gpx4 Search Results


95
MedChemExpress gpx4
Western blotting analysis on the effects of irisin on the expression level of ferroptosis-associated proteins. (a) Representative western blotting images for the expression of ACSL4, COX-2, <t>GPX4,</t> p-AMPK, and t-AMPK in lung tissues. GAPDH was selected as the loading control protein. (b) Quantification analysis of the related bands of ACSL4, COX-2, GPX4, p-AMPK, and t-AMPK in lung tissues. Lung tissues were harvested on day 3 post-CLP. Statistical analysis was performed using one-way ANOVA followed by Tukey’s post-hoc test. n = 6 per group. Data are presented as means ± SEM. * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001.
Gpx4, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gpx4/GPX4+Antibody/pmc12102538-114-18-19
Average 95 stars, based on 1 article reviews
gpx4 - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

95
Elabscience Biotechnology e-bc-k883-m
Western blotting analysis on the effects of irisin on the expression level of ferroptosis-associated proteins. (a) Representative western blotting images for the expression of ACSL4, COX-2, <t>GPX4,</t> p-AMPK, and t-AMPK in lung tissues. GAPDH was selected as the loading control protein. (b) Quantification analysis of the related bands of ACSL4, COX-2, GPX4, p-AMPK, and t-AMPK in lung tissues. Lung tissues were harvested on day 3 post-CLP. Statistical analysis was performed using one-way ANOVA followed by Tukey’s post-hoc test. n = 6 per group. Data are presented as means ± SEM. * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001.
E Bc K883 M, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gpx4/Glutathione+Peroxidase+4+(GPX4)+Activity+Assay+Kit/pm41864191-237-17-20
Average 95 stars, based on 1 article reviews
e-bc-k883-m - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

93
OriGene gpx4 plasmid
Fig. 6 TGF-β/Smad signaling activation during UUO is inhibited by ferroptosis deficiency in <t>GPX4-overexpressing</t> mice. a Western blot analysis of the expression of TGF-β, p-Smad2, and p-Smad3. b Relative transcript levels of genes related to profibrotic cytokines (TGF-β, CTGF, PDGFB, and FGF2) in UUO mice overexpressing GPX4. For all panels, the data are presented as the means ± SDs. *P < 0.05, **P < 0.005, ***P < 0.001, ****P < 0.0001, ns indicates no significance. Statistical analysis was performed via two-way analysis of variance (ANOVA) with the Bonferroni post hoc correction
Gpx4 Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gpx4/Glutathione+Peroxidase+4+(GPX4)+(NM_002085)+Human+Tagged+ORF+Clone/pm39934851-257-9-11
Average 93 stars, based on 1 article reviews
gpx4 plasmid - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

94
Cusabio glutathione peroxidase 4 gpx4 activity
Fig. 6. Effects of dexmedetomidine on the expressions of Nrf2, HO-1, SLC7A11, and <t>GPX4</t> in H9c2 cells under HR. (A) Protein bands of cytoplasmic Nrf2 of H9c2 cells among four groups were assayed by Western blot, and GAPDH served as an internal control for sample loading. (B) Intensities of protein bands of cytoplasmic Nrf2. (C) Protein bands of nuclear Nrf2 of H9c2 cells among four groups were assayed by Western blot, and Lamin B served as an internal control of Nrf2 for sample loading. (D) Intensities of protein bands of nuclear Nrf2. (E) Protein bands of HO-1, SLC7A11 and GPX4 of H9c2 cells among four groups were assayed by Western blot, and GAPDH served as an internal control for sample loading. (F-G) Intensities of protein bands of HO-1, SLC7A11 and GPX4 of H9c2 cells among four groups were normalized to GAPDH. Results are expressed as mean ± SD, (n = 3 for each group). *P < 0.05; * *P < 0.01; * **P < 0.001; ns, not significant.
Glutathione Peroxidase 4 Gpx4 Activity, supplied by Cusabio, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gpx4/GPX4/pm35988428-144-1-13
Average 94 stars, based on 1 article reviews
glutathione peroxidase 4 gpx4 activity - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

97
Cell Signaling Technology Inc gpx4
Combination of CARM1 and c-Myc inhibitors promotes ferroptosis in esophageal squamous carcinoma cells. (A-B) Lipid ROS levels in control and medicated groups in KYSE450 (upper) and KYSE510 (lower) cells were determined by flow cytometry. Data were presented as mean±SD; n=3. Two-tailed t-tests. (C-E) Western blot or RT-qPCR analyses of the <t>GPX4</t> , ACSL4, FTH1 and COX2 levels in control and medicated groups in KYSE450 (C), KYSE510 (D) and AKR(E) cells. Data were presented as mean±SD; n=3. Two-tailed t-tests. (F) Agarose gel electrophoresis shows the binding of c-Myc to the promoter region of CAD , DHODH , UMPS , ACSL4, and PLA 2 in KYSE450 cells. (G-H) ChIP-qPCR analyses of the fold enrichment of CAD (G) and DHODH (H) in control and medicated groups in KYSE450 cells. Data were presented as mean±SD; n=3. Two-tailed t-tests.
Gpx4, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gpx4/GPX4+Antibody/pmc12837744-222-48-50
Average 97 stars, based on 1 article reviews
gpx4 - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

93
Addgene inc gpx4 cacgcccgatacgctgagtg na na open
Combination of CARM1 and c-Myc inhibitors promotes ferroptosis in esophageal squamous carcinoma cells. (A-B) Lipid ROS levels in control and medicated groups in KYSE450 (upper) and KYSE510 (lower) cells were determined by flow cytometry. Data were presented as mean±SD; n=3. Two-tailed t-tests. (C-E) Western blot or RT-qPCR analyses of the <t>GPX4</t> , ACSL4, FTH1 and COX2 levels in control and medicated groups in KYSE450 (C), KYSE510 (D) and AKR(E) cells. Data were presented as mean±SD; n=3. Two-tailed t-tests. (F) Agarose gel electrophoresis shows the binding of c-Myc to the promoter region of CAD , DHODH , UMPS , ACSL4, and PLA 2 in KYSE450 cells. (G-H) ChIP-qPCR analyses of the fold enrichment of CAD (G) and DHODH (H) in control and medicated groups in KYSE450 cells. Data were presented as mean±SD; n=3. Two-tailed t-tests.
Gpx4 Cacgcccgatacgctgagtg Na Na Open, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gpx4/GPX4+(Plasmid+%2338797)/pmc06338496-367-191-189
Average 93 stars, based on 1 article reviews
gpx4 cacgcccgatacgctgagtg na na open - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

96
Cell Signaling Technology Inc anti gpx4
Combination of CARM1 and c-Myc inhibitors promotes ferroptosis in esophageal squamous carcinoma cells. (A-B) Lipid ROS levels in control and medicated groups in KYSE450 (upper) and KYSE510 (lower) cells were determined by flow cytometry. Data were presented as mean±SD; n=3. Two-tailed t-tests. (C-E) Western blot or RT-qPCR analyses of the <t>GPX4</t> , ACSL4, FTH1 and COX2 levels in control and medicated groups in KYSE450 (C), KYSE510 (D) and AKR(E) cells. Data were presented as mean±SD; n=3. Two-tailed t-tests. (F) Agarose gel electrophoresis shows the binding of c-Myc to the promoter region of CAD , DHODH , UMPS , ACSL4, and PLA 2 in KYSE450 cells. (G-H) ChIP-qPCR analyses of the fold enrichment of CAD (G) and DHODH (H) in control and medicated groups in KYSE450 cells. Data were presented as mean±SD; n=3. Two-tailed t-tests.
Anti Gpx4, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gpx4/GPX4+Rabbit+mAb/pm41792745-122-30-32
Average 96 stars, based on 1 article reviews
anti gpx4 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
Proteintech gpx4
<t>GPX4</t> protein expression is decreased in adenomyosis. (A) GPX4 protein levels determined by western blotting. (B) Protein levels normalized to GAPDH. ** P < 0.01, *** P < 0.001. (C) Representative immunohistochemical staining for GPX4 in CE, AE, and AM. Scale bar = 200 and 50 μm. (D) Average optical density analysis of GPX4 immunohistochemistry staining ( n = 15). ** P < 0.01. (E) GPX4 mRNA levels by RT-qPCR ( n = 12). (F) Correlation between GPX4 expression and CA125 levels, uterine size, and dysmenorrhea severity in adenomyosis patients. GPX4 expression was detected by IHC ( n = 30). CE, control endometrium; AE, adenomyosis endometrium; AM, adenomyosis myometrial lesion; L, length diameter; W, width diameter; A, anteroposterior diameter.
Gpx4, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gpx4/GPX4+Antibody/pmc12449703-56-14-16
Average 96 stars, based on 1 article reviews
gpx4 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology anti gpx4
<t>GPX4</t> protein expression is decreased in adenomyosis. (A) GPX4 protein levels determined by western blotting. (B) Protein levels normalized to GAPDH. ** P < 0.01, *** P < 0.001. (C) Representative immunohistochemical staining for GPX4 in CE, AE, and AM. Scale bar = 200 and 50 μm. (D) Average optical density analysis of GPX4 immunohistochemistry staining ( n = 15). ** P < 0.01. (E) GPX4 mRNA levels by RT-qPCR ( n = 12). (F) Correlation between GPX4 expression and CA125 levels, uterine size, and dysmenorrhea severity in adenomyosis patients. GPX4 expression was detected by IHC ( n = 30). CE, control endometrium; AE, adenomyosis endometrium; AM, adenomyosis myometrial lesion; L, length diameter; W, width diameter; A, anteroposterior diameter.
Anti Gpx4, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gpx4/GPx-4+Antibody/pm41894392-380-18-19
Average 96 stars, based on 1 article reviews
anti gpx4 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

94
MedChemExpress antibodies against gpx4
Ra influences the AKT1 / GSK3β signaling pathway under high-glucose conditions. a and b. Western blot analysis assessed AKT1 and p- AKT1 protein levels in HG-treated rMC-1 cells. a and c. Western blot analysis assessed GSK3β and p- GSK3β protein levels in HG-treated rMC-1 cells. d-f. Effects of Ra on <t>GPX4</t> and xCT expression in HG-treated rMC-1 cells assessed by Western blotting ( n = 3, *P < 0.05, ns: no significance, compared to HG group). Ra: Ranitidine, HG: High-glucose, rMC-1: Mouse retinal Müller cells, GPX4: Glutathione peroxidase 4, xCT: Cystine/glutamate transporter
Antibodies Against Gpx4, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gpx4/GPX4+Antibody/pmc12947084-91-22-25
Average 94 stars, based on 1 article reviews
antibodies against gpx4 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

93
Novus Biologicals glutathione peroxidase 4 gpx 4
Figure 2. SIRT3-acetylated p53 mediates ferroptosis in H9c2 myofibroblasts. (A) Immunoblots and analysis of p53 acetylation, <t>GPX-4</t> and GAPDH in H9c2 cells treated with Ad-SIRT3 alone or treated with Ad-SIRT3 and Erastin (n = 3). (B) Immunoblots and analysis of p53 acetylation, GPX-4 and GAPDH in H9c2 cells treated with/without Erastin and C646 (n = 3). (C) Representative images of DHE-stained H9c2 cells treated with/without Erastin and C646. (D) Quantification of ROS fluorescence integrated density and ferrous OD value in the indicated H9c2 cells treated with/without Erastin and C646 (n = 3). Mean ± S.D., * p < 0.05, ** p < 0.01.
Glutathione Peroxidase 4 Gpx 4, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gpx4/Glutathione+Peroxidase+4%2FGPX4+Antibody+(7O4Q9)/pm37408261-64-59-64
Average 93 stars, based on 1 article reviews
glutathione peroxidase 4 gpx 4 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

96
Elabscience Biotechnology anti gpx4
Figure 2. SIRT3-acetylated p53 mediates ferroptosis in H9c2 myofibroblasts. (A) Immunoblots and analysis of p53 acetylation, <t>GPX-4</t> and GAPDH in H9c2 cells treated with Ad-SIRT3 alone or treated with Ad-SIRT3 and Erastin (n = 3). (B) Immunoblots and analysis of p53 acetylation, GPX-4 and GAPDH in H9c2 cells treated with/without Erastin and C646 (n = 3). (C) Representative images of DHE-stained H9c2 cells treated with/without Erastin and C646. (D) Quantification of ROS fluorescence integrated density and ferrous OD value in the indicated H9c2 cells treated with/without Erastin and C646 (n = 3). Mean ± S.D., * p < 0.05, ** p < 0.01.
Anti Gpx4, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gpx4/(KD+Validated)+GPX4+Polyclonal+Antibody/pmc12734286-57-22-24
Average 96 stars, based on 1 article reviews
anti gpx4 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

Image Search Results


Western blotting analysis on the effects of irisin on the expression level of ferroptosis-associated proteins. (a) Representative western blotting images for the expression of ACSL4, COX-2, GPX4, p-AMPK, and t-AMPK in lung tissues. GAPDH was selected as the loading control protein. (b) Quantification analysis of the related bands of ACSL4, COX-2, GPX4, p-AMPK, and t-AMPK in lung tissues. Lung tissues were harvested on day 3 post-CLP. Statistical analysis was performed using one-way ANOVA followed by Tukey’s post-hoc test. n = 6 per group. Data are presented as means ± SEM. * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001.

Journal: The Journal of International Medical Research

Article Title: The therapeutic potential of irisin in alleviating acute lung injury via inflammation and ferroptosis modulation

doi: 10.1177/03000605251340338

Figure Lengend Snippet: Western blotting analysis on the effects of irisin on the expression level of ferroptosis-associated proteins. (a) Representative western blotting images for the expression of ACSL4, COX-2, GPX4, p-AMPK, and t-AMPK in lung tissues. GAPDH was selected as the loading control protein. (b) Quantification analysis of the related bands of ACSL4, COX-2, GPX4, p-AMPK, and t-AMPK in lung tissues. Lung tissues were harvested on day 3 post-CLP. Statistical analysis was performed using one-way ANOVA followed by Tukey’s post-hoc test. n = 6 per group. Data are presented as means ± SEM. * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001.

Article Snippet: Subsequently, the membranes were incubated with rabbit anti-AMPK (MCE, Cat# HY- P80541 ), anti-p-AMPK (MCE, HY- P80452 ), GPX4 (MCE, HY- P80450 ), ACSL4 (Santa Cruz Biotechnology, Dallas, Texas, USA; Cat# sc-365230), COX-2 (Abcam, Cambridge, United Kingdom; Cat# ab283574), and GAPDH (MCE, HY-P80137) antibodies at 4°C overnight.

Techniques: Western Blot, Expressing, Control

Fig. 6 TGF-β/Smad signaling activation during UUO is inhibited by ferroptosis deficiency in GPX4-overexpressing mice. a Western blot analysis of the expression of TGF-β, p-Smad2, and p-Smad3. b Relative transcript levels of genes related to profibrotic cytokines (TGF-β, CTGF, PDGFB, and FGF2) in UUO mice overexpressing GPX4. For all panels, the data are presented as the means ± SDs. *P < 0.05, **P < 0.005, ***P < 0.001, ****P < 0.0001, ns indicates no significance. Statistical analysis was performed via two-way analysis of variance (ANOVA) with the Bonferroni post hoc correction

Journal: Cell communication and signaling : CCS

Article Title: Inhibition of tubular epithelial cells ferroptosis alleviates renal interstitial fibrosis by reducing lipid hydroperoxides and TGF-β/Smad signaling.

doi: 10.1186/s12964-025-02068-4

Figure Lengend Snippet: Fig. 6 TGF-β/Smad signaling activation during UUO is inhibited by ferroptosis deficiency in GPX4-overexpressing mice. a Western blot analysis of the expression of TGF-β, p-Smad2, and p-Smad3. b Relative transcript levels of genes related to profibrotic cytokines (TGF-β, CTGF, PDGFB, and FGF2) in UUO mice overexpressing GPX4. For all panels, the data are presented as the means ± SDs. *P < 0.05, **P < 0.005, ***P < 0.001, ****P < 0.0001, ns indicates no significance. Statistical analysis was performed via two-way analysis of variance (ANOVA) with the Bonferroni post hoc correction

Article Snippet: Additional gene transfection studies included the use of a GPX4 plasmid (origene, catalog RC208065; 5 μg) in cells transfected with Lipofectamine 3000 (Thermo Fisher Scientific, MA).

Techniques: Activation Assay, Western Blot, Expressing

Fig. 6. Effects of dexmedetomidine on the expressions of Nrf2, HO-1, SLC7A11, and GPX4 in H9c2 cells under HR. (A) Protein bands of cytoplasmic Nrf2 of H9c2 cells among four groups were assayed by Western blot, and GAPDH served as an internal control for sample loading. (B) Intensities of protein bands of cytoplasmic Nrf2. (C) Protein bands of nuclear Nrf2 of H9c2 cells among four groups were assayed by Western blot, and Lamin B served as an internal control of Nrf2 for sample loading. (D) Intensities of protein bands of nuclear Nrf2. (E) Protein bands of HO-1, SLC7A11 and GPX4 of H9c2 cells among four groups were assayed by Western blot, and GAPDH served as an internal control for sample loading. (F-G) Intensities of protein bands of HO-1, SLC7A11 and GPX4 of H9c2 cells among four groups were normalized to GAPDH. Results are expressed as mean ± SD, (n = 3 for each group). *P < 0.05; * *P < 0.01; * **P < 0.001; ns, not significant.

Journal: Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie

Article Title: Dexmedetomidine attenuates myocardial ischemia/reperfusion-induced ferroptosis via AMPK/GSK-3β/Nrf2 axis.

doi: 10.1016/j.biopha.2022.113572

Figure Lengend Snippet: Fig. 6. Effects of dexmedetomidine on the expressions of Nrf2, HO-1, SLC7A11, and GPX4 in H9c2 cells under HR. (A) Protein bands of cytoplasmic Nrf2 of H9c2 cells among four groups were assayed by Western blot, and GAPDH served as an internal control for sample loading. (B) Intensities of protein bands of cytoplasmic Nrf2. (C) Protein bands of nuclear Nrf2 of H9c2 cells among four groups were assayed by Western blot, and Lamin B served as an internal control of Nrf2 for sample loading. (D) Intensities of protein bands of nuclear Nrf2. (E) Protein bands of HO-1, SLC7A11 and GPX4 of H9c2 cells among four groups were assayed by Western blot, and GAPDH served as an internal control for sample loading. (F-G) Intensities of protein bands of HO-1, SLC7A11 and GPX4 of H9c2 cells among four groups were normalized to GAPDH. Results are expressed as mean ± SD, (n = 3 for each group). *P < 0.05; * *P < 0.01; * **P < 0.001; ns, not significant.

Article Snippet: The glutathione peroxidase 4 (GPX4) activity was determined using a GPX4 Elisa kit (CUSABIO, China).

Techniques: Western Blot, Control

Fig. 7. Dexmedetomidine increased the levels of SLC7A11 and GPX4 in HR-treated H9c2 cells. (A) SLC7A11 expression was measured by immunofluorescent staining. Cells were immunostained using antibody specific for SLC7A11 (red). Nuclei were stained with DAPI (blue). Scale bars represent 20 µm. Images were captured at × 400 magnification. (B) Quantitative analysis of SLC7A11 expression. (C) GPX4 expression was measured by immunofluorescent staining. Cells were immunostained using antibody specific for GPX4 (red). Nuclei were stained with DAPI (blue). Scale bars represent 20 µm. Images were captured at × 400 magnification. (D) Quantitative analysis of GPX4 expression. (D) GPX4 activity was determined by Elisa. Results were expressed as mean ± SD, (n = 3 for each group). *P < 0.05; * *P < 0.01; * ** *P < 0.0001.

Journal: Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie

Article Title: Dexmedetomidine attenuates myocardial ischemia/reperfusion-induced ferroptosis via AMPK/GSK-3β/Nrf2 axis.

doi: 10.1016/j.biopha.2022.113572

Figure Lengend Snippet: Fig. 7. Dexmedetomidine increased the levels of SLC7A11 and GPX4 in HR-treated H9c2 cells. (A) SLC7A11 expression was measured by immunofluorescent staining. Cells were immunostained using antibody specific for SLC7A11 (red). Nuclei were stained with DAPI (blue). Scale bars represent 20 µm. Images were captured at × 400 magnification. (B) Quantitative analysis of SLC7A11 expression. (C) GPX4 expression was measured by immunofluorescent staining. Cells were immunostained using antibody specific for GPX4 (red). Nuclei were stained with DAPI (blue). Scale bars represent 20 µm. Images were captured at × 400 magnification. (D) Quantitative analysis of GPX4 expression. (D) GPX4 activity was determined by Elisa. Results were expressed as mean ± SD, (n = 3 for each group). *P < 0.05; * *P < 0.01; * ** *P < 0.0001.

Article Snippet: The glutathione peroxidase 4 (GPX4) activity was determined using a GPX4 Elisa kit (CUSABIO, China).

Techniques: Expressing, Staining, Activity Assay, Enzyme-linked Immunosorbent Assay

Combination of CARM1 and c-Myc inhibitors promotes ferroptosis in esophageal squamous carcinoma cells. (A-B) Lipid ROS levels in control and medicated groups in KYSE450 (upper) and KYSE510 (lower) cells were determined by flow cytometry. Data were presented as mean±SD; n=3. Two-tailed t-tests. (C-E) Western blot or RT-qPCR analyses of the GPX4 , ACSL4, FTH1 and COX2 levels in control and medicated groups in KYSE450 (C), KYSE510 (D) and AKR(E) cells. Data were presented as mean±SD; n=3. Two-tailed t-tests. (F) Agarose gel electrophoresis shows the binding of c-Myc to the promoter region of CAD , DHODH , UMPS , ACSL4, and PLA 2 in KYSE450 cells. (G-H) ChIP-qPCR analyses of the fold enrichment of CAD (G) and DHODH (H) in control and medicated groups in KYSE450 cells. Data were presented as mean±SD; n=3. Two-tailed t-tests.

Journal: International Journal of Biological Sciences

Article Title: Targeting c-Myc-p300-CARM1 complex induces ferroptosis and reduces CD8 + T cell exhaustion in esophageal squamous cell carcinoma

doi: 10.7150/ijbs.114575

Figure Lengend Snippet: Combination of CARM1 and c-Myc inhibitors promotes ferroptosis in esophageal squamous carcinoma cells. (A-B) Lipid ROS levels in control and medicated groups in KYSE450 (upper) and KYSE510 (lower) cells were determined by flow cytometry. Data were presented as mean±SD; n=3. Two-tailed t-tests. (C-E) Western blot or RT-qPCR analyses of the GPX4 , ACSL4, FTH1 and COX2 levels in control and medicated groups in KYSE450 (C), KYSE510 (D) and AKR(E) cells. Data were presented as mean±SD; n=3. Two-tailed t-tests. (F) Agarose gel electrophoresis shows the binding of c-Myc to the promoter region of CAD , DHODH , UMPS , ACSL4, and PLA 2 in KYSE450 cells. (G-H) ChIP-qPCR analyses of the fold enrichment of CAD (G) and DHODH (H) in control and medicated groups in KYSE450 cells. Data were presented as mean±SD; n=3. Two-tailed t-tests.

Article Snippet: Antibodies against the following proteins were used for western blotting: β-actin (1:1000, Cell Signaling Technology; 4970), c-Myc (1:1000, Cell Signaling Technology; 9402), CARM1 (1:1000, Abcam; ab243638), P300 (1:1000, Cell Signaling Technology; 54062), Flag-tag (1:1000, Cell Signaling Technology; 14793), Myc-tag (1:1000, Cell Signaling Technology; 2272), HA-tag (1:1000, Abcam; ab236632), GPX4 (1:1000, Cell Signaling Technology; 52455), ACSL4 (1:1000, Abcam; ab155282), FTH1 (1:1000, Abcam; ab75973), and COX2 (1:1000, Abcam; ab179800).

Techniques: Control, Flow Cytometry, Two Tailed Test, Western Blot, Quantitative RT-PCR, Agarose Gel Electrophoresis, Binding Assay, ChIP-qPCR

GPX4 protein expression is decreased in adenomyosis. (A) GPX4 protein levels determined by western blotting. (B) Protein levels normalized to GAPDH. ** P < 0.01, *** P < 0.001. (C) Representative immunohistochemical staining for GPX4 in CE, AE, and AM. Scale bar = 200 and 50 μm. (D) Average optical density analysis of GPX4 immunohistochemistry staining ( n = 15). ** P < 0.01. (E) GPX4 mRNA levels by RT-qPCR ( n = 12). (F) Correlation between GPX4 expression and CA125 levels, uterine size, and dysmenorrhea severity in adenomyosis patients. GPX4 expression was detected by IHC ( n = 30). CE, control endometrium; AE, adenomyosis endometrium; AM, adenomyosis myometrial lesion; L, length diameter; W, width diameter; A, anteroposterior diameter.

Journal: Reproduction (Cambridge, England)

Article Title: METTL3-mediated m 6 A modification promotes ferroptosis in adenomyosis through GPX4 in a YTHDF1-dependent manner

doi: 10.1530/REP-25-0251

Figure Lengend Snippet: GPX4 protein expression is decreased in adenomyosis. (A) GPX4 protein levels determined by western blotting. (B) Protein levels normalized to GAPDH. ** P < 0.01, *** P < 0.001. (C) Representative immunohistochemical staining for GPX4 in CE, AE, and AM. Scale bar = 200 and 50 μm. (D) Average optical density analysis of GPX4 immunohistochemistry staining ( n = 15). ** P < 0.01. (E) GPX4 mRNA levels by RT-qPCR ( n = 12). (F) Correlation between GPX4 expression and CA125 levels, uterine size, and dysmenorrhea severity in adenomyosis patients. GPX4 expression was detected by IHC ( n = 30). CE, control endometrium; AE, adenomyosis endometrium; AM, adenomyosis myometrial lesion; L, length diameter; W, width diameter; A, anteroposterior diameter.

Article Snippet: The corresponding primary antibodies against GAPDH (10494-1-AP, Proteintech, China), METTL3 (15073-1-AP, Proteintech, China), and GPX4 (67763-1-AP, Proteintech, China) were incubated at 4°C overnight, and then the secondary antibody was incubated at 25°C for 1 h. The relative expression level of protein was calculated using a chemiluminescence imaging system.

Techniques: Expressing, Western Blot, Immunohistochemical staining, Staining, Immunohistochemistry, Quantitative RT-PCR, Control

The downregulation of METTL3 promotes ferroptosis in EuESC cells. (A) Cell viability of EuESCs transfected with METTL3 siRNAs or METTL3-overexpressing plasmids for 24, 48, and 72 h. (B) Cell viability of EuESCs following METTL3 knockdown or overexpression and subsequent treatment with erastin or fer-1 for 24, 48, and 72 h. (C) Assessment of ROS levels in EuESCs after METTL3 knockdown or overexpression and treatment with erastin or fer-1 for 24 h using flow cytometry. (D) Statistical analyses of ROS from three independent experiments are shown. ** P < 0.01, *** P < 0.001. (E) MDA levels of EuESCs got METTL3 knocked down or overexpressed and treated with erastin or fer-1 for 24 h ( n = 3). ** P < 0.01, *** P < 0.001. (F) The mRNA levels of METTL3 and GPX4 after getting METTL3 knocked down or overexpressed ( n = 5). ** P < 0.01. (G) Protein levels of METTL3 and GPX4 after getting METTL3 knocked down or overexpressed. The protein levels normalized to GAPDH are shown in Fig. S1C. (H) Dot blot assay using m 6 A antibody on cells with METTL3 knocked down or overexpressed. (I) Dot blot assay using m 6 A antibody after treating cells with erastin or fer-1 for 24 h.

Journal: Reproduction (Cambridge, England)

Article Title: METTL3-mediated m 6 A modification promotes ferroptosis in adenomyosis through GPX4 in a YTHDF1-dependent manner

doi: 10.1530/REP-25-0251

Figure Lengend Snippet: The downregulation of METTL3 promotes ferroptosis in EuESC cells. (A) Cell viability of EuESCs transfected with METTL3 siRNAs or METTL3-overexpressing plasmids for 24, 48, and 72 h. (B) Cell viability of EuESCs following METTL3 knockdown or overexpression and subsequent treatment with erastin or fer-1 for 24, 48, and 72 h. (C) Assessment of ROS levels in EuESCs after METTL3 knockdown or overexpression and treatment with erastin or fer-1 for 24 h using flow cytometry. (D) Statistical analyses of ROS from three independent experiments are shown. ** P < 0.01, *** P < 0.001. (E) MDA levels of EuESCs got METTL3 knocked down or overexpressed and treated with erastin or fer-1 for 24 h ( n = 3). ** P < 0.01, *** P < 0.001. (F) The mRNA levels of METTL3 and GPX4 after getting METTL3 knocked down or overexpressed ( n = 5). ** P < 0.01. (G) Protein levels of METTL3 and GPX4 after getting METTL3 knocked down or overexpressed. The protein levels normalized to GAPDH are shown in Fig. S1C. (H) Dot blot assay using m 6 A antibody on cells with METTL3 knocked down or overexpressed. (I) Dot blot assay using m 6 A antibody after treating cells with erastin or fer-1 for 24 h.

Article Snippet: The corresponding primary antibodies against GAPDH (10494-1-AP, Proteintech, China), METTL3 (15073-1-AP, Proteintech, China), and GPX4 (67763-1-AP, Proteintech, China) were incubated at 4°C overnight, and then the secondary antibody was incubated at 25°C for 1 h. The relative expression level of protein was calculated using a chemiluminescence imaging system.

Techniques: Transfection, Knockdown, Over Expression, Flow Cytometry, Dot Blot

Downregulation of m 6 A-methylated GPX4 mRNA reduced GPX4 mRNA translation in a YTHDF1-dependent manner. (A) Heatmap and peaks of MeRIP-seq after homogenization in RNA ± 3 kb flanking TSSs in endometrium and myometrial lesion in adenomyosis. (B) GO analysis of upregulated and downregulated m 6 A-modified genes based on MeRIP-seq data. (C) The m 6 A motif detected by the HOMER motif discovery tool with MeRIP-seq data. (D) IGV tracks show the distribution of m 6 A peaks of GPX4. (E) MeRIP-qPCR were detected after METTL3 knockdown ( n = 3). ** P < 0.01. (F) YTHDF1-RIP-qPCR were detected after METTL3 knockdown ( n = 3). * P < 0.05. (G) Schematic representation of wild-type (GPX4-WT) and different sites of m 6 A mutant (GPX4-Mut) constructs. (H) YTHDF1-RIP-qPCR were detected after single sites of GPX4 mutant ( n = 4). * P < 0.05, ** P < 0.01, *** P < 0.001. (I) Protein levels of GPX4 after different sites of GPX4 mutant. The protein levels normalized to GAPDH are shown in Fig. S2F. AE, adenomyosis endometrium; AM, adenomyosis myometrial lesion.

Journal: Reproduction (Cambridge, England)

Article Title: METTL3-mediated m 6 A modification promotes ferroptosis in adenomyosis through GPX4 in a YTHDF1-dependent manner

doi: 10.1530/REP-25-0251

Figure Lengend Snippet: Downregulation of m 6 A-methylated GPX4 mRNA reduced GPX4 mRNA translation in a YTHDF1-dependent manner. (A) Heatmap and peaks of MeRIP-seq after homogenization in RNA ± 3 kb flanking TSSs in endometrium and myometrial lesion in adenomyosis. (B) GO analysis of upregulated and downregulated m 6 A-modified genes based on MeRIP-seq data. (C) The m 6 A motif detected by the HOMER motif discovery tool with MeRIP-seq data. (D) IGV tracks show the distribution of m 6 A peaks of GPX4. (E) MeRIP-qPCR were detected after METTL3 knockdown ( n = 3). ** P < 0.01. (F) YTHDF1-RIP-qPCR were detected after METTL3 knockdown ( n = 3). * P < 0.05. (G) Schematic representation of wild-type (GPX4-WT) and different sites of m 6 A mutant (GPX4-Mut) constructs. (H) YTHDF1-RIP-qPCR were detected after single sites of GPX4 mutant ( n = 4). * P < 0.05, ** P < 0.01, *** P < 0.001. (I) Protein levels of GPX4 after different sites of GPX4 mutant. The protein levels normalized to GAPDH are shown in Fig. S2F. AE, adenomyosis endometrium; AM, adenomyosis myometrial lesion.

Article Snippet: The corresponding primary antibodies against GAPDH (10494-1-AP, Proteintech, China), METTL3 (15073-1-AP, Proteintech, China), and GPX4 (67763-1-AP, Proteintech, China) were incubated at 4°C overnight, and then the secondary antibody was incubated at 25°C for 1 h. The relative expression level of protein was calculated using a chemiluminescence imaging system.

Techniques: Methylation, Homogenization, Modification, Knockdown, Mutagenesis, Construct

The expression of relevant proteins in the mouse model of adenomyosis. (A) Protein levels of METTL3 and GPX4 from the uterus of eight groups. (B) The protein levels normalized to GAPDH. * P < 0.05, ** P < 0.01, *** P < 0.001. (C) Dot blot assay using m 6 A antibody with RNA extracted from the uterus of eight groups. (D) Representative immunofluorescence (IF) staining for METTL3 and GPX4 in a model mouse. Squares indicate eutopic and ectopic endometrial glands. Scale bar = 100 and 20 μm. (E) Schematic representation of the mechanism through the METTL3/YTHDF1/GPX4 axis activating ferroptosis. EU, eutopic endometrium; EC, ectopic lesions.

Journal: Reproduction (Cambridge, England)

Article Title: METTL3-mediated m 6 A modification promotes ferroptosis in adenomyosis through GPX4 in a YTHDF1-dependent manner

doi: 10.1530/REP-25-0251

Figure Lengend Snippet: The expression of relevant proteins in the mouse model of adenomyosis. (A) Protein levels of METTL3 and GPX4 from the uterus of eight groups. (B) The protein levels normalized to GAPDH. * P < 0.05, ** P < 0.01, *** P < 0.001. (C) Dot blot assay using m 6 A antibody with RNA extracted from the uterus of eight groups. (D) Representative immunofluorescence (IF) staining for METTL3 and GPX4 in a model mouse. Squares indicate eutopic and ectopic endometrial glands. Scale bar = 100 and 20 μm. (E) Schematic representation of the mechanism through the METTL3/YTHDF1/GPX4 axis activating ferroptosis. EU, eutopic endometrium; EC, ectopic lesions.

Article Snippet: The corresponding primary antibodies against GAPDH (10494-1-AP, Proteintech, China), METTL3 (15073-1-AP, Proteintech, China), and GPX4 (67763-1-AP, Proteintech, China) were incubated at 4°C overnight, and then the secondary antibody was incubated at 25°C for 1 h. The relative expression level of protein was calculated using a chemiluminescence imaging system.

Techniques: Expressing, Dot Blot, Immunofluorescence, Staining

Ra influences the AKT1 / GSK3β signaling pathway under high-glucose conditions. a and b. Western blot analysis assessed AKT1 and p- AKT1 protein levels in HG-treated rMC-1 cells. a and c. Western blot analysis assessed GSK3β and p- GSK3β protein levels in HG-treated rMC-1 cells. d-f. Effects of Ra on GPX4 and xCT expression in HG-treated rMC-1 cells assessed by Western blotting ( n = 3, *P < 0.05, ns: no significance, compared to HG group). Ra: Ranitidine, HG: High-glucose, rMC-1: Mouse retinal Müller cells, GPX4: Glutathione peroxidase 4, xCT: Cystine/glutamate transporter

Journal: Indian Journal of Ophthalmology

Article Title: Ranitidine protects Müller cells against ferroptosis in diabetic retinopathy by regulating the AKT1 / GSK3β pathway

doi: 10.4103/IJO.IJO_1522_25

Figure Lengend Snippet: Ra influences the AKT1 / GSK3β signaling pathway under high-glucose conditions. a and b. Western blot analysis assessed AKT1 and p- AKT1 protein levels in HG-treated rMC-1 cells. a and c. Western blot analysis assessed GSK3β and p- GSK3β protein levels in HG-treated rMC-1 cells. d-f. Effects of Ra on GPX4 and xCT expression in HG-treated rMC-1 cells assessed by Western blotting ( n = 3, *P < 0.05, ns: no significance, compared to HG group). Ra: Ranitidine, HG: High-glucose, rMC-1: Mouse retinal Müller cells, GPX4: Glutathione peroxidase 4, xCT: Cystine/glutamate transporter

Article Snippet: After being closed with 5% bovine serum albumin blocking solution for 2 h at room temperature, the membranes were incubated with primary antibodies against GPX4 (Med Chem Express, USA) (1:1000), xCT (Med Chem Express, USA) (1:1000), GSK3β (Med Chem Express, USA) (1:1000), p- GSK3β (Med Chem Express, USA) (1:1000), AKT1 (Zenbio, USA) (1:1000), or p- AKT1 (Med Chem Express, USA) (1:1000) proteins at 4°C overnight.

Techniques: Western Blot, Expressing

Ra inhibits HG-induced ferroptosis in rMC-1 cells, depending on GSK3β . a-c. The effects of Ra on the expression levels of AKT1 , P- AKT1 , GSK3β , and p- GSK3β in HG-cultured rMC-1 cells were assessed by Western blotting. d-f. The effects of Ra on the expression levels of GPX4 and xCT in HG-cultured rMC-1 cells were assessed by Western blotting ( n = 3, **P < 0.01, ***P < 0.001, ns: no significance, compared to HG group; # P < 0.05, ### P < 0.001, ns: no significance, compared to HG + Ra group). Ra: Ranitidine, HG: High-glucose, rMC-1: Mouse retinal Müller cells, GPX4: Glutathione peroxidase 4, xCT: Cystine/glutamate transporter

Journal: Indian Journal of Ophthalmology

Article Title: Ranitidine protects Müller cells against ferroptosis in diabetic retinopathy by regulating the AKT1 / GSK3β pathway

doi: 10.4103/IJO.IJO_1522_25

Figure Lengend Snippet: Ra inhibits HG-induced ferroptosis in rMC-1 cells, depending on GSK3β . a-c. The effects of Ra on the expression levels of AKT1 , P- AKT1 , GSK3β , and p- GSK3β in HG-cultured rMC-1 cells were assessed by Western blotting. d-f. The effects of Ra on the expression levels of GPX4 and xCT in HG-cultured rMC-1 cells were assessed by Western blotting ( n = 3, **P < 0.01, ***P < 0.001, ns: no significance, compared to HG group; # P < 0.05, ### P < 0.001, ns: no significance, compared to HG + Ra group). Ra: Ranitidine, HG: High-glucose, rMC-1: Mouse retinal Müller cells, GPX4: Glutathione peroxidase 4, xCT: Cystine/glutamate transporter

Article Snippet: After being closed with 5% bovine serum albumin blocking solution for 2 h at room temperature, the membranes were incubated with primary antibodies against GPX4 (Med Chem Express, USA) (1:1000), xCT (Med Chem Express, USA) (1:1000), GSK3β (Med Chem Express, USA) (1:1000), p- GSK3β (Med Chem Express, USA) (1:1000), AKT1 (Zenbio, USA) (1:1000), or p- AKT1 (Med Chem Express, USA) (1:1000) proteins at 4°C overnight.

Techniques: Expressing, Cell Culture, Western Blot

Figure 2. SIRT3-acetylated p53 mediates ferroptosis in H9c2 myofibroblasts. (A) Immunoblots and analysis of p53 acetylation, GPX-4 and GAPDH in H9c2 cells treated with Ad-SIRT3 alone or treated with Ad-SIRT3 and Erastin (n = 3). (B) Immunoblots and analysis of p53 acetylation, GPX-4 and GAPDH in H9c2 cells treated with/without Erastin and C646 (n = 3). (C) Representative images of DHE-stained H9c2 cells treated with/without Erastin and C646. (D) Quantification of ROS fluorescence integrated density and ferrous OD value in the indicated H9c2 cells treated with/without Erastin and C646 (n = 3). Mean ± S.D., * p < 0.05, ** p < 0.01.

Journal: Cells

Article Title: SIRT3 Deficiency Enhances Ferroptosis and Promotes Cardiac Fibrosis via p53 Acetylation.

doi: 10.3390/cells12101428

Figure Lengend Snippet: Figure 2. SIRT3-acetylated p53 mediates ferroptosis in H9c2 myofibroblasts. (A) Immunoblots and analysis of p53 acetylation, GPX-4 and GAPDH in H9c2 cells treated with Ad-SIRT3 alone or treated with Ad-SIRT3 and Erastin (n = 3). (B) Immunoblots and analysis of p53 acetylation, GPX-4 and GAPDH in H9c2 cells treated with/without Erastin and C646 (n = 3). (C) Representative images of DHE-stained H9c2 cells treated with/without Erastin and C646. (D) Quantification of ROS fluorescence integrated density and ferrous OD value in the indicated H9c2 cells treated with/without Erastin and C646 (n = 3). Mean ± S.D., * p < 0.05, ** p < 0.01.

Article Snippet: Equal amounts of protein were run in 10% SDS-PAGE gel and transferred to a polyvinylidene difluoride (PVDF) membrane and then incubated with the primary antibodies at 4 ◦C overnight: β-myosin heavy chain (β-MHC; 1:1000, Abcam, Cambridge, MA, USA), α-smooth muscle actin (α-SMA; 1:1000, Abcam), 4-hydroxynonenal (4-HNE; 1:1000, Abcam), p53 acetylation (1:1000, Abcam), p53 (1:1000; Cell signaling, Danvers, MA, USA), glutathione peroxidase 4 (GPX-4) (1:1000; Novus Bio, Littleton, CO, USA) and TGF-β1 (1:500; Santa Cruz, CA, USA).

Techniques: Western Blot, Staining

Figure 3. Inhibition of acetylated p53 rescued ferroptosis and cardiac fibrosis in SIRT3KO mice. (A) Representative images of H&E-stained and Masson’s trichrome-stained whole heart sections and quantification of cardiomyocyte sizes and interstitial fibrosis area in WT mice, SIRT3KO mice and SIRT3KO/p534KR mice (n = 3–4). (B) Immunoblots and analysis of α-SMA, p53, p53 acetylation and GAPDH in the indicated mouse hearts (n = 3–4). (C) Representative images of DHE-stained whole heart sections in the indicated mouse hearts. (D) Immunoblots and analysis of GPX-4 and GAPDH ratio in the indicated mouse hearts (n = 3–4). (E) Quantification of ferrous iron OD value in the indicated H9c2 cells (n = 3). Mean ± S.D., * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Cells

Article Title: SIRT3 Deficiency Enhances Ferroptosis and Promotes Cardiac Fibrosis via p53 Acetylation.

doi: 10.3390/cells12101428

Figure Lengend Snippet: Figure 3. Inhibition of acetylated p53 rescued ferroptosis and cardiac fibrosis in SIRT3KO mice. (A) Representative images of H&E-stained and Masson’s trichrome-stained whole heart sections and quantification of cardiomyocyte sizes and interstitial fibrosis area in WT mice, SIRT3KO mice and SIRT3KO/p534KR mice (n = 3–4). (B) Immunoblots and analysis of α-SMA, p53, p53 acetylation and GAPDH in the indicated mouse hearts (n = 3–4). (C) Representative images of DHE-stained whole heart sections in the indicated mouse hearts. (D) Immunoblots and analysis of GPX-4 and GAPDH ratio in the indicated mouse hearts (n = 3–4). (E) Quantification of ferrous iron OD value in the indicated H9c2 cells (n = 3). Mean ± S.D., * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: Equal amounts of protein were run in 10% SDS-PAGE gel and transferred to a polyvinylidene difluoride (PVDF) membrane and then incubated with the primary antibodies at 4 ◦C overnight: β-myosin heavy chain (β-MHC; 1:1000, Abcam, Cambridge, MA, USA), α-smooth muscle actin (α-SMA; 1:1000, Abcam), 4-hydroxynonenal (4-HNE; 1:1000, Abcam), p53 acetylation (1:1000, Abcam), p53 (1:1000; Cell signaling, Danvers, MA, USA), glutathione peroxidase 4 (GPX-4) (1:1000; Novus Bio, Littleton, CO, USA) and TGF-β1 (1:500; Santa Cruz, CA, USA).

Techniques: Inhibition, Staining, Western Blot