90
|
OriginLab corp
originpro Originpro, supplied by OriginLab corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/heatmap+generated+using+graphpad+prism+9/originpro/pm39174872-43-12-13 Average 90 stars, based on 1 article reviews
originpro - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
86
|
Synthego Inc
resource source identifier oligonucleotides gccgtttaagaagatccctg Resource Source Identifier Oligonucleotides Gccgtttaagaagatccctg, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/heatmap+generated+using+graphpad+prism+9/gccgtttaagaagatccctg+identifier+oligonucleotides+resource+source/pm37330910-206-2-10 Average 86 stars, based on 1 article reviews
resource source identifier oligonucleotides gccgtttaagaagatccctg - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
99
|
Qiagen
dneasy blood and tissue kit Dneasy Blood And Tissue Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/heatmap+generated+using+graphpad+prism+9/DNeasy+Blood+%26+Tissue+Kit/pm36990294-106-14-20 Average 99 stars, based on 1 article reviews
dneasy blood and tissue kit - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
93
|
Addgene inc
bvu 1163 Bvu 1163, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/heatmap+generated+using+graphpad+prism+9/His-GIV-CTs+(Plasmid+%2369864)/pm35120663-251-74-70 Average 93 stars, based on 1 article reviews
bvu 1163 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
93
|
Addgene inc
ptetr p1t Ptetr P1t, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/heatmap+generated+using+graphpad+prism+9/pNBU2_erm-TetR-P1T_DP-GH023+(Plasmid+%2390324)/pm35120663-251-73-70 Average 93 stars, based on 1 article reviews
ptetr p1t - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
91
|
Addgene inc
phiv 1 nl4 3δenv luc dr paul bieniasz na pcdna spike d614g Phiv 1 Nl4 3δenv Luc Dr Paul Bieniasz Na Pcdna Spike D614g, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/heatmap+generated+using+graphpad+prism+9/mClY-N1+(Plasmid+%2390457)/ppr0553017-536-102-100 Average 91 stars, based on 1 article reviews
phiv 1 nl4 3δenv luc dr paul bieniasz na pcdna spike d614g - by Bioz Stars,
2026-09
91/100 stars
|
Buy from Supplier |
86
|
Microbiologics Inc
virus strains a549 atcc ccl 185 mdck ii atcc crl 2936 hek293t atcc crl 3216 hek293t hace 2 bei resources nr52511 vero e6 nccs pune Virus Strains A549 Atcc Ccl 185 Mdck Ii Atcc Crl 2936 Hek293t Atcc Crl 3216 Hek293t Hace 2 Bei Resources Nr52511 Vero E6 Nccs Pune, supplied by Microbiologics Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/heatmap+generated+using+graphpad+prism+9/185+2+2936+3216+a549+atcc+atcc+atcc+bei+ccl+crl+crl+e6+hace+hek293t+hek293t+ii+mdck+nccs+nr52511+pune+resources+strains+vero+virus/ppr0553017-536-5-28 Average 86 stars, based on 1 article reviews
virus strains a549 atcc ccl 185 mdck ii atcc crl 2936 hek293t atcc crl 3216 hek293t hace 2 bei resources nr52511 vero e6 nccs pune - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
86
|
Hooke Laboratories
adjuvant ifa hooke laboratories Adjuvant Ifa Hooke Laboratories, supplied by Hooke Laboratories, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/heatmap+generated+using+graphpad+prism+9/adjuvant+hooke+ifa+laboratories/pm40581928-681-143-145 Average 86 stars, based on 1 article reviews
adjuvant ifa hooke laboratories - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |