glun1 Search Results


93
NeuroMab anti nr1
Anti Nr1, supplied by NeuroMab, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti nr1/product/NeuroMab
Average 93 stars, based on 1 article reviews
anti nr1 - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

95
Cell Signaling Technology Inc anti glun2a
Anti Glun2a, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti glun2a/product/Cell Signaling Technology Inc
Average 95 stars, based on 1 article reviews
anti glun2a - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier

93
Cell Signaling Technology Inc pglun1
Pglun1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pglun1/product/Cell Signaling Technology Inc
Average 93 stars, based on 1 article reviews
pglun1 - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Cell Signaling Technology Inc pglun1 ser897
Fig. 4. Western blot analysis of NMDA receptors in the hippocampus of control and CsA-treated rats. (A) Representative images of the levels of total (pan) GluN2, GluN2A, GluN2B, p-GluN1 <t>(Ser897)</t> and total GluN1. (B-F) Respective quantifications of immunodetections normalized to β-actin and presented as a percentage of the control mean. Data represent the mean ± SEM. Statistics: ** *p ≤0.001 as determined by Student’s t-test; n = 6.
Pglun1 Ser897, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pglun1 ser897/product/Cell Signaling Technology Inc
Average 93 stars, based on 1 article reviews
pglun1 ser897 - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
OriGene glun1
Fig. 4. Western blot analysis of NMDA receptors in the hippocampus of control and CsA-treated rats. (A) Representative images of the levels of total (pan) GluN2, GluN2A, GluN2B, p-GluN1 <t>(Ser897)</t> and total GluN1. (B-F) Respective quantifications of immunodetections normalized to β-actin and presented as a percentage of the control mean. Data represent the mean ± SEM. Statistics: ** *p ≤0.001 as determined by Student’s t-test; n = 6.
Glun1, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/glun1/product/OriGene
Average 93 stars, based on 1 article reviews
glun1 - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

nr1  (OriGene)
90
OriGene nr1
Fig. 4. Western blot analysis of NMDA receptors in the hippocampus of control and CsA-treated rats. (A) Representative images of the levels of total (pan) GluN2, GluN2A, GluN2B, p-GluN1 <t>(Ser897)</t> and total GluN1. (B-F) Respective quantifications of immunodetections normalized to β-actin and presented as a percentage of the control mean. Data represent the mean ± SEM. Statistics: ** *p ≤0.001 as determined by Student’s t-test; n = 6.
Nr1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nr1/product/OriGene
Average 90 stars, based on 1 article reviews
nr1 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

93
OriGene human grin1
Fig. 4. Western blot analysis of NMDA receptors in the hippocampus of control and CsA-treated rats. (A) Representative images of the levels of total (pan) GluN2, GluN2A, GluN2B, p-GluN1 <t>(Ser897)</t> and total GluN1. (B-F) Respective quantifications of immunodetections normalized to β-actin and presented as a percentage of the control mean. Data represent the mean ± SEM. Statistics: ** *p ≤0.001 as determined by Student’s t-test; n = 6.
Human Grin1, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human grin1/product/OriGene
Average 93 stars, based on 1 article reviews
human grin1 - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

90
OriGene construct pcmv6 ac nr1 glun1 gfp
DISC1 interacts with <t>GluN1,</t> TRAK1 associates with GluN2B. ( a ) <t>HA-GluN1</t> co-immunoprecipitates FLAG-DISC1 from transfected COS7 cells. ( b ) Upper, GluN1 cytoplasmic tail (C0-C1-C2) peptide array hybridised with Flag-DISC1. Each spot represents a single peptide. red, black and green text marks the C0, C1 and C2 cassettes respectively. ER retention signals are in bold. ( c ) FLAG-DISC1 co-immunoprecipitates GST-tagged C0-C1-C2. ( d ) DISC1 peptide array probed with FLAG-C0-C1-C2. ( e ) DISC1 361-385 GluN1 binding region alanine scan probed with FLAG-C0-C1-C2. C, unmutated peptide. ( f ) HA-GluN1 co-immunoprecipitates GST-DISC1 amino acids 358-499 from transfected COS7 cells. ( g ) Co-localisation of FLAG-DISC1 and endogenous GluN1 in cultured DIV8 and DIV14 hippocampal neurons. Arrowheads and arrows indicate example sites of colocalisation. ( h ) COS7 cells transfected with GluN1 or HA-GluN2B expression constructs were labelled with antibodies specific for GluN1 or HA, plus the ER marker Calreticulin. ( i ) COS7 cells co-transfected with FLAG-TRAK1 plus GluN1 (left) or HA-GluN2B (right) expression constructs were labelled using antibodies specific for GluN1 or HA, plus antiFLAG and the mitochondrial dye Mitotracker CMXRos. ( j ) COS7 cells triple-transfected with FLAG-TRAK1, GluN1 plus HA-GluN2B expression constructs were labelled using antibodies specific for GluN1, HA and FLAG, plus Mitotracker CMXRos. COS7 cells were used because they are ideal for exogenous protein expression due to their high transfection efficiency, large size and low profile, which facilitate co-immunoprecipitation and colocalisation studies to complement endogenous protein studies in neurons. ( k ) Trak1 immunoprecipitates GluN2B from adult mouse brain synaptosome and light membrane fractions. Scale bars, 50μm in G, otherwise 20μm; white boxes indicate enlarged areas
Construct Pcmv6 Ac Nr1 Glun1 Gfp, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/construct pcmv6 ac nr1 glun1 gfp/product/OriGene
Average 90 stars, based on 1 article reviews
construct pcmv6 ac nr1 glun1 gfp - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
OriGene pcmv6 entry
DISC1 interacts with <t>GluN1,</t> TRAK1 associates with GluN2B. ( a ) <t>HA-GluN1</t> co-immunoprecipitates FLAG-DISC1 from transfected COS7 cells. ( b ) Upper, GluN1 cytoplasmic tail (C0-C1-C2) peptide array hybridised with Flag-DISC1. Each spot represents a single peptide. red, black and green text marks the C0, C1 and C2 cassettes respectively. ER retention signals are in bold. ( c ) FLAG-DISC1 co-immunoprecipitates GST-tagged C0-C1-C2. ( d ) DISC1 peptide array probed with FLAG-C0-C1-C2. ( e ) DISC1 361-385 GluN1 binding region alanine scan probed with FLAG-C0-C1-C2. C, unmutated peptide. ( f ) HA-GluN1 co-immunoprecipitates GST-DISC1 amino acids 358-499 from transfected COS7 cells. ( g ) Co-localisation of FLAG-DISC1 and endogenous GluN1 in cultured DIV8 and DIV14 hippocampal neurons. Arrowheads and arrows indicate example sites of colocalisation. ( h ) COS7 cells transfected with GluN1 or HA-GluN2B expression constructs were labelled with antibodies specific for GluN1 or HA, plus the ER marker Calreticulin. ( i ) COS7 cells co-transfected with FLAG-TRAK1 plus GluN1 (left) or HA-GluN2B (right) expression constructs were labelled using antibodies specific for GluN1 or HA, plus antiFLAG and the mitochondrial dye Mitotracker CMXRos. ( j ) COS7 cells triple-transfected with FLAG-TRAK1, GluN1 plus HA-GluN2B expression constructs were labelled using antibodies specific for GluN1, HA and FLAG, plus Mitotracker CMXRos. COS7 cells were used because they are ideal for exogenous protein expression due to their high transfection efficiency, large size and low profile, which facilitate co-immunoprecipitation and colocalisation studies to complement endogenous protein studies in neurons. ( k ) Trak1 immunoprecipitates GluN2B from adult mouse brain synaptosome and light membrane fractions. Scale bars, 50μm in G, otherwise 20μm; white boxes indicate enlarged areas
Pcmv6 Entry, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcmv6 entry/product/OriGene
Average 90 stars, based on 1 article reviews
pcmv6 entry - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

94
Proteintech 1 ap nr1 polyclonal antibody proteintech
DISC1 interacts with <t>GluN1,</t> TRAK1 associates with GluN2B. ( a ) <t>HA-GluN1</t> co-immunoprecipitates FLAG-DISC1 from transfected COS7 cells. ( b ) Upper, GluN1 cytoplasmic tail (C0-C1-C2) peptide array hybridised with Flag-DISC1. Each spot represents a single peptide. red, black and green text marks the C0, C1 and C2 cassettes respectively. ER retention signals are in bold. ( c ) FLAG-DISC1 co-immunoprecipitates GST-tagged C0-C1-C2. ( d ) DISC1 peptide array probed with FLAG-C0-C1-C2. ( e ) DISC1 361-385 GluN1 binding region alanine scan probed with FLAG-C0-C1-C2. C, unmutated peptide. ( f ) HA-GluN1 co-immunoprecipitates GST-DISC1 amino acids 358-499 from transfected COS7 cells. ( g ) Co-localisation of FLAG-DISC1 and endogenous GluN1 in cultured DIV8 and DIV14 hippocampal neurons. Arrowheads and arrows indicate example sites of colocalisation. ( h ) COS7 cells transfected with GluN1 or HA-GluN2B expression constructs were labelled with antibodies specific for GluN1 or HA, plus the ER marker Calreticulin. ( i ) COS7 cells co-transfected with FLAG-TRAK1 plus GluN1 (left) or HA-GluN2B (right) expression constructs were labelled using antibodies specific for GluN1 or HA, plus antiFLAG and the mitochondrial dye Mitotracker CMXRos. ( j ) COS7 cells triple-transfected with FLAG-TRAK1, GluN1 plus HA-GluN2B expression constructs were labelled using antibodies specific for GluN1, HA and FLAG, plus Mitotracker CMXRos. COS7 cells were used because they are ideal for exogenous protein expression due to their high transfection efficiency, large size and low profile, which facilitate co-immunoprecipitation and colocalisation studies to complement endogenous protein studies in neurons. ( k ) Trak1 immunoprecipitates GluN2B from adult mouse brain synaptosome and light membrane fractions. Scale bars, 50μm in G, otherwise 20μm; white boxes indicate enlarged areas
1 Ap Nr1 Polyclonal Antibody Proteintech, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1 ap nr1 polyclonal antibody proteintech/product/Proteintech
Average 94 stars, based on 1 article reviews
1 ap nr1 polyclonal antibody proteintech - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

90
OriGene human grin1 gene transcript variant nr1 3
DISC1 interacts with <t>GluN1,</t> TRAK1 associates with GluN2B. ( a ) <t>HA-GluN1</t> co-immunoprecipitates FLAG-DISC1 from transfected COS7 cells. ( b ) Upper, GluN1 cytoplasmic tail (C0-C1-C2) peptide array hybridised with Flag-DISC1. Each spot represents a single peptide. red, black and green text marks the C0, C1 and C2 cassettes respectively. ER retention signals are in bold. ( c ) FLAG-DISC1 co-immunoprecipitates GST-tagged C0-C1-C2. ( d ) DISC1 peptide array probed with FLAG-C0-C1-C2. ( e ) DISC1 361-385 GluN1 binding region alanine scan probed with FLAG-C0-C1-C2. C, unmutated peptide. ( f ) HA-GluN1 co-immunoprecipitates GST-DISC1 amino acids 358-499 from transfected COS7 cells. ( g ) Co-localisation of FLAG-DISC1 and endogenous GluN1 in cultured DIV8 and DIV14 hippocampal neurons. Arrowheads and arrows indicate example sites of colocalisation. ( h ) COS7 cells transfected with GluN1 or HA-GluN2B expression constructs were labelled with antibodies specific for GluN1 or HA, plus the ER marker Calreticulin. ( i ) COS7 cells co-transfected with FLAG-TRAK1 plus GluN1 (left) or HA-GluN2B (right) expression constructs were labelled using antibodies specific for GluN1 or HA, plus antiFLAG and the mitochondrial dye Mitotracker CMXRos. ( j ) COS7 cells triple-transfected with FLAG-TRAK1, GluN1 plus HA-GluN2B expression constructs were labelled using antibodies specific for GluN1, HA and FLAG, plus Mitotracker CMXRos. COS7 cells were used because they are ideal for exogenous protein expression due to their high transfection efficiency, large size and low profile, which facilitate co-immunoprecipitation and colocalisation studies to complement endogenous protein studies in neurons. ( k ) Trak1 immunoprecipitates GluN2B from adult mouse brain synaptosome and light membrane fractions. Scale bars, 50μm in G, otherwise 20μm; white boxes indicate enlarged areas
Human Grin1 Gene Transcript Variant Nr1 3, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human grin1 gene transcript variant nr1 3/product/OriGene
Average 90 stars, based on 1 article reviews
human grin1 gene transcript variant nr1 3 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

88
Biorbyt murine anti nr1 apc mab
DISC1 interacts with <t>GluN1,</t> TRAK1 associates with GluN2B. ( a ) <t>HA-GluN1</t> co-immunoprecipitates FLAG-DISC1 from transfected COS7 cells. ( b ) Upper, GluN1 cytoplasmic tail (C0-C1-C2) peptide array hybridised with Flag-DISC1. Each spot represents a single peptide. red, black and green text marks the C0, C1 and C2 cassettes respectively. ER retention signals are in bold. ( c ) FLAG-DISC1 co-immunoprecipitates GST-tagged C0-C1-C2. ( d ) DISC1 peptide array probed with FLAG-C0-C1-C2. ( e ) DISC1 361-385 GluN1 binding region alanine scan probed with FLAG-C0-C1-C2. C, unmutated peptide. ( f ) HA-GluN1 co-immunoprecipitates GST-DISC1 amino acids 358-499 from transfected COS7 cells. ( g ) Co-localisation of FLAG-DISC1 and endogenous GluN1 in cultured DIV8 and DIV14 hippocampal neurons. Arrowheads and arrows indicate example sites of colocalisation. ( h ) COS7 cells transfected with GluN1 or HA-GluN2B expression constructs were labelled with antibodies specific for GluN1 or HA, plus the ER marker Calreticulin. ( i ) COS7 cells co-transfected with FLAG-TRAK1 plus GluN1 (left) or HA-GluN2B (right) expression constructs were labelled using antibodies specific for GluN1 or HA, plus antiFLAG and the mitochondrial dye Mitotracker CMXRos. ( j ) COS7 cells triple-transfected with FLAG-TRAK1, GluN1 plus HA-GluN2B expression constructs were labelled using antibodies specific for GluN1, HA and FLAG, plus Mitotracker CMXRos. COS7 cells were used because they are ideal for exogenous protein expression due to their high transfection efficiency, large size and low profile, which facilitate co-immunoprecipitation and colocalisation studies to complement endogenous protein studies in neurons. ( k ) Trak1 immunoprecipitates GluN2B from adult mouse brain synaptosome and light membrane fractions. Scale bars, 50μm in G, otherwise 20μm; white boxes indicate enlarged areas
Murine Anti Nr1 Apc Mab, supplied by Biorbyt, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/murine anti nr1 apc mab/product/Biorbyt
Average 88 stars, based on 1 article reviews
murine anti nr1 apc mab - by Bioz Stars, 2026-06
88/100 stars
  Buy from Supplier

Image Search Results


Fig. 4. Western blot analysis of NMDA receptors in the hippocampus of control and CsA-treated rats. (A) Representative images of the levels of total (pan) GluN2, GluN2A, GluN2B, p-GluN1 (Ser897) and total GluN1. (B-F) Respective quantifications of immunodetections normalized to β-actin and presented as a percentage of the control mean. Data represent the mean ± SEM. Statistics: ** *p ≤0.001 as determined by Student’s t-test; n = 6.

Journal: Journal of Affective Disorders Reports

Article Title: Long-term cyclosporine A treatment promotes anxiety-like behavior: Possible relation with glutamate signaling in rat hippocampus

doi: 10.1016/j.jadr.2022.100394

Figure Lengend Snippet: Fig. 4. Western blot analysis of NMDA receptors in the hippocampus of control and CsA-treated rats. (A) Representative images of the levels of total (pan) GluN2, GluN2A, GluN2B, p-GluN1 (Ser897) and total GluN1. (B-F) Respective quantifications of immunodetections normalized to β-actin and presented as a percentage of the control mean. Data represent the mean ± SEM. Statistics: ** *p ≤0.001 as determined by Student’s t-test; n = 6.

Article Snippet: The utilized primary antibodies and respective dilutions were as follows: anti-AMPAR (1:500, #13185 Cell Signaling Technology), phosphorylated AMPAR (pAMPAR-S831) (1:1000, A4352-Sigma–Aldrich), pAMPAR (S845) (1:1000, #8084 – Cell Signaling Technology), GluN1 (1:750, #G8913 – Sigma–Aldrich), pan-GluN2 (1:750, 244-0P – SYSY Synaptic Systems), GluN2A (1:1000, #4205 - Cell Signaling Technology), GluN2B (1:1000, #4207 - Cell Signaling Technology), pGluN1 (Ser897) (1:500, 3385S – Cell Signaling Technology), nNOS (1:500, SC648 – Santa Cruz Biotechnology), and iNOS (1:750, SC7271 – Santa Cruz Biotechnology). β-actin antibody (1:5000, A5441 – Sigma-Aldrich) was used as a loading control in the experiments.

Techniques: Western Blot, Control

DISC1 interacts with GluN1, TRAK1 associates with GluN2B. ( a ) HA-GluN1 co-immunoprecipitates FLAG-DISC1 from transfected COS7 cells. ( b ) Upper, GluN1 cytoplasmic tail (C0-C1-C2) peptide array hybridised with Flag-DISC1. Each spot represents a single peptide. red, black and green text marks the C0, C1 and C2 cassettes respectively. ER retention signals are in bold. ( c ) FLAG-DISC1 co-immunoprecipitates GST-tagged C0-C1-C2. ( d ) DISC1 peptide array probed with FLAG-C0-C1-C2. ( e ) DISC1 361-385 GluN1 binding region alanine scan probed with FLAG-C0-C1-C2. C, unmutated peptide. ( f ) HA-GluN1 co-immunoprecipitates GST-DISC1 amino acids 358-499 from transfected COS7 cells. ( g ) Co-localisation of FLAG-DISC1 and endogenous GluN1 in cultured DIV8 and DIV14 hippocampal neurons. Arrowheads and arrows indicate example sites of colocalisation. ( h ) COS7 cells transfected with GluN1 or HA-GluN2B expression constructs were labelled with antibodies specific for GluN1 or HA, plus the ER marker Calreticulin. ( i ) COS7 cells co-transfected with FLAG-TRAK1 plus GluN1 (left) or HA-GluN2B (right) expression constructs were labelled using antibodies specific for GluN1 or HA, plus antiFLAG and the mitochondrial dye Mitotracker CMXRos. ( j ) COS7 cells triple-transfected with FLAG-TRAK1, GluN1 plus HA-GluN2B expression constructs were labelled using antibodies specific for GluN1, HA and FLAG, plus Mitotracker CMXRos. COS7 cells were used because they are ideal for exogenous protein expression due to their high transfection efficiency, large size and low profile, which facilitate co-immunoprecipitation and colocalisation studies to complement endogenous protein studies in neurons. ( k ) Trak1 immunoprecipitates GluN2B from adult mouse brain synaptosome and light membrane fractions. Scale bars, 50μm in G, otherwise 20μm; white boxes indicate enlarged areas

Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: DISC1 interacts with GluN1, TRAK1 associates with GluN2B. ( a ) HA-GluN1 co-immunoprecipitates FLAG-DISC1 from transfected COS7 cells. ( b ) Upper, GluN1 cytoplasmic tail (C0-C1-C2) peptide array hybridised with Flag-DISC1. Each spot represents a single peptide. red, black and green text marks the C0, C1 and C2 cassettes respectively. ER retention signals are in bold. ( c ) FLAG-DISC1 co-immunoprecipitates GST-tagged C0-C1-C2. ( d ) DISC1 peptide array probed with FLAG-C0-C1-C2. ( e ) DISC1 361-385 GluN1 binding region alanine scan probed with FLAG-C0-C1-C2. C, unmutated peptide. ( f ) HA-GluN1 co-immunoprecipitates GST-DISC1 amino acids 358-499 from transfected COS7 cells. ( g ) Co-localisation of FLAG-DISC1 and endogenous GluN1 in cultured DIV8 and DIV14 hippocampal neurons. Arrowheads and arrows indicate example sites of colocalisation. ( h ) COS7 cells transfected with GluN1 or HA-GluN2B expression constructs were labelled with antibodies specific for GluN1 or HA, plus the ER marker Calreticulin. ( i ) COS7 cells co-transfected with FLAG-TRAK1 plus GluN1 (left) or HA-GluN2B (right) expression constructs were labelled using antibodies specific for GluN1 or HA, plus antiFLAG and the mitochondrial dye Mitotracker CMXRos. ( j ) COS7 cells triple-transfected with FLAG-TRAK1, GluN1 plus HA-GluN2B expression constructs were labelled using antibodies specific for GluN1, HA and FLAG, plus Mitotracker CMXRos. COS7 cells were used because they are ideal for exogenous protein expression due to their high transfection efficiency, large size and low profile, which facilitate co-immunoprecipitation and colocalisation studies to complement endogenous protein studies in neurons. ( k ) Trak1 immunoprecipitates GluN2B from adult mouse brain synaptosome and light membrane fractions. Scale bars, 50μm in G, otherwise 20μm; white boxes indicate enlarged areas

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Transfection, Peptide Microarray, Binding Assay, Cell Culture, Expressing, Construct, Marker, Immunoprecipitation

Altered distal dendritic NMDAR trafficking in Disc1 Der1/Der1 hippocampal neurons. ( a ) Green Dendra2 fluorescence in dendrites of a DIV8 mouse hippocampal neuron transfected with GluN1-Dendra2 plus HA-GluN2B. Scale bar, 5μm ( b )( c ) Mean red fluorescence intensity, b, or ROI dendritic length, c, in the central bin in Disc1 wt/wt and Disc1 Der1/Der1 DIV8 neurons was equal at time zero following photoconversion. ( d ) Quantification of fluorescence intensity over time in successive 5μm dendritic bins distal to the centre of the photoconversion ROI. Data analysed by timepoint-paired two tailed t-test. ( e ) Model of dendritic GluN1-Dendra2 motility. Photoconverted GluN1-Dendra2 progresses in a wave-like fashion, with the fastest and slowest moving GluN1-Dendra2 at the leading and trailing edges, respectively, and the bulk travelling as the ‘crest’. ( f ) Fluorescence peak velocity estimates for the 10μm and 15μm bins. Average time to peak fluorescence was converted to velocity, indicated above each bar. Average velocities were determined from the two bins. ( g ) Fast-moving GluN1-Dendra2 maximum velocity estimates for the 25μm-40μm bins. Average time to fluorescence appearance was converted to velocity, indicated above each bar. Average velocities were determined from the four bins. WT, Disc1 wt/wt ; HOM, Disc1 Der1/Der1 ; error bars represent SEM; **** p<0.0001; *** p<0.001; ** p<0.01; *p<0.05; n indicated on graphs

Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: Altered distal dendritic NMDAR trafficking in Disc1 Der1/Der1 hippocampal neurons. ( a ) Green Dendra2 fluorescence in dendrites of a DIV8 mouse hippocampal neuron transfected with GluN1-Dendra2 plus HA-GluN2B. Scale bar, 5μm ( b )( c ) Mean red fluorescence intensity, b, or ROI dendritic length, c, in the central bin in Disc1 wt/wt and Disc1 Der1/Der1 DIV8 neurons was equal at time zero following photoconversion. ( d ) Quantification of fluorescence intensity over time in successive 5μm dendritic bins distal to the centre of the photoconversion ROI. Data analysed by timepoint-paired two tailed t-test. ( e ) Model of dendritic GluN1-Dendra2 motility. Photoconverted GluN1-Dendra2 progresses in a wave-like fashion, with the fastest and slowest moving GluN1-Dendra2 at the leading and trailing edges, respectively, and the bulk travelling as the ‘crest’. ( f ) Fluorescence peak velocity estimates for the 10μm and 15μm bins. Average time to peak fluorescence was converted to velocity, indicated above each bar. Average velocities were determined from the two bins. ( g ) Fast-moving GluN1-Dendra2 maximum velocity estimates for the 25μm-40μm bins. Average time to fluorescence appearance was converted to velocity, indicated above each bar. Average velocities were determined from the four bins. WT, Disc1 wt/wt ; HOM, Disc1 Der1/Der1 ; error bars represent SEM; **** p<0.0001; *** p<0.001; ** p<0.01; *p<0.05; n indicated on graphs

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Fluorescence, Transfection, Two Tailed Test

NMDAR trafficking assay controls and analysis of photoconverted GluN1-Dendra2 movement along a dendrite. ( a ) Endogenous GluN1 detected in wild-type DIV8 hippocampal neurons by immunofluorescence exhibits a fine granular appearance. scale bar, 15μm ( b ) GluN1-Dendra2 (native green Dendra2 fluorescence) co-localises withendogenous PSD95 in DIV14 hippocampal neurons within dendritic spines. scale bar, 20μm, arrowheads point to synapses ( c )( d ) Green fluorescent (non photoconverted) and red fluorescent (photoconverted) GluN1-Dendra2 in the first image frame captured after photoconversion. scale bars in c-j, 50μm ( e ) The dendrite area to be analysed is defined by a segmentation mask (green) applied on the green channel. ( f ) The area delimited by the segmentation mask is shown as a green line in the corresponding red channel image. Only the intensity of the red pixels located within the segmentation mask is measured. ( g ) A ‘skeleton’ (white line) corresponding to the longitudinal axis of the primary dendrite and all its branches is superimposed on the red image, providing a guide along which the algorithm will quantify the intensity of the red pixels. ( h ) At the start of the analysis, the analysis circle (white circle, 10μm in diameter) is placed on the geometric centre of the photoconversion ROI. Red pixels delimited by the intersection of the measuring circle with the dendrite outline (green) are measured through the time series. ( i ) The analysis circle moves one step along the dendrite in the distal direction. The new position of the centre of the analysis circle is defined by the intersection point between its previous position (dotted circle) and the dendrite skeleton (white line). The previous position of the circle (dotted circle) has been measured, and the corresponding data have been deleted. ( j ) Once the measuring circle has covered the entire dendritic area included in the image, an image showing all generated segments and their distance (in pixels) from the geometric centre of the photoconversion ROI is displayed. Mean intensity measured in all subsequent segments is normalised to the mean intensity measured in this first segment. ( k ) Example fluorescence intensity plot from a 5μm bin where fluorescence peaked within the 10 seconds prior to imaging onset. ( l ) 15μm bin where fluorescence peaked within the imaging period. ( m ) 25μm bin where fluorescence increased steadily because the peak was not reached during the imaging period. ( n ) 25μm bin where fluorescence appearance above background was delayed for 90s. This plot illustrates the use of sigmoidal curves to identify when fluorescence appears, as indicated by the arrow. Yellow rectangles represent the photoconversion ROI (14μm wide on average); red dots indicate the geometric centre of the photoconversion ROI; white rectangles indicate enlarged areas

Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: NMDAR trafficking assay controls and analysis of photoconverted GluN1-Dendra2 movement along a dendrite. ( a ) Endogenous GluN1 detected in wild-type DIV8 hippocampal neurons by immunofluorescence exhibits a fine granular appearance. scale bar, 15μm ( b ) GluN1-Dendra2 (native green Dendra2 fluorescence) co-localises withendogenous PSD95 in DIV14 hippocampal neurons within dendritic spines. scale bar, 20μm, arrowheads point to synapses ( c )( d ) Green fluorescent (non photoconverted) and red fluorescent (photoconverted) GluN1-Dendra2 in the first image frame captured after photoconversion. scale bars in c-j, 50μm ( e ) The dendrite area to be analysed is defined by a segmentation mask (green) applied on the green channel. ( f ) The area delimited by the segmentation mask is shown as a green line in the corresponding red channel image. Only the intensity of the red pixels located within the segmentation mask is measured. ( g ) A ‘skeleton’ (white line) corresponding to the longitudinal axis of the primary dendrite and all its branches is superimposed on the red image, providing a guide along which the algorithm will quantify the intensity of the red pixels. ( h ) At the start of the analysis, the analysis circle (white circle, 10μm in diameter) is placed on the geometric centre of the photoconversion ROI. Red pixels delimited by the intersection of the measuring circle with the dendrite outline (green) are measured through the time series. ( i ) The analysis circle moves one step along the dendrite in the distal direction. The new position of the centre of the analysis circle is defined by the intersection point between its previous position (dotted circle) and the dendrite skeleton (white line). The previous position of the circle (dotted circle) has been measured, and the corresponding data have been deleted. ( j ) Once the measuring circle has covered the entire dendritic area included in the image, an image showing all generated segments and their distance (in pixels) from the geometric centre of the photoconversion ROI is displayed. Mean intensity measured in all subsequent segments is normalised to the mean intensity measured in this first segment. ( k ) Example fluorescence intensity plot from a 5μm bin where fluorescence peaked within the 10 seconds prior to imaging onset. ( l ) 15μm bin where fluorescence peaked within the imaging period. ( m ) 25μm bin where fluorescence increased steadily because the peak was not reached during the imaging period. ( n ) 25μm bin where fluorescence appearance above background was delayed for 90s. This plot illustrates the use of sigmoidal curves to identify when fluorescence appears, as indicated by the arrow. Yellow rectangles represent the photoconversion ROI (14μm wide on average); red dots indicate the geometric centre of the photoconversion ROI; white rectangles indicate enlarged areas

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Immunofluorescence, Fluorescence, Generated, Imaging

Altered distal dendritic NMDAR trafficking in mouse hippocampal neurons overexpressing DISC1 or DISC1-37W. ( a )( b ) Mean red fluorescence intensity, b, or ROIdendritic length, c, in the central bin in Disc1 wt/wt and Disc1 Der1/Der1 DIV8 neurons was equal at time zero following photoconversion. ( c ) Quantification of fluorescence intensity over time in successive 5μm dendritic bins distal to the centre of the photoconversion ROI. Data analysed by timepoint-paired two tailed t-test. ( d ) Model of dendritic GluN1-Dendra2 motility. Photoconverted GluN1-Dendra2 progresses in a wave-like fashion, with the fastest and slowest moving GluN1-Dendra2 at the leading and trailing edges, respectively, and the bulk travelling as the ‘crest’. ( e ) Fluorescence peak velocity estimates for the 10μm and 15μm bins. Average time to peak fluorescence was converted to velocity, indicated above each bar. Average velocities were determined from the two bins. ( f ) Fast-moving GluN1-Dendra2 maximum velocity estimates for the 25μm-40μm bins. Average time to fluorescence appearance was converted to velocity, indicated above each bar. Average velocities were determined from the four bins. error bars represent SEM; **** p<0.0001; *** p<0.001; ** p<0.01; *p<0.05; n indicated on graphs

Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: Altered distal dendritic NMDAR trafficking in mouse hippocampal neurons overexpressing DISC1 or DISC1-37W. ( a )( b ) Mean red fluorescence intensity, b, or ROIdendritic length, c, in the central bin in Disc1 wt/wt and Disc1 Der1/Der1 DIV8 neurons was equal at time zero following photoconversion. ( c ) Quantification of fluorescence intensity over time in successive 5μm dendritic bins distal to the centre of the photoconversion ROI. Data analysed by timepoint-paired two tailed t-test. ( d ) Model of dendritic GluN1-Dendra2 motility. Photoconverted GluN1-Dendra2 progresses in a wave-like fashion, with the fastest and slowest moving GluN1-Dendra2 at the leading and trailing edges, respectively, and the bulk travelling as the ‘crest’. ( e ) Fluorescence peak velocity estimates for the 10μm and 15μm bins. Average time to peak fluorescence was converted to velocity, indicated above each bar. Average velocities were determined from the two bins. ( f ) Fast-moving GluN1-Dendra2 maximum velocity estimates for the 25μm-40μm bins. Average time to fluorescence appearance was converted to velocity, indicated above each bar. Average velocities were determined from the four bins. error bars represent SEM; **** p<0.0001; *** p<0.001; ** p<0.01; *p<0.05; n indicated on graphs

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Fluorescence, Two Tailed Test

Altered proximal dendritic GluN1-Dendra2 motility due to DISC1 overexpression or the Der1 mutation. ( a ) Effect of DISC1 overexpression. Quantification of fluorescence intensity over time in successive 5μm dendritic bins proximal to the centre of the photoconversion ROI. Mean fluorescence intensity at each time point within each bin is normalised to mean fluorescence intensity in the central bin at time zero per neuron. Total neuron numbers from three independent cultures are indicated. To determine whether fluorescence intensity differed between the expression constructs within each bin, data were analysed by Friedman repeated measures test (p<0.0001, p<0.0001, p<0.0001, p=0.0008, p<0.0001, p=0.02, p<0.0001, for the 5μm to 35μm bins, respectively) with Dunn’s post-hoc testing. ( b ) Model of dendritic GluN1-Dendra2 motility as described in . Total neuron numbers from three independent cultures are indicated. EV, empty vector; DISC1, wild-type DISC1; 37W, DISC1-37W; error bars represent SEM; *** p<0.001; ** p<0.01; *p<0.05 ( c ) Effect of the Der1 mutation. Quantification of fluorescence intensity over time in successive 5μm bins proximal to the centre of the photoconversion ROI. Mean fluorescence intensity at each time point within each bin is normalised to mean fluorescence intensity in the central bin at time zero per neuron. Total neuron numbers from three independent cultures are indicated. To determine whether fluorescence intensity differed between the genotypes within each bin, data were analysed by paired two tailed t-test to make comparisons at each timepoint. ( d ) Model of dendritic GluN1-Dendra2 motility as described in . WT, Disc1 wt/wt ; HOM, Disc1 Der1/Der1 ; error bars represent SEM, **** p<0.0001, ** p<0.01, * p<0.05, ns not significant

Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: Altered proximal dendritic GluN1-Dendra2 motility due to DISC1 overexpression or the Der1 mutation. ( a ) Effect of DISC1 overexpression. Quantification of fluorescence intensity over time in successive 5μm dendritic bins proximal to the centre of the photoconversion ROI. Mean fluorescence intensity at each time point within each bin is normalised to mean fluorescence intensity in the central bin at time zero per neuron. Total neuron numbers from three independent cultures are indicated. To determine whether fluorescence intensity differed between the expression constructs within each bin, data were analysed by Friedman repeated measures test (p<0.0001, p<0.0001, p<0.0001, p=0.0008, p<0.0001, p=0.02, p<0.0001, for the 5μm to 35μm bins, respectively) with Dunn’s post-hoc testing. ( b ) Model of dendritic GluN1-Dendra2 motility as described in . Total neuron numbers from three independent cultures are indicated. EV, empty vector; DISC1, wild-type DISC1; 37W, DISC1-37W; error bars represent SEM; *** p<0.001; ** p<0.01; *p<0.05 ( c ) Effect of the Der1 mutation. Quantification of fluorescence intensity over time in successive 5μm bins proximal to the centre of the photoconversion ROI. Mean fluorescence intensity at each time point within each bin is normalised to mean fluorescence intensity in the central bin at time zero per neuron. Total neuron numbers from three independent cultures are indicated. To determine whether fluorescence intensity differed between the genotypes within each bin, data were analysed by paired two tailed t-test to make comparisons at each timepoint. ( d ) Model of dendritic GluN1-Dendra2 motility as described in . WT, Disc1 wt/wt ; HOM, Disc1 Der1/Der1 ; error bars represent SEM, **** p<0.0001, ** p<0.01, * p<0.05, ns not significant

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Over Expression, Mutagenesis, Fluorescence, Expressing, Construct, Plasmid Preparation, Two Tailed Test

Dendritic NMDAR and PSD95 expression in hippocampal neurons. ( a ) 3D-SIM images of surface GluN1, GluN2A or Glun2B, and total PSD95 and βIII-tubulin (Tuj1). WT, Disc1 wt/wt ; HET, Disc1 (wt)/Der1 ; HOM, Disc1 Der1/Der1 ; scale bars, 2μm in main images, 0.6μm in enlarged insets indicated by white boxes ( b ) 3D-SIM image of a dendrite segment showing PSD95 (green) and βIII-tubulin (Tuj1, magenta). Scale bar B-F, 1μm ( c ) Identification of Imaris surfaces for PSD95. These three-dimensional surfaces are counted and their volume is quantified by the software. ( d ) PSD95 surfaces split into individual nanodomains. ( e ) Identification of the centre of each individual nanodomain, and conversion to Imaris spots using a bespoke MATLAB (MathWorks) XTension script. ( f ) Individual nanodomains are assigned to clusters, and the number per cluster is counted using the Imaris spots MATLAB XTension ‘Split into Surface Objects’.

Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: Dendritic NMDAR and PSD95 expression in hippocampal neurons. ( a ) 3D-SIM images of surface GluN1, GluN2A or Glun2B, and total PSD95 and βIII-tubulin (Tuj1). WT, Disc1 wt/wt ; HET, Disc1 (wt)/Der1 ; HOM, Disc1 Der1/Der1 ; scale bars, 2μm in main images, 0.6μm in enlarged insets indicated by white boxes ( b ) 3D-SIM image of a dendrite segment showing PSD95 (green) and βIII-tubulin (Tuj1, magenta). Scale bar B-F, 1μm ( c ) Identification of Imaris surfaces for PSD95. These three-dimensional surfaces are counted and their volume is quantified by the software. ( d ) PSD95 surfaces split into individual nanodomains. ( e ) Identification of the centre of each individual nanodomain, and conversion to Imaris spots using a bespoke MATLAB (MathWorks) XTension script. ( f ) Individual nanodomains are assigned to clusters, and the number per cluster is counted using the Imaris spots MATLAB XTension ‘Split into Surface Objects’.

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Expressing, Software

Altered dendritic NMDAR surface expression and GluN1 localisation to the post-synaptic density in Disc1 wt/Der1 and Disc1 Der1/Der1 hippocampal neurons. ( a ) Objects in 3D-SIM images visualised using the Imaris Isosurface tool. Touching objects are separated, with boundary lines between touching objects visible in the enlarged images. scale bars, 2μm in the full-size images, 0.6μm in enlarged insets indicated by white boxes ( b ) GluN1, GluN2A or GluN2B surface puncta density, total surface volume and individual surface puncta volume (all normalised to dendritic segment volume) from 3D reconstructions of primary dendrite segments of cultured DIV21 hippocampal neurons. Data analysed by Kruskal-Wallis (puncta density p=0.02, p=0.03, p=0.0004, total volume p=0.0025, p=0.4, p=0.003, puncta volume p=0.003, p<0.0001, p<0.0001 for GluN1, GluN2A and GluN2B respectively) followed by Dunn’s multiple comparison test. ( c ) Reconstructed 3D-SIM images of dendrites. Colocalised voxels, which contain signal from both PSD95 and surface-expressed GluN1 are shown in white. Scale bars, 3μm ( d ) GluN1 co-localisation with the PSD95 was evaluated on three measures. Pearson’s and Mander’s coefficients respectively indicate overall correlation of each signal or amount of GluN1 signal co-localised with PSD95 signal, and vice versa. Data analysed by Kruskal-Wallis (p=0.004, p=0.08, p=0.001 for Pearson’s, Mander’s M1 and Mander’s M2) followed by Dunn’s multiple comparison test. WT, Disc1 wt/wt ; HET, Disc1 wt/Der1 ; HOM, Disc1 Der1/Der1 ; error bars represent SEM; *** p<0.001; ** p<0.01; * p<0.05; n indicated on graphs

Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: Altered dendritic NMDAR surface expression and GluN1 localisation to the post-synaptic density in Disc1 wt/Der1 and Disc1 Der1/Der1 hippocampal neurons. ( a ) Objects in 3D-SIM images visualised using the Imaris Isosurface tool. Touching objects are separated, with boundary lines between touching objects visible in the enlarged images. scale bars, 2μm in the full-size images, 0.6μm in enlarged insets indicated by white boxes ( b ) GluN1, GluN2A or GluN2B surface puncta density, total surface volume and individual surface puncta volume (all normalised to dendritic segment volume) from 3D reconstructions of primary dendrite segments of cultured DIV21 hippocampal neurons. Data analysed by Kruskal-Wallis (puncta density p=0.02, p=0.03, p=0.0004, total volume p=0.0025, p=0.4, p=0.003, puncta volume p=0.003, p<0.0001, p<0.0001 for GluN1, GluN2A and GluN2B respectively) followed by Dunn’s multiple comparison test. ( c ) Reconstructed 3D-SIM images of dendrites. Colocalised voxels, which contain signal from both PSD95 and surface-expressed GluN1 are shown in white. Scale bars, 3μm ( d ) GluN1 co-localisation with the PSD95 was evaluated on three measures. Pearson’s and Mander’s coefficients respectively indicate overall correlation of each signal or amount of GluN1 signal co-localised with PSD95 signal, and vice versa. Data analysed by Kruskal-Wallis (p=0.004, p=0.08, p=0.001 for Pearson’s, Mander’s M1 and Mander’s M2) followed by Dunn’s multiple comparison test. WT, Disc1 wt/wt ; HET, Disc1 wt/Der1 ; HOM, Disc1 Der1/Der1 ; error bars represent SEM; *** p<0.001; ** p<0.01; * p<0.05; n indicated on graphs

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Expressing, Cell Culture

NMDAR subunit GluN2A and GluN2B co-localisation with the post-synaptic density marker PSD95. ( a ) Reconstructed 3D-SIM images of dendrites. Colocalised voxels, which contain signal from both PSD95 and surface-expressed GluN1 are shown in white. White boxes indicate enlarged regions. Scale bars, 3μm ( b ) Pearson’s coefficient indicates overall correlation of each signal. Mander’s coefficients measure the amount of subunit fluorescent signal co-localised with total PSD95 signal, and vice versa. Data were analysed by Kruskal-Wallis (p=0.02 for GluN2A Mander’s M1, p=0.06 for GluN2B Mander’s M1) followed by Dunn’s multiple comparison test. WT, Disc1 wt/wt ; HET, Disc1 (wt)/Der1 ; HOM, Disc1 Der1/Der1 ; error bars represent SEM; * p<0.05 ( c ) Immunoblots of hippocampus lysates were prepared from nine week mice, and probed with antibodies specific for GluN1. GluN2A and GluN2B NMDAR subunits, followed by loading controls Gapdh and Vcl. Subunit expression relative to the loading controls was quantified using densitometry. Data were analysed by Kruskal-Wallis test and no significant differences were found WT, Disc1 wt/wt ; HET, Disc1 (wt)/Der(1) ; HOM, Disc1 Der(1)/Der(1) ; error bars represent SEM; n indicated on graphs

Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: NMDAR subunit GluN2A and GluN2B co-localisation with the post-synaptic density marker PSD95. ( a ) Reconstructed 3D-SIM images of dendrites. Colocalised voxels, which contain signal from both PSD95 and surface-expressed GluN1 are shown in white. White boxes indicate enlarged regions. Scale bars, 3μm ( b ) Pearson’s coefficient indicates overall correlation of each signal. Mander’s coefficients measure the amount of subunit fluorescent signal co-localised with total PSD95 signal, and vice versa. Data were analysed by Kruskal-Wallis (p=0.02 for GluN2A Mander’s M1, p=0.06 for GluN2B Mander’s M1) followed by Dunn’s multiple comparison test. WT, Disc1 wt/wt ; HET, Disc1 (wt)/Der1 ; HOM, Disc1 Der1/Der1 ; error bars represent SEM; * p<0.05 ( c ) Immunoblots of hippocampus lysates were prepared from nine week mice, and probed with antibodies specific for GluN1. GluN2A and GluN2B NMDAR subunits, followed by loading controls Gapdh and Vcl. Subunit expression relative to the loading controls was quantified using densitometry. Data were analysed by Kruskal-Wallis test and no significant differences were found WT, Disc1 wt/wt ; HET, Disc1 (wt)/Der(1) ; HOM, Disc1 Der(1)/Der(1) ; error bars represent SEM; n indicated on graphs

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Marker, Western Blot, Expressing