genotyping Search Results


99
Transnetyx genotyping
Genotyping, supplied by Transnetyx, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping/Automated+Genotyping/bio_rxiv__64898__2026__04__08__717296-267-0-11
Average 99 stars, based on 1 article reviews
genotyping - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

96
Fujirebio Inc inno lipa hpv genotyping extra ii
Inno Lipa Hpv Genotyping Extra Ii, supplied by Fujirebio Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping/INNO-LiPA+HPV+Genotyping+Extra+II/nct04167501-15-5-10
Average 96 stars, based on 1 article reviews
inno lipa hpv genotyping extra ii - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

86
Eurofins lck cre fw tgcaacgagtgatgaggttc eurofins genotyping
Lck Cre Fw Tgcaacgagtgatgaggttc Eurofins Genotyping, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping/cre+eurofins+fw+genotyping+lck+tgcaacgagtgatgaggttc/pm40460200-785-123-126
Average 86 stars, based on 1 article reviews
lck cre fw tgcaacgagtgatgaggttc eurofins genotyping - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Eurofins oligonucleotides genotyping
Oligonucleotides Genotyping, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping/genotyping/pm40460200-785-120-126
Average 86 stars, based on 1 article reviews
oligonucleotides genotyping - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

95
fluidigm bmk-m-48.48gt
Bmk M 48.48gt, supplied by fluidigm, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping/48%2E48+Dynamic+Array+IFC+for+Genotyping/pmc08319808-76-9-7
Average 95 stars, based on 1 article reviews
bmk-m-48.48gt - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

92
MACHEREY NAGEL dna nucleotype mouse pcr direct kit for genotyping
Dna Nucleotype Mouse Pcr Direct Kit For Genotyping, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping/NucleoType+Mouse+PCR%2C+DirectPCR+kit+for+genotyping+of+mouse+samples/pmc11083572-32-6-14
Average 92 stars, based on 1 article reviews
dna nucleotype mouse pcr direct kit for genotyping - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

96
Roche kapa mouse genotyping kit
Kapa Mouse Genotyping Kit, supplied by Roche, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping/KAPA+Mouse+Genotyping+Kit/10__1161_slash_atvbaha__120__314557-136-10-16
Average 96 stars, based on 1 article reviews
kapa mouse genotyping kit - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

91
fluidigm snptype genotyping reagent kit
Snptype Genotyping Reagent Kit, supplied by fluidigm, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping/SNP+Type+96%2E96+Genotyping+Reagent+Kit/10__3390_slash_horticulturae8090792-76-12-11
Average 91 stars, based on 1 article reviews
snptype genotyping reagent kit - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

95
fluidigm 96 96 dynamic array ifc

96 96 Dynamic Array Ifc, supplied by fluidigm, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping/96%2E96+Dynamic+Array+IFC+for+Genotyping/pmc08753122-70-0-5
Average 95 stars, based on 1 article reviews
96 96 dynamic array ifc - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

94
fluidigm 192 24 dynamic array integrated fluidic circuits

192 24 Dynamic Array Integrated Fluidic Circuits, supplied by fluidigm, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping/192%2E24+Dynamic+Array+IFC+for+SNP+Genotyping/pmc05645220-146-22-28
Average 94 stars, based on 1 article reviews
192 24 dynamic array integrated fluidic circuits - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

99
tiangen biotech co genotyping

Genotyping, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping/2%C3%97+Genotyping+MasterMix/pmc11738785-65-1-14
Average 99 stars, based on 1 article reviews
genotyping - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

94
Thermo Fisher genotyping lpin rs13412852

Genotyping Lpin Rs13412852, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping/Genotyping+LPIN+rs13412852/pm41751781-159-0-12
Average 94 stars, based on 1 article reviews
genotyping lpin rs13412852 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

Image Search Results


Journal: iScience

Article Title: Gene regulatory network inference in long-lived C. elegans reveals modular properties that are predictive of novel aging genes

doi: 10.1016/j.isci.2021.103663

Figure Lengend Snippet:

Article Snippet: 96.96 Dynamic Array IFC , Fluidigm , Item No. SKU 100-6173.

Techniques: Recombinant, SYBR Green Assay, Generated, Software, Blocking Assay