guide rna lentiviral expression vector Search Results


lentiviral vectors for tetracycline-inducible short hairpin rna expression  (BioResource International Inc)
90
BioResource International Inc lentiviral vectors for tetracycline-inducible short hairpin rna expression
Lentiviral Vectors For Tetracycline Inducible Short Hairpin Rna Expression, supplied by BioResource International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+lentiviral+expression+vector/pmc08114557-47-10-20?v=BioResource+International+Inc
Average 90 stars, based on 1 article reviews
lentiviral vectors for tetracycline-inducible short hairpin rna expression - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
lentiviral vectors for tetracycline (tet)-inducible short hairpin rna (shrna) expression  (BioResource International Inc)
90
BioResource International Inc lentiviral vectors for tetracycline (tet)-inducible short hairpin rna (shrna) expression
LSD2 is essential for BAT differentiation in HB2 cells. A, B) Dox-inducible KD of LSD2. HB2 cells were transduced with tet-inducible shLSD2 (LSD2-KD#1 and #2) or control (shCtr) lentiviral vectors followed by blasticidin selection. Cells were cultured with or without Dox for 48 h. For relative mRNA levels of LSD2 (A), real-time quantitative PCR values were normalized to values for the 36B4 gene and are shown as fold differences against Dox (−). For levels of LSD2 protein (B), β-tubulin was used as a loading control. Values are mean ± sd (n = 3). *P < 0.05, †P < 0.01. C) Oil Red O staining of <t>shRNA-expressing</t> HB2 cells at d 7. Culture details are described in Supplemental Fig. S1A. Scale bars, 100 µm. D) Expression of adipogenesis and BAT-selective genes in shLSD2_#1 cells at indicated days. Quantitative RT-PCR values were normalized to those for the 36B4 gene and are shown as fold differences against Dox (−) at d 0. Values are mean ± sd (n = 3). *P < 0.05, †P < 0.01 vs. Dox (−) at each time point.
Lentiviral Vectors For Tetracycline (Tet) Inducible Short Hairpin Rna (Shrna) Expression, supplied by BioResource International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+lentiviral+expression+vector/pmc06436657-94-11-23?v=BioResource+International+Inc
Average 90 stars, based on 1 article reviews
lentiviral vectors for tetracycline (tet)-inducible short hairpin rna (shrna) expression - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
lentiviral vectors encoding guide rna targeting human cd74  (GenScript corporation)
90
GenScript corporation lentiviral vectors encoding guide rna targeting human cd74
LSD2 is essential for BAT differentiation in HB2 cells. A, B) Dox-inducible KD of LSD2. HB2 cells were transduced with tet-inducible shLSD2 (LSD2-KD#1 and #2) or control (shCtr) lentiviral vectors followed by blasticidin selection. Cells were cultured with or without Dox for 48 h. For relative mRNA levels of LSD2 (A), real-time quantitative PCR values were normalized to values for the 36B4 gene and are shown as fold differences against Dox (−). For levels of LSD2 protein (B), β-tubulin was used as a loading control. Values are mean ± sd (n = 3). *P < 0.05, †P < 0.01. C) Oil Red O staining of <t>shRNA-expressing</t> HB2 cells at d 7. Culture details are described in Supplemental Fig. S1A. Scale bars, 100 µm. D) Expression of adipogenesis and BAT-selective genes in shLSD2_#1 cells at indicated days. Quantitative RT-PCR values were normalized to those for the 36B4 gene and are shown as fold differences against Dox (−) at d 0. Values are mean ± sd (n = 3). *P < 0.05, †P < 0.01 vs. Dox (−) at each time point.
Lentiviral Vectors Encoding Guide Rna Targeting Human Cd74, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+lentiviral+expression+vector/10__1158_slash_0008___5472__can___20___2811-98-12-14?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
lentiviral vectors encoding guide rna targeting human cd74 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
lentiviral vectors expressing a short hairpin rna against vdr  (Shanghai GenePharma)
90
Shanghai GenePharma lentiviral vectors expressing a short hairpin rna against vdr
LSD2 is essential for BAT differentiation in HB2 cells. A, B) Dox-inducible KD of LSD2. HB2 cells were transduced with tet-inducible shLSD2 (LSD2-KD#1 and #2) or control (shCtr) lentiviral vectors followed by blasticidin selection. Cells were cultured with or without Dox for 48 h. For relative mRNA levels of LSD2 (A), real-time quantitative PCR values were normalized to values for the 36B4 gene and are shown as fold differences against Dox (−). For levels of LSD2 protein (B), β-tubulin was used as a loading control. Values are mean ± sd (n = 3). *P < 0.05, †P < 0.01. C) Oil Red O staining of <t>shRNA-expressing</t> HB2 cells at d 7. Culture details are described in Supplemental Fig. S1A. Scale bars, 100 µm. D) Expression of adipogenesis and BAT-selective genes in shLSD2_#1 cells at indicated days. Quantitative RT-PCR values were normalized to those for the 36B4 gene and are shown as fold differences against Dox (−) at d 0. Values are mean ± sd (n = 3). *P < 0.05, †P < 0.01 vs. Dox (−) at each time point.
Lentiviral Vectors Expressing A Short Hairpin Rna Against Vdr, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+lentiviral+expression+vector/pm27561793-68-0-16?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
lentiviral vectors expressing a short hairpin rna against vdr - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
lentiviral vector expressing short hairpin rna against panx3 (shpanx3, ggcaggcagagcaacttagtaagagattaataaggatatga) and its negative control (shnc)  (VectorBuilder GmbH)
90
VectorBuilder GmbH lentiviral vector expressing short hairpin rna against panx3 (shpanx3, ggcaggcagagcaacttagtaagagattaataaggatatga) and its negative control (shnc)
LSD2 is essential for BAT differentiation in HB2 cells. A, B) Dox-inducible KD of LSD2. HB2 cells were transduced with tet-inducible shLSD2 (LSD2-KD#1 and #2) or control (shCtr) lentiviral vectors followed by blasticidin selection. Cells were cultured with or without Dox for 48 h. For relative mRNA levels of LSD2 (A), real-time quantitative PCR values were normalized to values for the 36B4 gene and are shown as fold differences against Dox (−). For levels of LSD2 protein (B), β-tubulin was used as a loading control. Values are mean ± sd (n = 3). *P < 0.05, †P < 0.01. C) Oil Red O staining of <t>shRNA-expressing</t> HB2 cells at d 7. Culture details are described in Supplemental Fig. S1A. Scale bars, 100 µm. D) Expression of adipogenesis and BAT-selective genes in shLSD2_#1 cells at indicated days. Quantitative RT-PCR values were normalized to those for the 36B4 gene and are shown as fold differences against Dox (−) at d 0. Values are mean ± sd (n = 3). *P < 0.05, †P < 0.01 vs. Dox (−) at each time point.
Lentiviral Vector Expressing Short Hairpin Rna Against Panx3 (Shpanx3, Ggcaggcagagcaacttagtaagagattaataaggatatga) And Its Negative Control (Shnc), supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+lentiviral+expression+vector/pm37021698-54-12-18?v=VectorBuilder+GmbH
Average 90 stars, based on 1 article reviews
lentiviral vector expressing short hairpin rna against panx3 (shpanx3, ggcaggcagagcaacttagtaagagattaataaggatatga) and its negative control (shnc) - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


LSD2 is essential for BAT differentiation in HB2 cells. A, B) Dox-inducible KD of LSD2. HB2 cells were transduced with tet-inducible shLSD2 (LSD2-KD#1 and #2) or control (shCtr) lentiviral vectors followed by blasticidin selection. Cells were cultured with or without Dox for 48 h. For relative mRNA levels of LSD2 (A), real-time quantitative PCR values were normalized to values for the 36B4 gene and are shown as fold differences against Dox (−). For levels of LSD2 protein (B), β-tubulin was used as a loading control. Values are mean ± sd (n = 3). *P < 0.05, †P < 0.01. C) Oil Red O staining of shRNA-expressing HB2 cells at d 7. Culture details are described in Supplemental Fig. S1A. Scale bars, 100 µm. D) Expression of adipogenesis and BAT-selective genes in shLSD2_#1 cells at indicated days. Quantitative RT-PCR values were normalized to those for the 36B4 gene and are shown as fold differences against Dox (−) at d 0. Values are mean ± sd (n = 3). *P < 0.05, †P < 0.01 vs. Dox (−) at each time point.

Journal: The FASEB Journal

Article Title: Lysine-specific demethylase-2 is distinctively involved in brown and beige adipogenic differentiation

doi: 10.1096/fj.201801422RR

Figure Lengend Snippet: LSD2 is essential for BAT differentiation in HB2 cells. A, B) Dox-inducible KD of LSD2. HB2 cells were transduced with tet-inducible shLSD2 (LSD2-KD#1 and #2) or control (shCtr) lentiviral vectors followed by blasticidin selection. Cells were cultured with or without Dox for 48 h. For relative mRNA levels of LSD2 (A), real-time quantitative PCR values were normalized to values for the 36B4 gene and are shown as fold differences against Dox (−). For levels of LSD2 protein (B), β-tubulin was used as a loading control. Values are mean ± sd (n = 3). *P < 0.05, †P < 0.01. C) Oil Red O staining of shRNA-expressing HB2 cells at d 7. Culture details are described in Supplemental Fig. S1A. Scale bars, 100 µm. D) Expression of adipogenesis and BAT-selective genes in shLSD2_#1 cells at indicated days. Quantitative RT-PCR values were normalized to those for the 36B4 gene and are shown as fold differences against Dox (−) at d 0. Values are mean ± sd (n = 3). *P < 0.05, †P < 0.01 vs. Dox (−) at each time point.

Article Snippet: Lentiviral expression of short hairpin RNA Lentiviral vectors for tetracycline (tet)-inducible short hairpin RNA (shRNA) expression were constructed using plasmids obtained from Riken BioResource Research Center (Saitama, Japan) according to the guidelines ( http://cfm.brc.riken.jp/Lentiviral_Vectors_J ).

Techniques: Transduction, Control, Selection, Cell Culture, Real-time Polymerase Chain Reaction, Staining, shRNA, Expressing, Quantitative RT-PCR