after it was fully elevated (10 m.p.i. and later). Magnification is indicated by the bar which represents 100 mm.

Journal: Developmental biology

Article Title: PYK2: a calcium-sensitive protein tyrosine kinase activated in response to fertilization of the zebrafish oocyte.

doi: 10.1016/j.ydbio.2012.10.015

Figure Lengend Snippet: Fig. 2. Localization of activated PYK2 in the fertilized oocyte. Oocytes were fixed before and 2.5, 4.5, and 10 m.p.i., then processed for immunofluorescence, labeled with anti-PYK2-PY579 (upper panels) which would detect the activated form of PYK2 or with anti-PYK2 peptide (lower panels) which would detect the total pool of PYK2 protein. Bound antibody was detected with alexa 488-coupled secondary antibody (green) as described in ‘‘Materials and Methods’’. Since the chorion formed a barrier to antibody diffusion, it was punctured multiple times with a micropipette after fixation or removed by dissection in samples fixed after it was fully elevated (10 m.p.i. and later). Magnification is indicated by the bar which represents 100 mm.

Article Snippet: A GST fusion protein encoding the N-terminal ERM domain of human PYK2 (PERM domain) was prepared by PCR amplification from a kinase inactive human PYK2 plasmid (Origene catalog #SC323519).

Techniques: Labeling, Diffusion-based Assay, Dissection

Fig. 3. PYK2 activation co-localized with actin cytoskeletal reorganization. Oocytes were fixed at 1.0 (panels A–C) and 2.5 m.p.i.(panels D–F), then labeled with alexa 565—phalloidin (red) and anti-PYK2-PY579 followed by alexa 488-goat anti-rabbit IgG (green). Confocal images are displayed showing actin in the red channel (A and D), phosphorylated PYK2 in the green channel (B and E), or the merged red and green channels (C and F). Magnification is indicated by the bar which represents 100 mm. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Journal: Developmental biology

Article Title: PYK2: a calcium-sensitive protein tyrosine kinase activated in response to fertilization of the zebrafish oocyte.

doi: 10.1016/j.ydbio.2012.10.015

Figure Lengend Snippet: Fig. 3. PYK2 activation co-localized with actin cytoskeletal reorganization. Oocytes were fixed at 1.0 (panels A–C) and 2.5 m.p.i.(panels D–F), then labeled with alexa 565—phalloidin (red) and anti-PYK2-PY579 followed by alexa 488-goat anti-rabbit IgG (green). Confocal images are displayed showing actin in the red channel (A and D), phosphorylated PYK2 in the green channel (B and E), or the merged red and green channels (C and F). Magnification is indicated by the bar which represents 100 mm. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Article Snippet: A GST fusion protein encoding the N-terminal ERM domain of human PYK2 (PERM domain) was prepared by PCR amplification from a kinase inactive human PYK2 plasmid (Origene catalog #SC323519).

Techniques: Activation Assay, Labeling

Fig. 4. PYK2 activation during cleavage and epiboly. Developing embryos were collected at 55, 120, and 240 m.p.i., then processed for confocal immunofluorescence with anti-PYK2 PY579 as in Fig. 2. Magnification is indicated by the bar which represents 100 mm.

Journal: Developmental biology

Article Title: PYK2: a calcium-sensitive protein tyrosine kinase activated in response to fertilization of the zebrafish oocyte.

doi: 10.1016/j.ydbio.2012.10.015

Figure Lengend Snippet: Fig. 4. PYK2 activation during cleavage and epiboly. Developing embryos were collected at 55, 120, and 240 m.p.i., then processed for confocal immunofluorescence with anti-PYK2 PY579 as in Fig. 2. Magnification is indicated by the bar which represents 100 mm.

Article Snippet: A GST fusion protein encoding the N-terminal ERM domain of human PYK2 (PERM domain) was prepared by PCR amplification from a kinase inactive human PYK2 plasmid (Origene catalog #SC323519).

Techniques: Activation Assay

Fig. 5. Effect of changes in intracellular calcium on PYK2 activation state in the zebrafish oocyte. In order to establish whether oocyte PYK2 could be activated by artificially increasing intracellular calcium levels Oocytes were injected with injection buffer only as a control (A) or with injection buffer containing 25 mM IP3 (B) to artificially drive an increase in intracellular free calcium levels. The control and IP3-injected oocytes were maintained in Hanks-BSA for 4.5 min then fixed. In order to establish whether prevention of the fertilization-induced calcium transient would block PYK2 activation in response to fertilization, oocytes were injected with calcium clamping buffer (C) then fertilized by a mixture of sperm and aquarium water, followed by fixation at 4.5 m.p.i. Oocytes were then prepared for immunofluorescence detection of activated PYK2 with anti-PYK2-PY579

Journal: Developmental biology

Article Title: PYK2: a calcium-sensitive protein tyrosine kinase activated in response to fertilization of the zebrafish oocyte.

doi: 10.1016/j.ydbio.2012.10.015

Figure Lengend Snippet: Fig. 5. Effect of changes in intracellular calcium on PYK2 activation state in the zebrafish oocyte. In order to establish whether oocyte PYK2 could be activated by artificially increasing intracellular calcium levels Oocytes were injected with injection buffer only as a control (A) or with injection buffer containing 25 mM IP3 (B) to artificially drive an increase in intracellular free calcium levels. The control and IP3-injected oocytes were maintained in Hanks-BSA for 4.5 min then fixed. In order to establish whether prevention of the fertilization-induced calcium transient would block PYK2 activation in response to fertilization, oocytes were injected with calcium clamping buffer (C) then fertilized by a mixture of sperm and aquarium water, followed by fixation at 4.5 m.p.i. Oocytes were then prepared for immunofluorescence detection of activated PYK2 with anti-PYK2-PY579

Article Snippet: A GST fusion protein encoding the N-terminal ERM domain of human PYK2 (PERM domain) was prepared by PCR amplification from a kinase inactive human PYK2 plasmid (Origene catalog #SC323519).

Techniques: Activation Assay, Injection, Control, Blocking Assay

Fig. 6. Effect of PYK2 inhibitors on fertilization. Oocytes were treated with AG17, PF04594755, AG82 (control) or DMSO (solvent control) for 45 min, then washed with Hank’s- BSA. Other groups were injected with different concentrations of GST-PERM or GST fusion proteins. The samples were fertilized, then fixed and stained with DAPI at 15 m.p.i. to assess sperm incorporation by the presence of male and female pronuclei, and at 90 m.p.i. to assess cleavage by the presence of a cleavage furrow and two somatic nuclei. An example of zygotes derived from control (DMSO) treated oocytes demonstrating the presence of two pronuclei (A, arrows) and a polar body (pb) demonstrates the criteria for sperm penetration. Panel B demonstrates the presence of a cleavage furrow and two somatic nuclei shown (B, arrows) during telophase of the second mitotic division indicating that fertilization was successful. The % of oocytes that successfully incorporated sperm (C and D, left) or cleaved to the 2-cell stage (C and D, right) are presented as the mean of 4 three experiments þ/ S.E.M. Values represent the mean of three or more experiments þ/ S.E.M. (*)¼significantly different from control (Po0.05).

Journal: Developmental biology

Article Title: PYK2: a calcium-sensitive protein tyrosine kinase activated in response to fertilization of the zebrafish oocyte.

doi: 10.1016/j.ydbio.2012.10.015

Figure Lengend Snippet: Fig. 6. Effect of PYK2 inhibitors on fertilization. Oocytes were treated with AG17, PF04594755, AG82 (control) or DMSO (solvent control) for 45 min, then washed with Hank’s- BSA. Other groups were injected with different concentrations of GST-PERM or GST fusion proteins. The samples were fertilized, then fixed and stained with DAPI at 15 m.p.i. to assess sperm incorporation by the presence of male and female pronuclei, and at 90 m.p.i. to assess cleavage by the presence of a cleavage furrow and two somatic nuclei. An example of zygotes derived from control (DMSO) treated oocytes demonstrating the presence of two pronuclei (A, arrows) and a polar body (pb) demonstrates the criteria for sperm penetration. Panel B demonstrates the presence of a cleavage furrow and two somatic nuclei shown (B, arrows) during telophase of the second mitotic division indicating that fertilization was successful. The % of oocytes that successfully incorporated sperm (C and D, left) or cleaved to the 2-cell stage (C and D, right) are presented as the mean of 4 three experiments þ/ S.E.M. Values represent the mean of three or more experiments þ/ S.E.M. (*)¼significantly different from control (Po0.05).

Article Snippet: A GST fusion protein encoding the N-terminal ERM domain of human PYK2 (PERM domain) was prepared by PCR amplification from a kinase inactive human PYK2 plasmid (Origene catalog #SC323519).

Techniques: Control, Solvent, Injection, Staining, Derivative Assay

Fig. 7. Effect of PYK2 inhibitors on actin reorganization post-fertilization. Oocytes injected with GST-PERM (2.5 mM final) were fertilized and fixed at 2.5 and 4 m.p.i. The distribution of actin was detected with alexa-565-phalloidin (red). Arrows indicate the position of the defective fertilization cone. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Journal: Developmental biology

Article Title: PYK2: a calcium-sensitive protein tyrosine kinase activated in response to fertilization of the zebrafish oocyte.

doi: 10.1016/j.ydbio.2012.10.015

Figure Lengend Snippet: Fig. 7. Effect of PYK2 inhibitors on actin reorganization post-fertilization. Oocytes injected with GST-PERM (2.5 mM final) were fertilized and fixed at 2.5 and 4 m.p.i. The distribution of actin was detected with alexa-565-phalloidin (red). Arrows indicate the position of the defective fertilization cone. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Article Snippet: A GST fusion protein encoding the N-terminal ERM domain of human PYK2 (PERM domain) was prepared by PCR amplification from a kinase inactive human PYK2 plasmid (Origene catalog #SC323519).

Techniques: Injection

Fig. 1. PYK2 recruitment at the site of sperm-oocyte contact. Zona-free oocytes were incubated with a limiting concentration of sperm and samples were fixed at 30 (A, A′), 45 (B, C), and 60 (D) m.p.i., then processed for confocal immunofluorescence. The distribution of anti-PYK2 protein (green) is shown in the top panels, while f-actin detected by alexa 568- phalloidin (red) is shown in the middle row. Sperm chromatin was detected with DRAQ5 (blue) and the combined images containing all three channels are displayed in the bottom row. Specificity of the anit-PYK2 antibody is seen in column (E) where a pyk2 -/- oocyte collected at 45 m.p.i. was labeled under identical conditions. Magnification is indicated by the bar, which represents 5 µm.

Journal: Developmental biology

Article Title: Sperm-oocyte contact induces outside-in signaling via PYK2 activation.

doi: 10.1016/j.ydbio.2017.05.016

Figure Lengend Snippet: Fig. 1. PYK2 recruitment at the site of sperm-oocyte contact. Zona-free oocytes were incubated with a limiting concentration of sperm and samples were fixed at 30 (A, A′), 45 (B, C), and 60 (D) m.p.i., then processed for confocal immunofluorescence. The distribution of anti-PYK2 protein (green) is shown in the top panels, while f-actin detected by alexa 568- phalloidin (red) is shown in the middle row. Sperm chromatin was detected with DRAQ5 (blue) and the combined images containing all three channels are displayed in the bottom row. Specificity of the anit-PYK2 antibody is seen in column (E) where a pyk2 -/- oocyte collected at 45 m.p.i. was labeled under identical conditions. Magnification is indicated by the bar, which represents 5 µm.

Article Snippet: An eGFP-linked dominant-negative construct encoding the N-terminal ERM domain (aa1-370) of PYK2 was amplified from the human PYK2 transcript variant 1 cDNA (Origene, Rockville, MD) using the following primers: (forward; CCCAAGCTTATGTCTGGGGTGTCCGAGCCC); (reverse; CCCAAGCTTGCTGTTCCGCTTCTCACCATCTT) which contained a Hind III site used to ligate the product into the N-terminal cloning site of pEGFPN1 (Clontech, Mountain View, CA).

Techniques: Incubation, Concentration Assay, Labeling

Fig. 2. PYK2 activation at the site of sperm-oocyte contact. Zona-free oocytes incubated with sperm for 30 min and processed for immunofluorescence as above, were labeled with anti PYK2 PY579 (green), alexa 568-phalloidin (red), and DRAQ5 (blue). The position of an aggregation of phosphorylated (activated) PYK2 and f-actin in close proximity to one of the bound sperm is indicated by the arrows. Magnification is indicated by the bar, which represents 10 µm.

Journal: Developmental biology

Article Title: Sperm-oocyte contact induces outside-in signaling via PYK2 activation.

doi: 10.1016/j.ydbio.2017.05.016

Figure Lengend Snippet: Fig. 2. PYK2 activation at the site of sperm-oocyte contact. Zona-free oocytes incubated with sperm for 30 min and processed for immunofluorescence as above, were labeled with anti PYK2 PY579 (green), alexa 568-phalloidin (red), and DRAQ5 (blue). The position of an aggregation of phosphorylated (activated) PYK2 and f-actin in close proximity to one of the bound sperm is indicated by the arrows. Magnification is indicated by the bar, which represents 10 µm.

Article Snippet: An eGFP-linked dominant-negative construct encoding the N-terminal ERM domain (aa1-370) of PYK2 was amplified from the human PYK2 transcript variant 1 cDNA (Origene, Rockville, MD) using the following primers: (forward; CCCAAGCTTATGTCTGGGGTGTCCGAGCCC); (reverse; CCCAAGCTTGCTGTTCCGCTTCTCACCATCTT) which contained a Hind III site used to ligate the product into the N-terminal cloning site of pEGFPN1 (Clontech, Mountain View, CA).

Techniques: Activation Assay, Incubation, Labeling

Fig. 4. PYK2 recruitment to sperm binding sites does not require sperm – oocyte fusion. Zona-free CF-1 oocytes were pre-loaded with DRAQ5, then washed and incubated in KSOMaa +15 mg/ml BSA at pH 6.1 or at pH 7.3, as indicated under the X-axis. Capacitated sperm were added and samples were fixed at 20, 30, and 40 min post- insemination. For dye diffusion analysis, groups of 10 oocytes collected at each time point were fixed in formaldehyde to maintain membrane integrity and immediately imaged by confocal microscopy with the 633 nm laser to identify sperm heads that had accumulated DRAQ5 from the oocyte. Duplicate samples for immunofluorescence detection of PYK2 were fixed in 2% formaldehyde with picric acid, and processed through immunolabeling of PYK2. The percent of oocytes that had fused with at least one sperm is indicated by white bars. The percent of oocytes that exhibited PYK2 foci in close proximity to bound sperm is indicated by grey bars. Values along the Y axis represent the mean of 4 experiments ± SEM.

Journal: Developmental biology

Article Title: Sperm-oocyte contact induces outside-in signaling via PYK2 activation.

doi: 10.1016/j.ydbio.2017.05.016

Figure Lengend Snippet: Fig. 4. PYK2 recruitment to sperm binding sites does not require sperm – oocyte fusion. Zona-free CF-1 oocytes were pre-loaded with DRAQ5, then washed and incubated in KSOMaa +15 mg/ml BSA at pH 6.1 or at pH 7.3, as indicated under the X-axis. Capacitated sperm were added and samples were fixed at 20, 30, and 40 min post- insemination. For dye diffusion analysis, groups of 10 oocytes collected at each time point were fixed in formaldehyde to maintain membrane integrity and immediately imaged by confocal microscopy with the 633 nm laser to identify sperm heads that had accumulated DRAQ5 from the oocyte. Duplicate samples for immunofluorescence detection of PYK2 were fixed in 2% formaldehyde with picric acid, and processed through immunolabeling of PYK2. The percent of oocytes that had fused with at least one sperm is indicated by white bars. The percent of oocytes that exhibited PYK2 foci in close proximity to bound sperm is indicated by grey bars. Values along the Y axis represent the mean of 4 experiments ± SEM.

Article Snippet: An eGFP-linked dominant-negative construct encoding the N-terminal ERM domain (aa1-370) of PYK2 was amplified from the human PYK2 transcript variant 1 cDNA (Origene, Rockville, MD) using the following primers: (forward; CCCAAGCTTATGTCTGGGGTGTCCGAGCCC); (reverse; CCCAAGCTTGCTGTTCCGCTTCTCACCATCTT) which contained a Hind III site used to ligate the product into the N-terminal cloning site of pEGFPN1 (Clontech, Mountain View, CA).

Techniques: Binding Assay, Incubation, Membrane, Confocal Microscopy, Immunolabeling

Fig. 5. Recruitment of PYK2 at sperm binding sites of oocytes cultured at pH 6.1. Zona-free oocytes were pre-loaded with DRAQ5, then washed and incubated in KSOMaa +15 mg/ml BSA at pH 6.1, as in Fig. 3. Capacitated sperm were added and samples were fixed with 2% formaldehyde containing picric acid at 20 (A), 30 (B), and 40 (C) minutes post-insemination, then prepared for immunofluorescence detection of PYK2. PYK2 protein detected by alexa 488-anti-rabbit IgG is represented in the green channel (top row), while f-actin detected by alexa 568-phalloidin is seen in the red channel (middle row). Sperm chromatin labeled with DRAQ5 is seen in the blue channel. Sperm binding sites where PYK2 accumulation was observed are indicated by the arrows. Magnification is indicated by the bar, which represents 10 µm.

Journal: Developmental biology

Article Title: Sperm-oocyte contact induces outside-in signaling via PYK2 activation.

doi: 10.1016/j.ydbio.2017.05.016

Figure Lengend Snippet: Fig. 5. Recruitment of PYK2 at sperm binding sites of oocytes cultured at pH 6.1. Zona-free oocytes were pre-loaded with DRAQ5, then washed and incubated in KSOMaa +15 mg/ml BSA at pH 6.1, as in Fig. 3. Capacitated sperm were added and samples were fixed with 2% formaldehyde containing picric acid at 20 (A), 30 (B), and 40 (C) minutes post-insemination, then prepared for immunofluorescence detection of PYK2. PYK2 protein detected by alexa 488-anti-rabbit IgG is represented in the green channel (top row), while f-actin detected by alexa 568-phalloidin is seen in the red channel (middle row). Sperm chromatin labeled with DRAQ5 is seen in the blue channel. Sperm binding sites where PYK2 accumulation was observed are indicated by the arrows. Magnification is indicated by the bar, which represents 10 µm.

Article Snippet: An eGFP-linked dominant-negative construct encoding the N-terminal ERM domain (aa1-370) of PYK2 was amplified from the human PYK2 transcript variant 1 cDNA (Origene, Rockville, MD) using the following primers: (forward; CCCAAGCTTATGTCTGGGGTGTCCGAGCCC); (reverse; CCCAAGCTTGCTGTTCCGCTTCTCACCATCTT) which contained a Hind III site used to ligate the product into the N-terminal cloning site of pEGFPN1 (Clontech, Mountain View, CA).

Techniques: Binding Assay, Cell Culture, Incubation, Labeling

Fig. 6. Role of PYK2 in gamete fusion and sperm incorporation. The timing and extent of sperm-oocyte fusion was quantified in WT (white bars) and pyk2 -/- (grey bars) oocytes pre-loaded with DRAQ5 as in Fig. 3. Samples of oocytes were collected at 60, 90, and 120 m.p.i. to correlate with the sperm incorporation time course (below). Sperm heads bound to the oocyte surface that accumulated DRAQ5 from the oocyte were considered to have fused with the oocyte plasma membrane (panel A). Values represent the mean of 4 experiments including 116 WT oocytes and 126 pyk2 -/- oocytes. The timing and extent of sperm incorporation was quantified in separate experiments (Panel B) where WT (white bars) and pyk2 -/- (grey bars) oocytes were fixed and labeled with DRAQ 5 to label all sperm heads and with alexa 568-phalloidin to label the cortical actin layer. Sperm heads that were located within the oocyte cytoplasm and which showed evidence of nuclear decondensation were considered to be incorporated. Values in panel B represent the mean of 5 groups including 123 WT oocytes and 133 pyk2 -/- oocytes ± SEM. (*) t- test indicated that the WT and pyk2 -/- means were significantly different (P=0.01).

Journal: Developmental biology

Article Title: Sperm-oocyte contact induces outside-in signaling via PYK2 activation.

doi: 10.1016/j.ydbio.2017.05.016

Figure Lengend Snippet: Fig. 6. Role of PYK2 in gamete fusion and sperm incorporation. The timing and extent of sperm-oocyte fusion was quantified in WT (white bars) and pyk2 -/- (grey bars) oocytes pre-loaded with DRAQ5 as in Fig. 3. Samples of oocytes were collected at 60, 90, and 120 m.p.i. to correlate with the sperm incorporation time course (below). Sperm heads bound to the oocyte surface that accumulated DRAQ5 from the oocyte were considered to have fused with the oocyte plasma membrane (panel A). Values represent the mean of 4 experiments including 116 WT oocytes and 126 pyk2 -/- oocytes. The timing and extent of sperm incorporation was quantified in separate experiments (Panel B) where WT (white bars) and pyk2 -/- (grey bars) oocytes were fixed and labeled with DRAQ 5 to label all sperm heads and with alexa 568-phalloidin to label the cortical actin layer. Sperm heads that were located within the oocyte cytoplasm and which showed evidence of nuclear decondensation were considered to be incorporated. Values in panel B represent the mean of 5 groups including 123 WT oocytes and 133 pyk2 -/- oocytes ± SEM. (*) t- test indicated that the WT and pyk2 -/- means were significantly different (P=0.01).

Article Snippet: An eGFP-linked dominant-negative construct encoding the N-terminal ERM domain (aa1-370) of PYK2 was amplified from the human PYK2 transcript variant 1 cDNA (Origene, Rockville, MD) using the following primers: (forward; CCCAAGCTTATGTCTGGGGTGTCCGAGCCC); (reverse; CCCAAGCTTGCTGTTCCGCTTCTCACCATCTT) which contained a Hind III site used to ligate the product into the N-terminal cloning site of pEGFPN1 (Clontech, Mountain View, CA).

Techniques: Clinical Proteomics, Membrane, Labeling

Fig. 7. Role of PYK2 in actin polymerization at sperm-oocyte binding sites. Oocytes in which PYK2 was suppressed by different methods were incubated with capacitated sperm, then fixed at 45 m.p.i. to determine whether they could respond to sperm binding by accumulation of f-actin in the cortical actin layer. The distribution of actin at sites of sperm contact was detected by labeling with alexa 568-phalloidin to detect f-actin (red) and DRAQ5 to detect sperm DNA (blue). PYK2 activity was suppressed in WT oocytes by three independent methods. The effect of chemical inhibition is shown in panels A and B, where oocytes were treated with 0.1% DMSO as a solvent control (A) or with the inhibitor PF0454799 at 10uM for 30 min, then washed prior to addition of sperm (B). The effect of the dominant-negative PERM fusion construct was tested by injecting oocytes with cRNA encoding eGFP as a control (C), or with cRNA encoding the inhibitory PERM-eGFP construct (D). Panels E and F demonstrate the effect of pyk2 knockout on the response of oocytes to bound sperm with examples of sperm bound to a WT oocyte (E) and a pyk2 -/- oocyte (F). Magnification is indicated by the bar which represents 5 µm.

Journal: Developmental biology

Article Title: Sperm-oocyte contact induces outside-in signaling via PYK2 activation.

doi: 10.1016/j.ydbio.2017.05.016

Figure Lengend Snippet: Fig. 7. Role of PYK2 in actin polymerization at sperm-oocyte binding sites. Oocytes in which PYK2 was suppressed by different methods were incubated with capacitated sperm, then fixed at 45 m.p.i. to determine whether they could respond to sperm binding by accumulation of f-actin in the cortical actin layer. The distribution of actin at sites of sperm contact was detected by labeling with alexa 568-phalloidin to detect f-actin (red) and DRAQ5 to detect sperm DNA (blue). PYK2 activity was suppressed in WT oocytes by three independent methods. The effect of chemical inhibition is shown in panels A and B, where oocytes were treated with 0.1% DMSO as a solvent control (A) or with the inhibitor PF0454799 at 10uM for 30 min, then washed prior to addition of sperm (B). The effect of the dominant-negative PERM fusion construct was tested by injecting oocytes with cRNA encoding eGFP as a control (C), or with cRNA encoding the inhibitory PERM-eGFP construct (D). Panels E and F demonstrate the effect of pyk2 knockout on the response of oocytes to bound sperm with examples of sperm bound to a WT oocyte (E) and a pyk2 -/- oocyte (F). Magnification is indicated by the bar which represents 5 µm.

Article Snippet: An eGFP-linked dominant-negative construct encoding the N-terminal ERM domain (aa1-370) of PYK2 was amplified from the human PYK2 transcript variant 1 cDNA (Origene, Rockville, MD) using the following primers: (forward; CCCAAGCTTATGTCTGGGGTGTCCGAGCCC); (reverse; CCCAAGCTTGCTGTTCCGCTTCTCACCATCTT) which contained a Hind III site used to ligate the product into the N-terminal cloning site of pEGFPN1 (Clontech, Mountain View, CA).

Techniques: Binding Assay, Incubation, Labeling, Activity Assay, Inhibition, Solvent, Control, Dominant Negative Mutation, Construct, Knock-Out

Fig. 8. PYK2 is required for enhanced actin polymerization at a subset of sperm-oocyte binding sites. Zona-free oocytes collected from WT and PYK2 -/- females were incubated with capacitated sperm for 45 min as described in Section 2 then fixed and labeled with alexa 568-phalloidin to detect f-actin (red) and DRAQ5 to detect sperm DNA (blue). The distribution of bound sperm and f-actin in the oocyte cortex was recorded by Z-stack confocal imaging and quantified by linescan analysis as described in Section 2. Panel A demonstrates the distribution of sperm heads (labeled S31,33, 34, 35 and 36) detected by DRAQ5 fluorescence in the blue channel (Y axis, upper trace) around the perimeter of a representative optical section through a WT oocyte. The corresponding alexa 568-phalloidin fluorescence is expressed in the red channel (Y axis, lower trace). Instances where sperm binding sites are associated with increased alexa 568-fluorescence are indicated by arrows. “actin cap” represents the thickening of the cortical actin layer that normally occurs over the MII spindle. Panel B demonstrated the relative integrated alexa 568-phalloidin fluorescence (Y axis) calculated for each sperm binding site (n=123) from 7 WT oocytes and (n=134) from 7 pyk2 -/- oocytes. “0” representing no change relative to the adjacent cortex and positive values representing an increase in fluorescence intensity relative to the adjacent cortex. Panels C and D display the number of sperm binding sites associated with given levels of relative integrated alexa 568-phalloidin fluorescence (X axis).

Journal: Developmental biology

Article Title: Sperm-oocyte contact induces outside-in signaling via PYK2 activation.

doi: 10.1016/j.ydbio.2017.05.016

Figure Lengend Snippet: Fig. 8. PYK2 is required for enhanced actin polymerization at a subset of sperm-oocyte binding sites. Zona-free oocytes collected from WT and PYK2 -/- females were incubated with capacitated sperm for 45 min as described in Section 2 then fixed and labeled with alexa 568-phalloidin to detect f-actin (red) and DRAQ5 to detect sperm DNA (blue). The distribution of bound sperm and f-actin in the oocyte cortex was recorded by Z-stack confocal imaging and quantified by linescan analysis as described in Section 2. Panel A demonstrates the distribution of sperm heads (labeled S31,33, 34, 35 and 36) detected by DRAQ5 fluorescence in the blue channel (Y axis, upper trace) around the perimeter of a representative optical section through a WT oocyte. The corresponding alexa 568-phalloidin fluorescence is expressed in the red channel (Y axis, lower trace). Instances where sperm binding sites are associated with increased alexa 568-fluorescence are indicated by arrows. “actin cap” represents the thickening of the cortical actin layer that normally occurs over the MII spindle. Panel B demonstrated the relative integrated alexa 568-phalloidin fluorescence (Y axis) calculated for each sperm binding site (n=123) from 7 WT oocytes and (n=134) from 7 pyk2 -/- oocytes. “0” representing no change relative to the adjacent cortex and positive values representing an increase in fluorescence intensity relative to the adjacent cortex. Panels C and D display the number of sperm binding sites associated with given levels of relative integrated alexa 568-phalloidin fluorescence (X axis).

Article Snippet: An eGFP-linked dominant-negative construct encoding the N-terminal ERM domain (aa1-370) of PYK2 was amplified from the human PYK2 transcript variant 1 cDNA (Origene, Rockville, MD) using the following primers: (forward; CCCAAGCTTATGTCTGGGGTGTCCGAGCCC); (reverse; CCCAAGCTTGCTGTTCCGCTTCTCACCATCTT) which contained a Hind III site used to ligate the product into the N-terminal cloning site of pEGFPN1 (Clontech, Mountain View, CA).

Techniques: Binding Assay, Incubation, Labeling, Imaging