grna sequences Search Results


90
GenScript corporation grna (5’-caggguucuggauaucugu-3)
Grna (5’ Caggguucuggauaucugu 3), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+sequences/grna+sequences/pm38123592-222-9-11
Average 90 stars, based on 1 article reviews
grna (5’-caggguucuggauaucugu-3) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Broad Institute Inc grna sequences
Grna Sequences, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+sequences/grna+sequence/10__3390_slash_v16101541-78-2-12
Average 90 stars, based on 1 article reviews
grna sequences - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
VectorBuilder GmbH sequencing of grna amplicons
Sequencing Of Grna Amplicons, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+sequences/sequencing+of+grna+amplicons/pm40498965-20929-0-7
Average 90 stars, based on 1 article reviews
sequencing of grna amplicons - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
GenScript corporation mouse non-targeting grna (guide rna) sequence
Mouse Non Targeting Grna (Guide Rna) Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+sequences/mouse+non+targeting+grna++guide+rna++sequence/pm33197448-108-8-28
Average 90 stars, based on 1 article reviews
mouse non-targeting grna (guide rna) sequence - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
GenScript corporation grna sequences targeting cyclin t1
Grna Sequences Targeting Cyclin T1, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+sequences/grna+sequences+targeting+cyclin+t1/pm37215150-241-1-9
Average 90 stars, based on 1 article reviews
grna sequences targeting cyclin t1 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Broad Institute Inc guide rna (grna) sequences targeting the exon regions of the human il15ra gene
Guide Rna (Grna) Sequences Targeting The Exon Regions Of The Human Il15ra Gene, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+sequences/guide+rna++grna++sequences+targeting+the+exon+regions+of+the+human+il15ra+gene/pmc11986442-68-6-17
Average 90 stars, based on 1 article reviews
guide rna (grna) sequences targeting the exon regions of the human il15ra gene - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Microsynth ag forward and reverse primers for each grna
Forward And Reverse Primers For Each Grna, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+sequences/grna+sequence/pmc08126794__pnas__2012908118__sapp-211-125-129
Average 90 stars, based on 1 article reviews
forward and reverse primers for each grna - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
GenScript corporation glut1 coding sequence nm_006516.2
Glut1 Coding Sequence Nm 006516.2, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+sequences/grna+containing+20+nucleotide+target+sequences+of+glut1/10__1212_slash_nxg__0000000000000297-65-1-15
Average 90 stars, based on 1 article reviews
glut1 coding sequence nm_006516.2 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Metabion International AG grna sequences
Grna Sequences, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+sequences/grna+sequences/pmc07265331-291-0-5
Average 90 stars, based on 1 article reviews
grna sequences - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Broad Institute Inc guide rna (grna) sequences
Guide Rna (Grna) Sequences, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+sequences/guide+rna++grna++sequences/pm39396119-44-2-23
Average 90 stars, based on 1 article reviews
guide rna (grna) sequences - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
KU Leuven p58 backbone with 2 grna targeting sequence for pdc1
Plasmids used in this work
P58 Backbone With 2 Grna Targeting Sequence For Pdc1, supplied by KU Leuven, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+sequences/p58+backbone+with+2+grna+targeting+sequence+for+pdc1/pmc09520875-21-2-16
Average 90 stars, based on 1 article reviews
p58 backbone with 2 grna targeting sequence for pdc1 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
GenScript corporation 20-bp guide rna (grna) sequence (5′-catggagttcccgttcgatg-3′)
Plasmids used in this work
20 Bp Guide Rna (Grna) Sequence (5′ Catggagttcccgttcgatg 3′), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+sequences/20+bp+guide+rna++grna++sequence++5++catggagttcccgttcgatg+3++/pmc11105004-138-2-19
Average 90 stars, based on 1 article reviews
20-bp guide rna (grna) sequence (5′-catggagttcccgttcgatg-3′) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Plasmids used in this work

Journal: Microbial Cell Factories

Article Title: Development of an industrial yeast strain for efficient production of 2,3-butanediol

doi: 10.1186/s12934-022-01924-z

Figure Lengend Snippet: Plasmids used in this work

Article Snippet: P58-PDC1 , P58 backbone with 2 gRNA targeting sequence for PDC1 (AGCATCCAACAATTTTTGCA and GATAAGCTTTATGAAGTCAA) , MCB, KU Leuven.

Techniques: Marker, Plasmid Preparation, Sequencing, Expressing