|
Sino Biological
human pcmvnrf2 Human Pcmvnrf2, supplied by Sino Biological, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human pcmvnrf2/product/Sino Biological Average 91 stars, based on 1 article reviews
human pcmvnrf2 - by Bioz Stars,
2026-04
91/100 stars
|
Buy from Supplier |
|
Shanghai Korain Biotech Co Ltd
nrf 2 Nrf 2, supplied by Shanghai Korain Biotech Co Ltd, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/nrf 2/product/Shanghai Korain Biotech Co Ltd Average 94 stars, based on 1 article reviews
nrf 2 - by Bioz Stars,
2026-04
94/100 stars
|
Buy from Supplier |
|
R&D Systems
mouse anti nrf2 antibody ![]() Mouse Anti Nrf2 Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mouse anti nrf2 antibody/product/R&D Systems Average 93 stars, based on 1 article reviews
mouse anti nrf2 antibody - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
R&D Systems
mouse monoclonal antibody ![]() Mouse Monoclonal Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mouse monoclonal antibody/product/R&D Systems Average 92 stars, based on 1 article reviews
mouse monoclonal antibody - by Bioz Stars,
2026-04
92/100 stars
|
Buy from Supplier |
|
R&D Systems
anti nrf2 ![]() Anti Nrf2, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti nrf2/product/R&D Systems Average 93 stars, based on 1 article reviews
anti nrf2 - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Angio-Proteomie
nrf2 ![]() Nrf2, supplied by Angio-Proteomie, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/nrf2/product/Angio-Proteomie Average 86 stars, based on 1 article reviews
nrf2 - by Bioz Stars,
2026-04
86/100 stars
|
Buy from Supplier |
|
Boster Bio
anti nuclear factor kappa b p65 ![]() Anti Nuclear Factor Kappa B P65, supplied by Boster Bio, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti nuclear factor kappa b p65/product/Boster Bio Average 94 stars, based on 1 article reviews
anti nuclear factor kappa b p65 - by Bioz Stars,
2026-04
94/100 stars
|
Buy from Supplier |
|
R&D Systems Hematology
nrf2 ![]() Nrf2, supplied by R&D Systems Hematology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/nrf2/product/R&D Systems Hematology Average 93 stars, based on 1 article reviews
nrf2 - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Novus Biologicals
recombinant nrf2 rnrf2 ![]() Recombinant Nrf2 Rnrf2, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/recombinant nrf2 rnrf2/product/Novus Biologicals Average 90 stars, based on 1 article reviews
recombinant nrf2 rnrf2 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
OriGene
sr321100a auugauguuucugaucuaucacutt ![]() Sr321100a Auugauguuucugaucuaucacutt, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sr321100a auugauguuucugaucuaucacutt/product/OriGene Average 93 stars, based on 1 article reviews
sr321100a auugauguuucugaucuaucacutt - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
OriGene
myc flag ![]() Myc Flag, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/myc flag/product/OriGene Average 94 stars, based on 1 article reviews
myc flag - by Bioz Stars,
2026-04
94/100 stars
|
Buy from Supplier |
|
OriGene
nrf2 nfe2l2 nm 006164 human untagged ![]() Nrf2 Nfe2l2 Nm 006164 Human Untagged, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/nrf2 nfe2l2 nm 006164 human untagged/product/OriGene Average 90 stars, based on 1 article reviews
nrf2 nfe2l2 nm 006164 human untagged - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: American Journal of Translational Research
Article Title: PIAS3/SOCS1-STAT3 axis responses to oxidative stress in hepatocellular cancer cells
doi:
Figure Lengend Snippet: Effect of H2O2 treatment on oxidative stress induction and malignant processes in HCC cells. A. H2O2 (50 μM for 24 h) and/or antioxidant TA treatment. Total antioxidant capacity (TAC) in HepG2 cells was determined. VCEAC: vitamin C equivalent antioxidant capacity (n=3). B. Protein carbonyl content in HepG2 cells was detected (n=3). C. Western blotting detected the expression of Nrf2 protein in cells (n=3). The band density for Nrf2 protein are shown (n=3). D. HepG2 cell proliferation 48 h after different treatments (n=3). E. Cell growth of HepG2 cells 24-72 h post treatment (n=3). F. Cell apoptosis in HepG2 cells. G. Invasion ability of HepG2 cells (n=3). Scale bar, 50 μm. H. Migration capacity of HepG2 cells (n=3). Scale bar, 50 μm. *P<0.05, **P<0.01.
Article Snippet: Immunohistochemical staining Immunohistochemical staining was performed according to the manufacturer’s instructions with the following reagents and instruments: horse serum (RTU Vectastain Kit, PK-7200), 1:200
Techniques: Western Blot, Expressing, Migration
Journal: American Journal of Translational Research
Article Title: PIAS3/SOCS1-STAT3 axis responses to oxidative stress in hepatocellular cancer cells
doi:
Figure Lengend Snippet: Effects of PIAS3 and SOCS1 overexpression and colivelin treatment on oxidative stress induction and malignant processes of HCC cells. HepG2 cells were transfected with PIAS3 or SOCS1 overexpression vector for 36 h and then treated with H2O2 (50 μM) and/or 0.5 μM CO for 24 h. A. Total antioxidant capacity (TAC) in HepG2 cells was determined. VCEAC: vitamin C equivalent antioxidant capacity (n=3). B. Protein carbonyl content in HepG2 cells was detected (n=3). C. Western blotting detected the expression of Nrf2 protein in cells (n=3). Quantification data from three independent repeats were showed below the blot. D. HepG2 cell proliferation 48 h after different treatments (n=3). E. MTT assays detected cell growth of HepG2 cells 24-72 h post treatment (n=3). F. Cell apoptosis of HepG2 cells. G. Invasion ability of HepG2 cells (n=3). Scale bar, 50 μm. H. Migration capacity of HepG2 cells (n=3). Scale bar, 50 μm. *P<0.05, **P<0.01.
Article Snippet: Immunohistochemical staining Immunohistochemical staining was performed according to the manufacturer’s instructions with the following reagents and instruments: horse serum (RTU Vectastain Kit, PK-7200), 1:200
Techniques: Over Expression, Transfection, Plasmid Preparation, Western Blot, Expressing, Migration
Journal: Antioxidants & Redox Signaling
Article Title: Extracellular Superoxide Dismutase Attenuates Renal Oxidative Stress Through the Activation of Adenosine Monophosphate-Activated Protein Kinase in Diabetic Nephropathy
doi: 10.1089/ars.2017.7207
Figure Lengend Snippet: Western blot analysis of nuclear Nrf2, cytoplasmic/total Nrf2, Keap1, NQO-1, HO-1, and NADPH oxidases in db/m and db/db mice with or without hEC-SOD treatment. Protein lysates (30 μg) from renal cortex were separated by SDS-PAGE and analyzed by Western blotting. (A) Representative Western blot showing nuclear Nrf2, cytoplasmic/total Nrf2, Keap1, NQO-1, HO-1, lamin B1, and β-actin. Quantitative analyses of the results from the Western blot: (Supplementary Fig. S2). (B) nuclear Nrf2/lamin B1, (C) cytoplasmic Nrf2/total Nrf2, (D) Keap1/β-actin, (E) NQO-1/β-actin, and (F) HO-1/β-actin. *p < 0.05 and **p < 0.01 vs. dm cont (db/m cont), dm+hEC-SOD (db/m hEC-SOD) and db+hEC-SOD (db/db hEC-SOD) mice. (G) Representative Western blot showing Nox1, Nox2, Nox4, and β-actin. Quantitative analyses of the results from the Western blot: (Supplementary Fig. S2). (H) Nox1/β-actin, (I) Nox2/β-actin, and (J) Nox4/β-actin, **p < 0.01, and #p < 0.001 vs. dm cont (db/m cont), dm+hEC-SOD (db/m hEC-SOD) and db+hEC-SOD (db/db hEC-SOD) mice. HO-1, heme oxygenase; Keap1, Kelchlike ECh-associated protein 1; NQO-1, NAD(P)H dehydrogenase 1; Nrf2, nuclear factor E2-related factor 2.
Article Snippet: Primers used for AMPKα1, AMPKα2, PGC-1α, and Nrf2 are shown in . table ft1 table-wrap mode="anchored" t5 Table 2. caption a7 Gene Sequence AMPKα1 Fwd: GTCAAAGCCGACCCAATGATA Rev: CGTACACGCAAATAATAGGGGTT AMPKα2 Fwd: CAGGCCATAAAGTGGCAGTTA Rev: AAAAGTCTGTCGGAGTGCTGA PGC-1α Fwd: AGAGCAAGTATGACTCTCTGG Rev: GTCCTCACATGTGTACATATG Nrf2 Fwd: TTGGCAGAGACATTCCCAT Rev: GCTGCCACCGTCACTGGG 18s rRNA Fwd: CGCGGTTCTATTTTGTTGGT Rev: AGTCGGCATCGTTTATGGTC Open in a separate window AMPK, adenosine monophosphate-activated protein kinase; Fwd, forward;
Techniques: Western Blot, SDS Page
Journal: Antioxidants & Redox Signaling
Article Title: Extracellular Superoxide Dismutase Attenuates Renal Oxidative Stress Through the Activation of Adenosine Monophosphate-Activated Protein Kinase in Diabetic Nephropathy
doi: 10.1089/ars.2017.7207
Figure Lengend Snippet: RT-PCR of AMPK, PGC-1α, and Nrf2 and electron micrographs showing mitochondrial morphology in db/m and db/db mice with or without hEC-SOD treatment. (A) Representative RT-PCR showing ampkα1, ampkα2, pgc-1α, nrf2, and 18s rRNA. Quantitative analyses of the results from the RT-PCR: (Supplementary Fig. S3). (B) ampkα1/18s rRNA, (C) ampkα2/18s rRNA, (D) pgc-1α/18s rRNA, and (E) nrf2/18s rRNA. *P < 0.05 and **P < 0.01 compared with other groups. (F) Representative images of mitochondrial morphology by transmission electron microscopy in kidney tissues of db/m and db/db mice with or without hEC-SOD treatment. RT-PCR, reverse transcription polymerase chain reaction.
Article Snippet: Primers used for AMPKα1, AMPKα2, PGC-1α, and Nrf2 are shown in . table ft1 table-wrap mode="anchored" t5 Table 2. caption a7 Gene Sequence AMPKα1 Fwd: GTCAAAGCCGACCCAATGATA Rev: CGTACACGCAAATAATAGGGGTT AMPKα2 Fwd: CAGGCCATAAAGTGGCAGTTA Rev: AAAAGTCTGTCGGAGTGCTGA PGC-1α Fwd: AGAGCAAGTATGACTCTCTGG Rev: GTCCTCACATGTGTACATATG Nrf2 Fwd: TTGGCAGAGACATTCCCAT Rev: GCTGCCACCGTCACTGGG 18s rRNA Fwd: CGCGGTTCTATTTTGTTGGT Rev: AGTCGGCATCGTTTATGGTC Open in a separate window AMPK, adenosine monophosphate-activated protein kinase; Fwd, forward;
Techniques: Reverse Transcription Polymerase Chain Reaction, Transmission Assay, Electron Microscopy, Reverse Transcription, Polymerase Chain Reaction
Journal: Antioxidants & Redox Signaling
Article Title: Extracellular Superoxide Dismutase Attenuates Renal Oxidative Stress Through the Activation of Adenosine Monophosphate-Activated Protein Kinase in Diabetic Nephropathy
doi: 10.1089/ars.2017.7207
Figure Lengend Snippet: Primer Sequences for Reverse Transcription Polymerase Chain Reaction Analysis
Article Snippet: Primers used for AMPKα1, AMPKα2, PGC-1α, and Nrf2 are shown in . table ft1 table-wrap mode="anchored" t5 Table 2. caption a7 Gene Sequence AMPKα1 Fwd: GTCAAAGCCGACCCAATGATA Rev: CGTACACGCAAATAATAGGGGTT AMPKα2 Fwd: CAGGCCATAAAGTGGCAGTTA Rev: AAAAGTCTGTCGGAGTGCTGA PGC-1α Fwd: AGAGCAAGTATGACTCTCTGG Rev: GTCCTCACATGTGTACATATG Nrf2 Fwd: TTGGCAGAGACATTCCCAT Rev: GCTGCCACCGTCACTGGG 18s rRNA Fwd: CGCGGTTCTATTTTGTTGGT Rev: AGTCGGCATCGTTTATGGTC Open in a separate window AMPK, adenosine monophosphate-activated protein kinase; Fwd, forward;
Techniques: Reverse Transcription, Polymerase Chain Reaction, Sequencing
Journal: Frontiers in Molecular Biosciences
Article Title: Nrf2 Modulates the Hybrid Epithelial/Mesenchymal Phenotype and Notch Signaling During Collective Cancer Migration
doi: 10.3389/fmolb.2022.807324
Figure Lengend Snippet: Nrf2 regulates the Notch signaling pathway in the migrating front. (A – C) Immunocytochemistry of RT4 bladder cancer cells measuring Jagged1 (left column), Notch1 (center column), and Dll4 (right column) protein levels in a cell migration assay for (A) CRISPR/Cas9 NFE2L2-KO Pool RT4 cells (KO), (B) RT4 cells (Control), and (C) sulforaphane treated (7.5 μM, 24 h) RT4 cells (SFN), respectively. Scale bars, 50 μm. (D – F) Quantification of immunocytochemistry data. (D) Average intensity of each cell in the whole monolayer. One-Way ANOVA with post-hoc Tukey’s test was used to compare across groups (Jagged1: KO n = 307 cells, Control n = 526 cells, SFN n = 423 cells. Notch1: KO n = 307 cells, Control n = 370 cells, SFN n = 423 cells. Dll4: KO n = 460 cells, Control n = 1135 cells, SFN n = 570 cells). (E) Tracing of relative fluorescence intensity per tissue depth measured as number of cell layers. Data represent mean ± S.E.M. (F) Heatmap of representative cells at the leading edge for Jagged1, Notch1, and Dll4, respectively. Each cell at the leading edge is indicated by “Cell #” where cell #1 refers to the first measured cell from top to bottom. Results are from four experiments performed across different days.
Article Snippet: Primary antibodies used were
Techniques: Immunocytochemistry, Cell Migration Assay, CRISPR, Control, Fluorescence
Journal: Frontiers in Molecular Biosciences
Article Title: Nrf2 Modulates the Hybrid Epithelial/Mesenchymal Phenotype and Notch Signaling During Collective Cancer Migration
doi: 10.3389/fmolb.2022.807324
Figure Lengend Snippet: Nrf2 modulations impair collective migration in a 2D model. (A) Bright-field images of CRISPR/Cas9 NFE2L2-KO Pool RT4 cells (KO), RT4 cells (Control) and sulforaphane treated (7.5 μM, 24 h) RT4 cells (SFN) for 0 and 48 h migration time points. Scale bars, 100 μm. (B) Violin plot of migration rate for KO, control, and SFN, respectively. One-way ANOVA with post-hoc Tukey test was used to compare across groups and the ROUT method was used to identify outliers (KO n = 44 leading edges, Control n = 91 leading edges, SFN n = 78 leading edges). (C) Representative images illustrating the formation of migration tips. Scale bars, 100 μm. (D) Violin plot of protrusions/mm for KO, control, and SFN, respectively. One-way ANOVA with post-hoc Tukey test was used to compare across groups and the ROUT method was used to identify outliers (KO n = 43 leading edges, Control n = 110 leading edges, SFN n = 86 leading edges). Results are from four experiments performed across different days.
Article Snippet: Primary antibodies used were
Techniques: Migration, CRISPR, Control
Journal: Frontiers in Molecular Biosciences
Article Title: Nrf2 Modulates the Hybrid Epithelial/Mesenchymal Phenotype and Notch Signaling During Collective Cancer Migration
doi: 10.3389/fmolb.2022.807324
Figure Lengend Snippet: Spatial patterning of cells in the multicell model of cell migration. (A) Left: In the multicell model, cells are arranged on a hexagonal lattice. Cells at the leftmost region (leading edge) are highly exposed to an external EMT-inducing signal (indicated by the blue shading), while cells in the interior are weakly exposed. Right: The signaling dynamics within each cell is described by the coupled biochemical network of Nrf2, EMT and Notch. Binding between Notch ligands and receptors of neighboring cells give rise to cell-cell communication. (B) Snapshot of the multicell pattern after 120 h of simulation starting from a randomized initial condition for a case of weak Nrf2 activation ( g N R F 2 = 0 molecules/hour). Green, yellow and red hexagons depict epithelial (E), hybrid E/M and mesenchymal (M) cells, respectively. (C) Fraction of E, E/M, and M cells as a function of distance from the leading edge for weak Nrf2 activation. Black dashed line indicates the M-E/M crossover point. (D , E) Same as (B , C) for intermediate Nrf2 activation ( g N R F 2 = 0.5 × 10 5 molecules/hour). (F , G) Same as (B , C) for strong Nrf2 activation ( g N R F 2 = 10 5 molecules/hour). (H) Crossover point where the fraction of hybrid E/M cells becomes larger than the fraction of M cells as a function of Nrf2 production rate. (I) Comparison of ZEB1 levels between simulation (red line) and control experiment (black line) in the first 13 cell layers. (J) Fold-change in ZEB1 levels between the first and second cell layers as a function of Nrf2 production rate. Result for panels C-E-G-H-I-J are averaged over five independent simulations.
Article Snippet: Primary antibodies used were
Techniques: Migration, Binding Assay, Activation Assay, Comparison, Control
Journal: Frontiers in Molecular Biosciences
Article Title: Nrf2 Modulates the Hybrid Epithelial/Mesenchymal Phenotype and Notch Signaling During Collective Cancer Migration
doi: 10.3389/fmolb.2022.807324
Figure Lengend Snippet: Nrf2 modulates EMT near the leading edge during collective migration. (A – C) Immunocytochemistry of RT4 bladder cancer cells measuring Nrf2 (left column), ZEB1 (center column), and E-cadherin (right column) protein levels in a cell migration assay for (A) CRISPR/Cas9 NFE2L2-KO Pool RT4 cells (KO), (B) RT4 cells (Control), and (C) sulforaphane treated (7.5 μM, 24 h) RT4 cells (SFN), respectively. Scale bars, 50 μm. (D – F) Quantification of immunocytochemistry data. (D) Average intensity of each cell in the whole monolayer. One-way ANOVA with post-hoc Tukey’s test was used to compare across groups (NRF2: KO n = 598 cells, Control n = 503 cells, and SFN n = 564 cells. ZEB1: KO n = 385 cells, Control n = 1267 cells, and SFN n = 1166 cells. E-cadherin: KO n = 385 cells, Control n = 1268 cells, and SFN n = 1166 cells). (E) Intensity distribution in the migrating monolayer measured as number of cell layers (position from the leading edge). Data represent mean ± S.E.M. (F) Heatmap of representative cells at the leading edge for Nrf2, E-cadherin, and ZEB1, respectively. Each cell at the leading edge is indicated by “Cell #” where cell #1 refers to the first measured cell from top to bottom. Results are from six experiments performed across different days.
Article Snippet: Primary antibodies used were
Techniques: Migration, Immunocytochemistry, Cell Migration Assay, CRISPR, Control
Journal: Frontiers in Molecular Biosciences
Article Title: Nrf2 Modulates the Hybrid Epithelial/Mesenchymal Phenotype and Notch Signaling During Collective Cancer Migration
doi: 10.3389/fmolb.2022.807324
Figure Lengend Snippet: Nrf2 upregulation modulates microRNA miR-200c-3p and Notch1 and Dll4 mRNA in the migrating front. (A – C) Live single cell gene expression measurements with the dsLNA probes in RT4 cells. From left to right: fluorescence images of control and SFN (7.5 μM, 24 h) cases, tracing of relative fluorescence intensity per tissue depth measured as number of cell layers, and heatmap of representative cells at the leading edge measuring (A) microRNA miR-200c-3p, (B) Notch1 mRNA, and (C) Dll4 mRNA levels in a cell migration assay. (D – F) FISH assay in fixed RT4 cells. From left to right: fluorescence images of control and SFN cases, tracing of relative fluorescence intensity per tissue depth measured as number of cell layers, and heatmap of representative cells at the leading edge measuring (D) microRNA miR-200c-3p, (E) Notch1 mRNA, and (F) Dll4 mRNA levels in a scratch cell migration assay. Scale bars, 50 μm. Each cell at the leading edge is indicated by “Cell #” where cell #1 refers to the first measured cell from top to bottom. Data represent mean ± S.E.M. The two-way ANOVA with the post-hoc Tukey test was performed to compare across groups. At least 500 cells were analyzed for each condition (miRNA-200c-3p, Notch1 mRNA, and Dll4 mRNA). Results are from three experiments performed across different days.
Article Snippet: Primary antibodies used were
Techniques: Gene Expression, Fluorescence, Control, Cell Migration Assay
Journal: Frontiers in Molecular Biosciences
Article Title: Nrf2 Modulates the Hybrid Epithelial/Mesenchymal Phenotype and Notch Signaling During Collective Cancer Migration
doi: 10.3389/fmolb.2022.807324
Figure Lengend Snippet: Analysis of the leading edge by the multicell model. (A) To conduct leading edge analysis, the expression of miR-200, Notch, Dll4 and Jagged1 is analyzed in the leftmost layer of cells (i.e., the cell layer more exposed to EMT-inducing signal and thus comparable to the experimental leading edge). (B) Heatmap of expression levels for miR-200, Notch1, Dll4 and Jagged1 in the leading edge as a function of Nrf2 activation. Each column represents the lattice leading edge for a different level of Nrf2 production rate ( g N r f 2 ). (C) Log-normalized probability to observe cells with varying levels of Dll4 and Jagged1 in the model’s leading edge under low Nrf2 induction. (D) Fraction of Epithelial, hybrid E/M, and Mesenchymal cells in the leading edge as a function of Nrf2 production rate ( g N r f 2 ). For panels (C , D) , results are averaged over five simulations starting from randomized initial conditions.
Article Snippet: Primary antibodies used were
Techniques: Expressing, Activation Assay
Journal: Frontiers in Molecular Biosciences
Article Title: Nrf2 Modulates the Hybrid Epithelial/Mesenchymal Phenotype and Notch Signaling During Collective Cancer Migration
doi: 10.3389/fmolb.2022.807324
Figure Lengend Snippet: Leader cell formation at the leading edge. (A) Representative bright-field images of leader cells after a 24 h cell migration assay for CRISPR/Cas9 NFE2L2-KO Pool RT4 cells (KO), RT4 cells (Control) and sulforaphane treated (7.5 μM, 24 h) RT4 cells (SFN), respectively. (B) Plot showing leader cells per millimeter for CRISPR/Cas9 NFE2L2-KO Pool RT4 cells (KO), RT4 cells (Control) and sulforaphane treated RT4 cells (SFN), respectively. One-way ANOVA with post-hoc Tukey’s test was used to compare across groups and the ROUT method was used to identify outliers (KO n = 46, Control n = 100, SNF n = 86 leading edges). (C – H) Representative immunocytochemistry images of leader cells in the control case (RT4 cells) characterizing gene expression for (C) E-cadherin, (D) Jagged1, (E) ZEB1, (F) Notch1, (G) Nrf2, (H) Dll4. (I , J) Representative overlay images using the dsLNA biosensors to measure mRNA levels of (I) Dll4 and (J) Notch1, respectively. (K , L) Mean intensity of leader vs. follower cells for levels of (K) Dll4 mRNA ( n = 6 follower cells) and (L) Notch1 mRNA ( n = 6 follower cells). (K , L) represent the quantification of one leader cell and its follower cells. Immunocytochemistry data are from four experiments, and dsLNA biosensor data are from three experiments. Scale bars, 20 μm.
Article Snippet: Primary antibodies used were
Techniques: Cell Migration Assay, CRISPR, Control, Immunocytochemistry, Gene Expression
Journal: Antioxidants (Basel, Switzerland)
Article Title: NRF2 Regulates Cystathionine Gamma-Lyase Expression and Activity in Primary Airway Epithelial Cells Infected with Respiratory Syncytial Virus.
doi: 10.3390/antiox11081582
Figure Lengend Snippet: Figure 2. CSE promoter activity in response to RSV infection, tBHQ stimulation and NRF2 expression. iSAE cells were transfected with -973 CSE-PGL4-Luc and Renilla-Luc plasmid (pRL-CMV) in 24-well plates. After 24 h, transfected cells were left untreated (control) or treated with tBHQ (25 µM) for 15 h or infected with RSV for 24 h alone or in combination with tBHQ (RSV + tBHQ). Luciferase activity was normalized to Renilla luciferase activity. Results are expressed as mean ± SEM of triplicate determination of a representative experiment repeated twice and expressed as fold change relative to control. * p < 0.05 relative to control cells, # p < 0.05 compared to RSV infected cells (A). iSAE cells were co-transfected with increasing amounts of NRF2 expression vector or the corresponding empty vector and harvested 48 h post transfection to measure luciferase activity. Luciferase activity was normalized to Renilla luciferase activity. Results are expressed as mean ± SEM of triplicate determination of a representative experiment repeated twice and expressed as fold change relative to control. * p < 0.05 relative to empty vector (B). Each circle represents individual data.
Article Snippet: The sequences of oligonucleotides are shown: −156/−120 CSE wild type (WT) 5′-CGGTCGCGGTGACGTTTCAGGCAACGCCTCTGCTGT-3′ Antioxidants 2022, 11, 1582 4 of 12 3′-GCCAGCGCCACTGCAAAGTCCGTTGCGGAGACGACA-5′ −156/−120 CSE mutant (M) 5′-CGGTCGCGGGTCAGTGTCAGGCAACGCCTCTGCTGT-3′ 3′-GCCAGCGCCCAGTCACAGTCCGTTGCGGAGACGACA-5′ Commercially available purified human
Techniques: Activity Assay, Infection, Expressing, Transfection, Plasmid Preparation, Control, Luciferase
Journal: Antioxidants (Basel, Switzerland)
Article Title: NRF2 Regulates Cystathionine Gamma-Lyase Expression and Activity in Primary Airway Epithelial Cells Infected with Respiratory Syncytial Virus.
doi: 10.3390/antiox11081582
Figure Lengend Snippet: Figure 3. Effects of 5’ deletions in the CSE promoter sequence on NRF2-inducible activity. Schematic representation of the CSE promoter deletion constructs. Numbering is relative to transcription initiation site (+1) (A). iSAE cells were co-transfected with the CSE-PGL4-Luc deletion mutants and Renilla-Luc plasmid plus either the empty vector or the NRF2 expression vector and harvested 48 h later to measure luciferase activity. Luciferase activity was normalized to Renilla luciferase activity. Results are expressed as mean ± SEM of triplicate determination of a representative experiment repeated twice and expressed as fold change relative to empty vector. * p < 0.05 relative to −973-PGL4- Luc (B). iSAE cells were co-transfected with the CSE-PGL4-Luc deletion mutants and Renilla-Luc plasmid for 24 h. Cells were left untreated or treated with tBHQ (25 µM) for 15 h before harvesting to measure luciferase activity. Luciferase activity was normalized to Renilla luciferase activity. Results are expressed as mean ± SEM of triplicate determination of a representative experiment repeated twice and expressed as fold change relative to control. * p < 0.05 relative to control cells (C). Each circle represents individual data.
Article Snippet: The sequences of oligonucleotides are shown: −156/−120 CSE wild type (WT) 5′-CGGTCGCGGTGACGTTTCAGGCAACGCCTCTGCTGT-3′ Antioxidants 2022, 11, 1582 4 of 12 3′-GCCAGCGCCACTGCAAAGTCCGTTGCGGAGACGACA-5′ −156/−120 CSE mutant (M) 5′-CGGTCGCGGGTCAGTGTCAGGCAACGCCTCTGCTGT-3′ 3′-GCCAGCGCCCAGTCACAGTCCGTTGCGGAGACGACA-5′ Commercially available purified human
Techniques: Sequencing, Activity Assay, Construct, Transfection, Plasmid Preparation, Expressing, Luciferase, Control
Journal: Antioxidants (Basel, Switzerland)
Article Title: NRF2 Regulates Cystathionine Gamma-Lyase Expression and Activity in Primary Airway Epithelial Cells Infected with Respiratory Syncytial Virus.
doi: 10.3390/antiox11081582
Figure Lengend Snippet: Figure 4. Effects of site mutations in the CSE promoter sequence on NRF2-inducible activity. Schematic representation of the CSE promoter site mutation constructs. Numbering is relative to transcription initiation site. Four segments of nine nucleotides for each of the 36 base pair regions of the CSE promoter comprised between nt −156 and −120 were mutated separately (mutation sites shown in italic underlined) (A). iSAE cells were co-transfected with the wild type (WT) −250-CSE- PGL4-Luc or the site mutants (M1 to M4) and Renilla-Luc plasmid plus either the empty vector or the NRF2 expression vector and harvested 48 h later to measure luciferase activity. Luciferase activity was normalized to Renilla luciferase activity. Results are expressed as mean ± SEM of triplicate determination of a representative experiment repeated twice and expressed as fold change relative to empty vector (each circle represents individual data). * p < 0.05 relative to WT PGL4-Luc (B). Nucleotide comparison of putative CSE antioxidant response element (ARE) with canonical (NQO1) and non-canonical (heme oxigenase-1, HO-1 and HSF1) ARE sites (C).
Article Snippet: The sequences of oligonucleotides are shown: −156/−120 CSE wild type (WT) 5′-CGGTCGCGGTGACGTTTCAGGCAACGCCTCTGCTGT-3′ Antioxidants 2022, 11, 1582 4 of 12 3′-GCCAGCGCCACTGCAAAGTCCGTTGCGGAGACGACA-5′ −156/−120 CSE mutant (M) 5′-CGGTCGCGGGTCAGTGTCAGGCAACGCCTCTGCTGT-3′ 3′-GCCAGCGCCCAGTCACAGTCCGTTGCGGAGACGACA-5′ Commercially available purified human
Techniques: Sequencing, Activity Assay, Mutagenesis, Construct, Transfection, Plasmid Preparation, Expressing, Luciferase, Comparison
Journal: Antioxidants (Basel, Switzerland)
Article Title: NRF2 Regulates Cystathionine Gamma-Lyase Expression and Activity in Primary Airway Epithelial Cells Infected with Respiratory Syncytial Virus.
doi: 10.3390/antiox11081582
Figure Lengend Snippet: Figure 5. EMSA of CSE putative ARE binding complexes in response to tBHQ treatment. Nuclear extracts (6 µg) from control and SAE cells treated with tBHQ (25 µM) for 15 h were used in EMSA. Two DNA–protein complexes, C1 and C2, are detected in control cells. C2 binding is further increased by tBHQ treatment (A). Similar complex formation is observed with purified recombinant NRF2 (rNRF2) (B). Competition assay using wild type (WT) and mutant (M) oligos (50×) and nuclear extracts of tBHQ-treated SAE cells (C). Super-shift assay with specific anti-NRF2 antibody and control IgG using nuclear extracts of tBHQ-treated SAE cells (D).
Article Snippet: The sequences of oligonucleotides are shown: −156/−120 CSE wild type (WT) 5′-CGGTCGCGGTGACGTTTCAGGCAACGCCTCTGCTGT-3′ Antioxidants 2022, 11, 1582 4 of 12 3′-GCCAGCGCCACTGCAAAGTCCGTTGCGGAGACGACA-5′ −156/−120 CSE mutant (M) 5′-CGGTCGCGGGTCAGTGTCAGGCAACGCCTCTGCTGT-3′ 3′-GCCAGCGCCCAGTCACAGTCCGTTGCGGAGACGACA-5′ Commercially available purified human
Techniques: Binding Assay, Control, Recombinant, Competitive Binding Assay, Mutagenesis, Super-Shift Assay
Journal: Antioxidants (Basel, Switzerland)
Article Title: NRF2 Regulates Cystathionine Gamma-Lyase Expression and Activity in Primary Airway Epithelial Cells Infected with Respiratory Syncytial Virus.
doi: 10.3390/antiox11081582
Figure Lengend Snippet: Figure 6. ChIP assay of endogenous CSE and NQO1 promoters. Chromatin from primary SAE cells infected with RSV for 20 h or treated with 25 µM tBHQ for 15 h was immunoprecipitated with anti-NRF2 antibody or IgG as negative control. qPCR was performed with immunoprecipi- tated DNA using primers spanning either the putative ARE site of the CSE promoter (A) or the NQO1 promoter (B). Fold change was calculated compared to IgG control. Data are expressed as mean ± SEM of three or four replicate data from two independent experiments (each circle represents individual data). * p < 0.05 relative to control cells.
Article Snippet: The sequences of oligonucleotides are shown: −156/−120 CSE wild type (WT) 5′-CGGTCGCGGTGACGTTTCAGGCAACGCCTCTGCTGT-3′ Antioxidants 2022, 11, 1582 4 of 12 3′-GCCAGCGCCACTGCAAAGTCCGTTGCGGAGACGACA-5′ −156/−120 CSE mutant (M) 5′-CGGTCGCGGGTCAGTGTCAGGCAACGCCTCTGCTGT-3′ 3′-GCCAGCGCCCAGTCACAGTCCGTTGCGGAGACGACA-5′ Commercially available purified human
Techniques: Infection, Immunoprecipitation, Negative Control, Control