Journal: Mediators of Inflammation

Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition

doi: 10.1155/2019/1625381

Figure Lengend Snippet: The expression levels of CDR1as in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.

Article Snippet: The expression plasmid for expressing CDR1as sequence was DNA3.1(+) CircRNA Mini Vector, a gift from Jeremy Wilusz (Addgene plasmid # 60648).

Techniques: Expressing, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Control

Journal: Mediators of Inflammation

Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition

doi: 10.1155/2019/1625381

Figure Lengend Snippet: circRNA CDR1as mediated LPS-induced inhibition of PDLSC proliferation. (a) A standard curve of cell proliferation and mathematical formula describing OD value and cell number. Cell proliferation of PDLSCs was assessed by CCK-8 assay as indicated with cell numbers in reference to this standard curve obtained under the same conditions in all subsequent experiments. (b) Cell number of LPS-treated PDLSCs was less than that of untreated cells at each examined day, ∗ p < 0.01. (c) The efficiency of knockdown of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. si-NC. (d) The effects of knockdown of CDR1as on the proliferation of PDLSCs. ∗ p < 0.01 vs. control. (e) The efficiency of overexpression of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. over-NC. (f) The effects of overexpression of CDR1as on the proliferation of PDLSCs, ∗ p < 0.01 vs. control.

Article Snippet: The expression plasmid for expressing CDR1as sequence was DNA3.1(+) CircRNA Mini Vector, a gift from Jeremy Wilusz (Addgene plasmid # 60648).

Techniques: Inhibition, CCK-8 Assay, Knockdown, Quantitative RT-PCR, Control, Over Expression

Journal: Mediators of Inflammation

Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition

doi: 10.1155/2019/1625381

Figure Lengend Snippet: CDR1as/miR-7 regulated LPS-induced inhibition of PDLSC proliferation by targeting ERK. (a) The efficiency of transient transduction of miR-7 mimics and miR-7 inhibitor evaluated by RT-qPCR. ∗ p < 0.01 vs. miR-NC. (b) The effects of miR-1 mimic and inhibitor on the proliferation of PDLSCs. After being transfected with miR-NC, miR-7 mimic, or miR-7 inhibitor, PDLSCs were treated with LPS at 10 ng/ μ l for 3 h and cultured for another 3 days with an initial seeding density of 2000 cell/well. Cell proliferation was evaluated by CCK-8 kits. ∗ p < 0.01 vs. miR-NC. (c) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with miR-7 mimic, miR-7 inhibitor, or miR-NC. ∗ p < 0.01 vs. miR-NC. (d) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with siRNA-CDR1as alone or cotransfected with miR-7 inhibit or miR-7 mimic. ∗ p < 0.01 vs. siRNA-CDR1as. (e) The effects of siRNA-CDR1as cotransfected with miR-7 inhibit or miR-7 mimic on the cell proliferation of PDLSCs. ∗ p < 0.05 vs. siRNA-CDR1as.

Article Snippet: The expression plasmid for expressing CDR1as sequence was DNA3.1(+) CircRNA Mini Vector, a gift from Jeremy Wilusz (Addgene plasmid # 60648).

Techniques: Inhibition, Transduction, Quantitative RT-PCR, Transfection, Cell Culture, CCK-8 Assay, Western Blot, Expressing, Control

Journal: Blood Advances

Article Title: Unexpected diagnosis of WHIM syndrome in refractory autoimmune cytopenia

doi: 10.1182/bloodadvances.2024013301

Figure Lengend Snippet: Patient characterization. (A) Serum immunoglobulin titer (IgM and IgG) in P1 show reduced serum IgG and, with IVIG replacement, serum IgM levels dramatically increased. The timing of rituximab and IVIG infusions is shown. (B) Family pedigree. Patients are indicated. (C) Bone marrow aspirate from P1 showing myelokathexis: arrows show degenerative changes and hypersegmentation of mature neutrophils. (D) Schematic representation of signaling pathways activated downstream of the CXCR4 receptor and the effect of the mutations.

Article Snippet: Briefly, cells were transfected with a plasmid expressing a single-guide RNA specific for CXCR4 (GCCGTGGCAAACTGGTACTT), CRISPR–associated protein 9, enhanced green fluorescent protein (GFP), and puromycin (VectorBuilder, VB190718-1161ybg) following the calcium phosphate method (for HEK 293T cells; Sigma-Aldrich), or by electroporation for the NALM6 B cells.

Techniques: Protein-Protein interactions

Journal: Blood Advances

Article Title: Unexpected diagnosis of WHIM syndrome in refractory autoimmune cytopenia

doi: 10.1182/bloodadvances.2024013301

Figure Lengend Snippet: The signaling tail of CXCR4 and position of other mutants

Article Snippet: Briefly, cells were transfected with a plasmid expressing a single-guide RNA specific for CXCR4 (GCCGTGGCAAACTGGTACTT), CRISPR–associated protein 9, enhanced green fluorescent protein (GFP), and puromycin (VectorBuilder, VB190718-1161ybg) following the calcium phosphate method (for HEK 293T cells; Sigma-Aldrich), or by electroporation for the NALM6 B cells.

Techniques:

Journal: Blood Advances

Article Title: Unexpected diagnosis of WHIM syndrome in refractory autoimmune cytopenia

doi: 10.1182/bloodadvances.2024013301

Figure Lengend Snippet: Functional assays in CXCR4 variants: impaired termination of CXCR4 signaling. (A) CXCR4 phosphorylation. HEK-293T cells expressing CXCR4 WT or mutants were stimulated with 100 nM rhCXCL12 for 20 minutes, and 1, 3, and 6 hours, and the whole-cell lysates were analyzed by western blot (WB) to determine CXCR4 phosphorylation (Ser324/325) and total CXCR4 levels; β-actin was used as loading control. Data show a representative WB of 4 independent experiments. (B) Stable WT and mutant CXCR4 NALM6 cells were stimulated with 100 nM rhCXCL12 for 30 minutes, and 1, 3, and 6 hours, and the surface expression of CXCR4 was measured by flow cytometry (left panel). (C) Data are expressed as precent (%) of remaining surface CXCR4. Values represent mean ± standard deviation of 5 independent experiments.

Article Snippet: Briefly, cells were transfected with a plasmid expressing a single-guide RNA specific for CXCR4 (GCCGTGGCAAACTGGTACTT), CRISPR–associated protein 9, enhanced green fluorescent protein (GFP), and puromycin (VectorBuilder, VB190718-1161ybg) following the calcium phosphate method (for HEK 293T cells; Sigma-Aldrich), or by electroporation for the NALM6 B cells.

Techniques: Functional Assay, Phospho-proteomics, Expressing, Western Blot, Control, Mutagenesis, Flow Cytometry, Standard Deviation

Journal: Blood Advances

Article Title: Unexpected diagnosis of WHIM syndrome in refractory autoimmune cytopenia

doi: 10.1182/bloodadvances.2024013301

Figure Lengend Snippet: Functional assays in CXCR4 variants: enhanced receptor activation and prolonged intracellular signaling. (A) cAMP production was determined in stable NALM6 cells expressing WT CXCR4 (CXCR4 WT ) or CXCR4 variants, after 30 minutes of stimulation in the presence of CXCL12; data represent mean ± standard error of the mean (SEM) of 4 independent experiments. (B) NALM6 cells were serum starved for 4 hours and stimulated with 100 nM rhCXCL12 for 10, 20, or 30 minutes, and ERK1/2 phosphorylation (T202/Y204) was measured by flow cytometry and represented as mean fluorescent intensity (MFI) fold change from baseline. Values represent mean ± SEM of 5 independent experiments. Comparisons are made to WT. ∗ P < .05 (2-tailed unpaired Students t test). (C) Calcium mobilization was determined in WT and CXCR4 mutant NALM6 cells. Measurements were taken every second before and after ligand binding, for 2 minutes. Values represent mean ± SEM of 3 experimental triplicates of 5 independent experiments. (D) Right panel shows the area under the curve (AUC) of calcium mobilization, calculated for each cell line. ∗ P < .05; ∗∗ P < .01 (2-tailed unpaired Student t test). (E) Chemotaxis assay in transwells. Data show the fold of migrated cells to the lower chamber for 4 hours compared with WT. (F) NALM6 cells were serum starved for 4 hours and stimulated with 100 nM rhCXCL12 for 10, 20, or 30 minutes, and AKT phosphorylation (S473) was measured by flow cytometry and represented as MFI fold change from baseline. Values represent mean ± SEM of 5 independent experiments. Comparisons are made with WT. ∗ P < .05; ∗∗ P < .01 (2-tailed unpaired Student t test).

Article Snippet: Briefly, cells were transfected with a plasmid expressing a single-guide RNA specific for CXCR4 (GCCGTGGCAAACTGGTACTT), CRISPR–associated protein 9, enhanced green fluorescent protein (GFP), and puromycin (VectorBuilder, VB190718-1161ybg) following the calcium phosphate method (for HEK 293T cells; Sigma-Aldrich), or by electroporation for the NALM6 B cells.

Techniques: Functional Assay, Activation Assay, Expressing, Phospho-proteomics, Flow Cytometry, Mutagenesis, Ligand Binding Assay, Chemotaxis Assay