human caveolin 1 Search Results


86
Miltenyi Biotec mouse anti egfp antibody
Mouse Anti Egfp Antibody, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+caveolin+1/Caveolin-1+Antibody%2C+anti-human%2C+REAdye_lease/10__1186_slash_1743___422x___7___108-255-10-28
Average 86 stars, based on 1 article reviews
mouse anti egfp antibody - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

92
R&D Systems anti cave1
Anti Cave1, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+caveolin+1/Human%2FMouse%2FRat+Caveolin-1+Antibody/pmc08492349-257-40-41
Average 92 stars, based on 1 article reviews
anti cave1 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

90
OriGene human cav1 2
Human Cav1 2, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+caveolin+1/Caveolin+1+(CAV1)+(NM_001172896)+Human+Tagged+ORF+Clone/pm20169111-220-0-5
Average 90 stars, based on 1 article reviews
human cav1 2 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
OriGene cav1 cdna null
<t>Cav1</t> and TRPC1 protein expression in gastric mucosa isolated from Cav1 −/− mice and control wild‐type littermates. Levels of Cav1 and TRPC1 were examined by western blot analysis. Actin immunoblotting was performed as an internal control for equal loading. Three separate experiments were performed that showed similar results.
Cav1 Cdna Null, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+caveolin+1/Caveolin+1+(CAV1)+(NM_001172895)+Human+Untagged+Clone/pmc04255804-70-29-35
Average 90 stars, based on 1 article reviews
cav1 cdna null - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Novus Biologicals recombinant wild type caveolin 1
<t>Cav1</t> and TRPC1 protein expression in gastric mucosa isolated from Cav1 −/− mice and control wild‐type littermates. Levels of Cav1 and TRPC1 were examined by western blot analysis. Actin immunoblotting was performed as an internal control for equal loading. Three separate experiments were performed that showed similar results.
Recombinant Wild Type Caveolin 1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+caveolin+1/Recombinant+Human+Caveolin-1+GST+(N-Term)+Protein/pmc05640814-237-19-26
Average 90 stars, based on 1 article reviews
recombinant wild type caveolin 1 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
R&D Systems ic5736g goat anti human tnfrsf9 r
<t>Cav1</t> and TRPC1 protein expression in gastric mucosa isolated from Cav1 −/− mice and control wild‐type littermates. Levels of Cav1 and TRPC1 were examined by western blot analysis. Actin immunoblotting was performed as an internal control for equal loading. Three separate experiments were performed that showed similar results.
Ic5736g Goat Anti Human Tnfrsf9 R, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+caveolin+1/Human%2FMouse%2FRat+Caveolin-1+Alexa+Fluor%C2%AE+488-conjugated+Antibody/pm31402260-202-88-92
Average 93 stars, based on 1 article reviews
ic5736g goat anti human tnfrsf9 r - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Elabscience Biotechnology e el h0673
<t>Cav1</t> and TRPC1 protein expression in gastric mucosa isolated from Cav1 −/− mice and control wild‐type littermates. Levels of Cav1 and TRPC1 were examined by western blot analysis. Actin immunoblotting was performed as an internal control for equal loading. Three separate experiments were performed that showed similar results.
E El H0673, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+caveolin+1/Human+Cav-1+(Caveolin-1)+ELISA+Kit/pmc12384931-53-17-18
Average 93 stars, based on 1 article reviews
e el h0673 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

91
OriGene ccaaggagatcgacctggtcaa origene technologies hp205553 human cav1 r
<t>Cav1</t> and TRPC1 protein expression in gastric mucosa isolated from Cav1 −/− mice and control wild‐type littermates. Levels of Cav1 and TRPC1 were examined by western blot analysis. Actin immunoblotting was performed as an internal control for equal loading. Three separate experiments were performed that showed similar results.
Ccaaggagatcgacctggtcaa Origene Technologies Hp205553 Human Cav1 R, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+caveolin+1/Caveolin+1+(CAV1)+Human+qPCR+Primer+Pair/pm37541209-216-88-89
Average 91 stars, based on 1 article reviews
ccaaggagatcgacctggtcaa origene technologies hp205553 human cav1 r - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

91
Cusabio human caveolin 1 elisa kit
<t>Cav1</t> and TRPC1 protein expression in gastric mucosa isolated from Cav1 −/− mice and control wild‐type littermates. Levels of Cav1 and TRPC1 were examined by western blot analysis. Actin immunoblotting was performed as an internal control for equal loading. Three separate experiments were performed that showed similar results.
Human Caveolin 1 Elisa Kit, supplied by Cusabio, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+caveolin+1/Human+Caveolin-1%2CCav-1+ELISA+KIT/10__5152_slash_jarem__2019__2300-105-5-14
Average 91 stars, based on 1 article reviews
human caveolin 1 elisa kit - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

93
R&D Systems antibody anti goat human cav 1
a Western blot expression of <t>CAV-1</t> (21–24 kDa) and MMP-9 (65–92 kDa) identified in diseased and non-cancer colon tissues NC: non-cancer normal colon lining, NAP non-adenomatous colon polyp, CC NM colon cancer (non-metastatic), CC M colon cancer (metastatic), I–III TNM staging according to AJCC 8th Edition guidelines. b Box and whisker plot of the CAV-1 expression by western blotting versus normal colon or disease stage
Antibody Anti Goat Human Cav 1, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+caveolin+1/Human+Caveolin-1+Antibody/pmc06935225-218-30-34
Average 93 stars, based on 1 article reviews
antibody anti goat human cav 1 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
OriGene caveolin1 shrna
a Western blot expression of <t>CAV-1</t> (21–24 kDa) and MMP-9 (65–92 kDa) identified in diseased and non-cancer colon tissues NC: non-cancer normal colon lining, NAP non-adenomatous colon polyp, CC NM colon cancer (non-metastatic), CC M colon cancer (metastatic), I–III TNM staging according to AJCC 8th Edition guidelines. b Box and whisker plot of the CAV-1 expression by western blotting versus normal colon or disease stage
Caveolin1 Shrna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+caveolin+1/Caveolin+1+(CAV1)+Human+shRNA+Lentiviral+Particle/pmc04737895__ncomms10523___s1-212-0-5
Average 90 stars, based on 1 article reviews
caveolin1 shrna - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
R&D Systems goat anti cav1
a Western blot expression of <t>CAV-1</t> (21–24 kDa) and MMP-9 (65–92 kDa) identified in diseased and non-cancer colon tissues NC: non-cancer normal colon lining, NAP non-adenomatous colon polyp, CC NM colon cancer (non-metastatic), CC M colon cancer (metastatic), I–III TNM staging according to AJCC 8th Edition guidelines. b Box and whisker plot of the CAV-1 expression by western blotting versus normal colon or disease stage
Goat Anti Cav1, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+caveolin+1/Human+Caveolin-1+Antibody/pmc04152152-187-3-6
Average 93 stars, based on 1 article reviews
goat anti cav1 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

Image Search Results


Cav1 and TRPC1 protein expression in gastric mucosa isolated from Cav1 −/− mice and control wild‐type littermates. Levels of Cav1 and TRPC1 were examined by western blot analysis. Actin immunoblotting was performed as an internal control for equal loading. Three separate experiments were performed that showed similar results.

Journal: Physiological Reports

Article Title: Caveolin‐1 enhances rapid mucosal restitution by activating TRPC1‐mediated Ca 2+ signaling

doi: 10.14814/phy2.12193

Figure Lengend Snippet: Cav1 and TRPC1 protein expression in gastric mucosa isolated from Cav1 −/− mice and control wild‐type littermates. Levels of Cav1 and TRPC1 were examined by western blot analysis. Actin immunoblotting was performed as an internal control for equal loading. Three separate experiments were performed that showed similar results.

Article Snippet: The transfection grade eukaryotic expression vector pCMV6‐Neo containing the full‐length cDNA of human Cav1 (~2.4 kb) gene under the control of cytomegalovirus (CMV) promoter and its control vector lacking Cav1 cDNA (Null) were purchased from Origene Technologies (Rockville, MD).

Techniques: Expressing, Isolation, Control, Western Blot

Levels of Cav1, TRPC1, and their complexes in gastric mucosa after hypertonic NaCl‐induced injury in mice. After cell lysates (500 μ g) were immunoprecipitated (IP) by the specific Ab against TRPC1, precipitates were subjected to SDS‐PAGE (10% acrylamide). Levels of Cav1 and TRPC1 proteins were measured using western blot analysis with the antibody against Cav1 or TRPC1. Three separate experiments were performed that showed similar results.

Journal: Physiological Reports

Article Title: Caveolin‐1 enhances rapid mucosal restitution by activating TRPC1‐mediated Ca 2+ signaling

doi: 10.14814/phy2.12193

Figure Lengend Snippet: Levels of Cav1, TRPC1, and their complexes in gastric mucosa after hypertonic NaCl‐induced injury in mice. After cell lysates (500 μ g) were immunoprecipitated (IP) by the specific Ab against TRPC1, precipitates were subjected to SDS‐PAGE (10% acrylamide). Levels of Cav1 and TRPC1 proteins were measured using western blot analysis with the antibody against Cav1 or TRPC1. Three separate experiments were performed that showed similar results.

Article Snippet: The transfection grade eukaryotic expression vector pCMV6‐Neo containing the full‐length cDNA of human Cav1 (~2.4 kb) gene under the control of cytomegalovirus (CMV) promoter and its control vector lacking Cav1 cDNA (Null) were purchased from Origene Technologies (Rockville, MD).

Techniques: Immunoprecipitation, SDS Page, Western Blot

Levels of Cav1 and its interaction with TRPC1 in different lines of IECs. (A) representative immunoblot of Cav1 in IEC‐6 cells, differentiated IEC‐Cdx2L1 cells, and IECs stably overexpressing TRPC1 (IEC‐TRPC1). Levels of total Cav1 were examined by western blot analysis, and actin immunoblotting was performed as an internal control for equal loading (upper panel). Quantitative analysis of western immunoblots by densitometry that were corrected for actin loading from cells described above. Values are means ± SEM; P < 0.05 compared with parental IEC‐6 cells (lower panel). (B) levels of Cav1 and TRPC1 in the complex IP by the anti‐Cav1 or anti‐TRPC1 Ab in cells described in (A). Three separate experiments were performed that showed similar results.

Journal: Physiological Reports

Article Title: Caveolin‐1 enhances rapid mucosal restitution by activating TRPC1‐mediated Ca 2+ signaling

doi: 10.14814/phy2.12193

Figure Lengend Snippet: Levels of Cav1 and its interaction with TRPC1 in different lines of IECs. (A) representative immunoblot of Cav1 in IEC‐6 cells, differentiated IEC‐Cdx2L1 cells, and IECs stably overexpressing TRPC1 (IEC‐TRPC1). Levels of total Cav1 were examined by western blot analysis, and actin immunoblotting was performed as an internal control for equal loading (upper panel). Quantitative analysis of western immunoblots by densitometry that were corrected for actin loading from cells described above. Values are means ± SEM; P < 0.05 compared with parental IEC‐6 cells (lower panel). (B) levels of Cav1 and TRPC1 in the complex IP by the anti‐Cav1 or anti‐TRPC1 Ab in cells described in (A). Three separate experiments were performed that showed similar results.

Article Snippet: The transfection grade eukaryotic expression vector pCMV6‐Neo containing the full‐length cDNA of human Cav1 (~2.4 kb) gene under the control of cytomegalovirus (CMV) promoter and its control vector lacking Cav1 cDNA (Null) were purchased from Origene Technologies (Rockville, MD).

Techniques: Western Blot, Stable Transfection, Control

Effect of Cav1 silencing on Cav1/TRPC1 complex, SOCE, and cell migration in stable IEC‐TRPC1 cells. (Aa) representative Cav1 and TRPC1 immunoblots. After cells were transfected with either siRNA targeting the Cav1 mRNA coding region (siCav1) or control siRNA (C‐siRNA) for 24 and 48 h, whole‐cell lysates were harvested for western blot analysis to monitor the expression of Cav1, TRPC1 and loading control actin. (Ab) changes in the levels of Cav1/TRPC1 protein in the complex IP by anti‐TRPC1 antibody in cells described in (Aa). (B) representative records showing the time course of [Ca 2+ ] cyt changes after exposure to 10 μ mol/L cyclopiazonic acid (CPA) in the absence (0Ca 2+ ) or presence of extracellular Ca 2+ in parent IEC‐6 cells and IEC‐TRPC1 cells transfected with C‐siRNA or siCav1 for 48 h. (C) summarized data showing resting [Ca 2+ ] cyt ( left ) and the amplitude of CPA‐induced Ca 2+ influx ( right ) from cells described in (B). Values are means ± SEM; n = 25. * P < 0.05 compared with parent IEC‐6 cells; + P < 0.05 compared with cells transfected with C‐siRNA. (D) images of cell migration after wounding: (a) 0 h after wounding; (b) 6 h after wounding in parent IEC‐6 cells; (c) 6 h after wounding in IEC‐TRPC1 cells transfected with C‐siRNA; and (d) 6 h after wounding in IEC‐TRPC1 cells transfected with siCav1 for 48 h. (E) summarized data showing rates of cell migration after wounding in cells described in (D). Data were expressed as means ± SEM from six dishes. * P < 0.05 compared with parent IEC‐6 cells; + P < 0.05 compared with cells transfected with C‐siRNA.

Journal: Physiological Reports

Article Title: Caveolin‐1 enhances rapid mucosal restitution by activating TRPC1‐mediated Ca 2+ signaling

doi: 10.14814/phy2.12193

Figure Lengend Snippet: Effect of Cav1 silencing on Cav1/TRPC1 complex, SOCE, and cell migration in stable IEC‐TRPC1 cells. (Aa) representative Cav1 and TRPC1 immunoblots. After cells were transfected with either siRNA targeting the Cav1 mRNA coding region (siCav1) or control siRNA (C‐siRNA) for 24 and 48 h, whole‐cell lysates were harvested for western blot analysis to monitor the expression of Cav1, TRPC1 and loading control actin. (Ab) changes in the levels of Cav1/TRPC1 protein in the complex IP by anti‐TRPC1 antibody in cells described in (Aa). (B) representative records showing the time course of [Ca 2+ ] cyt changes after exposure to 10 μ mol/L cyclopiazonic acid (CPA) in the absence (0Ca 2+ ) or presence of extracellular Ca 2+ in parent IEC‐6 cells and IEC‐TRPC1 cells transfected with C‐siRNA or siCav1 for 48 h. (C) summarized data showing resting [Ca 2+ ] cyt ( left ) and the amplitude of CPA‐induced Ca 2+ influx ( right ) from cells described in (B). Values are means ± SEM; n = 25. * P < 0.05 compared with parent IEC‐6 cells; + P < 0.05 compared with cells transfected with C‐siRNA. (D) images of cell migration after wounding: (a) 0 h after wounding; (b) 6 h after wounding in parent IEC‐6 cells; (c) 6 h after wounding in IEC‐TRPC1 cells transfected with C‐siRNA; and (d) 6 h after wounding in IEC‐TRPC1 cells transfected with siCav1 for 48 h. (E) summarized data showing rates of cell migration after wounding in cells described in (D). Data were expressed as means ± SEM from six dishes. * P < 0.05 compared with parent IEC‐6 cells; + P < 0.05 compared with cells transfected with C‐siRNA.

Article Snippet: The transfection grade eukaryotic expression vector pCMV6‐Neo containing the full‐length cDNA of human Cav1 (~2.4 kb) gene under the control of cytomegalovirus (CMV) promoter and its control vector lacking Cav1 cDNA (Null) were purchased from Origene Technologies (Rockville, MD).

Techniques: Migration, Western Blot, Transfection, Control, Expressing

Effect of ectopic overexpression of Cav1 on the levels of Cav1, SOCE, and cell migration after wounding. (Aa) structure of expression vector. (Ab) representative Cav1 and TRPC1 immunoblots in two different clones (C1 and C2) of stable Cav1‐transfected cells (IEC‐Cav1). IEC‐6 cells were transfected with the Cav1 expression vector or control empty vector (Null), and clones resistant to the selection medium containing 0.6 mg/mL G418 were isolated and screened for Cav1 and TRPC1 expression. (Ac) changes in the levels of Cav1 and TRPC1 in the complex IPed by anti‐Cav1 Ab in cells described in (Ab). Levels of TRPC1 and Cav1 were measured using western blot analysis. (B) representative records showing the time course of [Ca 2+ ] cyt changes after exposure to 10 μ mol/L CPA in the absence (0Ca 2+ ) or presence of extracellular Ca 2+ in cells described in (Ab). (C) summarized data showing resting [Ca 2+ ] cyt ( left ) and the amplitude of CPA‐induced Ca 2+ influx ( right ) from cells described in (B). Values are means ± SEM; n = 25. * P < 0.05 compared with cells transfected with the Null. (D) summarized data showing cell migration 6 h after wounding in cells described in (Ab). Values are means ± SEM from six dishes. * P < 0.05 compared with cells transfected with the Null.

Journal: Physiological Reports

Article Title: Caveolin‐1 enhances rapid mucosal restitution by activating TRPC1‐mediated Ca 2+ signaling

doi: 10.14814/phy2.12193

Figure Lengend Snippet: Effect of ectopic overexpression of Cav1 on the levels of Cav1, SOCE, and cell migration after wounding. (Aa) structure of expression vector. (Ab) representative Cav1 and TRPC1 immunoblots in two different clones (C1 and C2) of stable Cav1‐transfected cells (IEC‐Cav1). IEC‐6 cells were transfected with the Cav1 expression vector or control empty vector (Null), and clones resistant to the selection medium containing 0.6 mg/mL G418 were isolated and screened for Cav1 and TRPC1 expression. (Ac) changes in the levels of Cav1 and TRPC1 in the complex IPed by anti‐Cav1 Ab in cells described in (Ab). Levels of TRPC1 and Cav1 were measured using western blot analysis. (B) representative records showing the time course of [Ca 2+ ] cyt changes after exposure to 10 μ mol/L CPA in the absence (0Ca 2+ ) or presence of extracellular Ca 2+ in cells described in (Ab). (C) summarized data showing resting [Ca 2+ ] cyt ( left ) and the amplitude of CPA‐induced Ca 2+ influx ( right ) from cells described in (B). Values are means ± SEM; n = 25. * P < 0.05 compared with cells transfected with the Null. (D) summarized data showing cell migration 6 h after wounding in cells described in (Ab). Values are means ± SEM from six dishes. * P < 0.05 compared with cells transfected with the Null.

Article Snippet: The transfection grade eukaryotic expression vector pCMV6‐Neo containing the full‐length cDNA of human Cav1 (~2.4 kb) gene under the control of cytomegalovirus (CMV) promoter and its control vector lacking Cav1 cDNA (Null) were purchased from Origene Technologies (Rockville, MD).

Techniques: Over Expression, Migration, Expressing, Plasmid Preparation, Western Blot, Clone Assay, Transfection, Control, Selection, Isolation

a Western blot expression of CAV-1 (21–24 kDa) and MMP-9 (65–92 kDa) identified in diseased and non-cancer colon tissues NC: non-cancer normal colon lining, NAP non-adenomatous colon polyp, CC NM colon cancer (non-metastatic), CC M colon cancer (metastatic), I–III TNM staging according to AJCC 8th Edition guidelines. b Box and whisker plot of the CAV-1 expression by western blotting versus normal colon or disease stage

Journal: Clinical Proteomics

Article Title: Proteomics analysis of colon cancer progression

doi: 10.1186/s12014-019-9264-y

Figure Lengend Snippet: a Western blot expression of CAV-1 (21–24 kDa) and MMP-9 (65–92 kDa) identified in diseased and non-cancer colon tissues NC: non-cancer normal colon lining, NAP non-adenomatous colon polyp, CC NM colon cancer (non-metastatic), CC M colon cancer (metastatic), I–III TNM staging according to AJCC 8th Edition guidelines. b Box and whisker plot of the CAV-1 expression by western blotting versus normal colon or disease stage

Article Snippet: Blotted membranes were blocked with 5% skimmed milk solution in 20 mM Tris; pH 7.5, 150 mM NaCl, 0.1% Tween-20 (TBST) for 45 min at room temperature, incubated with primary antibody [anti-goat human CAV-1 (R&D Systems, Abingdon, UK, 1:2000 dilution), anti-mouse human MMP-9 (R&D Systems, Minneapolis, USA, 4:1000 dilution or rabbit anti-human β-Actin (Abcam, Cambridge, UK, 1:1000 dilution)] overnight at 4 °C and washed 3 times with TBST.

Techniques: Western Blot, Expressing, Whisker Assay