99
|
Transnetyx
genotyping Genotyping, supplied by Transnetyx, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/genotyping/Automated+Genotyping/bio_rxiv__64898__2026__04__08__717296-267-0-11 Average 99 stars, based on 1 article reviews
genotyping - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
96
|
Fujirebio Inc
inno lipa hpv genotyping extra ii Inno Lipa Hpv Genotyping Extra Ii, supplied by Fujirebio Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/genotyping/INNO-LiPA+HPV+Genotyping+Extra+II/nct04167501-15-5-10 Average 96 stars, based on 1 article reviews
inno lipa hpv genotyping extra ii - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
86
|
Eurofins
lck cre fw tgcaacgagtgatgaggttc eurofins genotyping Lck Cre Fw Tgcaacgagtgatgaggttc Eurofins Genotyping, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/genotyping/cre+eurofins+fw+genotyping+lck+tgcaacgagtgatgaggttc/pm40460200-785-123-126 Average 86 stars, based on 1 article reviews
lck cre fw tgcaacgagtgatgaggttc eurofins genotyping - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
86
|
Eurofins
oligonucleotides genotyping Oligonucleotides Genotyping, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/genotyping/genotyping/pm40460200-785-120-126 Average 86 stars, based on 1 article reviews
oligonucleotides genotyping - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
95
|
fluidigm
bmk-m-48.48gt Bmk M 48.48gt, supplied by fluidigm, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/genotyping/48%2E48+Dynamic+Array+IFC+for+Genotyping/pmc08319808-76-9-7 Average 95 stars, based on 1 article reviews
bmk-m-48.48gt - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
92
|
MACHEREY NAGEL
dna nucleotype mouse pcr direct kit for genotyping Dna Nucleotype Mouse Pcr Direct Kit For Genotyping, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/genotyping/NucleoType+Mouse+PCR%2C+DirectPCR+kit+for+genotyping+of+mouse+samples/pmc11083572-32-6-14 Average 92 stars, based on 1 article reviews
dna nucleotype mouse pcr direct kit for genotyping - by Bioz Stars,
2026-09
92/100 stars
|
Buy from Supplier |
96
|
Roche
kapa mouse genotyping kit Kapa Mouse Genotyping Kit, supplied by Roche, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/genotyping/KAPA+Mouse+Genotyping+Kit/10__1161_slash_atvbaha__120__314557-136-10-16 Average 96 stars, based on 1 article reviews
kapa mouse genotyping kit - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
91
|
fluidigm
snptype genotyping reagent kit Snptype Genotyping Reagent Kit, supplied by fluidigm, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/genotyping/SNP+Type+96%2E96+Genotyping+Reagent+Kit/10__3390_slash_horticulturae8090792-76-12-11 Average 91 stars, based on 1 article reviews
snptype genotyping reagent kit - by Bioz Stars,
2026-09
91/100 stars
|
Buy from Supplier |
95
|
fluidigm
96 96 dynamic array ifc ![]() 96 96 Dynamic Array Ifc, supplied by fluidigm, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/genotyping/96%2E96+Dynamic+Array+IFC+for+Genotyping/pmc08753122-70-0-5 Average 95 stars, based on 1 article reviews
96 96 dynamic array ifc - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
94
|
fluidigm
192 24 dynamic array integrated fluidic circuits ![]() 192 24 Dynamic Array Integrated Fluidic Circuits, supplied by fluidigm, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/genotyping/192%2E24+Dynamic+Array+IFC+for+SNP+Genotyping/pmc05645220-146-22-28 Average 94 stars, based on 1 article reviews
192 24 dynamic array integrated fluidic circuits - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
99
|
tiangen biotech co
genotyping ![]() Genotyping, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/genotyping/2%C3%97+Genotyping+MasterMix/pmc11738785-65-1-14 Average 99 stars, based on 1 article reviews
genotyping - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
94
|
Thermo Fisher
genotyping lpin rs13412852 ![]() Genotyping Lpin Rs13412852, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/genotyping/Genotyping+LPIN+rs13412852/pm41751781-159-0-12 Average 94 stars, based on 1 article reviews
genotyping lpin rs13412852 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
Image Search Results
Journal: iScience
Article Title: Gene regulatory network inference in long-lived C. elegans reveals modular properties that are predictive of novel aging genes
doi: 10.1016/j.isci.2021.103663
Figure Lengend Snippet:
Article Snippet:
Techniques: Recombinant, SYBR Green Assay, Generated, Software, Blocking Assay