gdf10 Search Results


86
Thermo Fisher gene exp gdf10 rn00666937 m1
Gene Exp Gdf10 Rn00666937 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp gdf10 rn00666937 m1/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
gene exp gdf10 rn00666937 m1 - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier

94
Sino Biological gdf10 fc
Hepatic <t>GDF10</t> is specifically expressed by HSCs and is downregulated in activated HSCs. A) UMAP visualization of the cell type expresses Gdf10 in the liver ( GSE218299 ). B) Cell type enrichment of GDF10 in human liver (Human Protein Atlas database). C) qPCR analysis of Gdf10 mRNA levels in LSECs, MACs, HSCs, and HCs from the normal, CCl4‐induced fibrotic, and AMLN diet‐induced fibrotic liver. D) IF staining analysis of GDF10 and Desmin protein levels in the liver, scale bars, 20 µm. E,F) UMAP visualization of the Gdf10 and Acta2 mRNA levels in the qHSCs and aHSCs, data from GSE218299 (E) and GSE171904 (F). G) Heat map representation of the indicated genes in HSCs from CCl4 treated or AMLN diet‐fed mice ( GSE134512 ). H,I) qPCR (H) ( n = 6) and IF staining (I) analysis of indicated genes in HSCs isolated from normal and CCl4‐induced fibrotic liver, scale bars, 5 µm. J,K) qPCR (J) ( n = 6) and IF staining (K) analysis of indicated genes in HSCs isolated from normal and AMLN diet‐induced fibrotic liver, scale bars, 5 µm. L,M) qPCR analysis of Desmin ( Des ) mRNA levels (normalized to 36B4) and Gdf10 and Acta2 mRNA levels (normalized to Des ) in fibrotic liver. N) Analysis of DES mRNA levels and GDF10 and ACTA2 mRNA levels (normalized to DES ) in human health and fibrotic liver tissues from dataset GSE159676 . Data are mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001 by the two‐tailed Student's t ‐test.
Gdf10 Fc, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gdf10 fc/product/Sino Biological
Average 94 stars, based on 1 article reviews
gdf10 fc - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

86
Thermo Fisher gene exp gdf10 mm00521349 m1
Hepatic <t>GDF10</t> is specifically expressed by HSCs and is downregulated in activated HSCs. A) UMAP visualization of the cell type expresses Gdf10 in the liver ( GSE218299 ). B) Cell type enrichment of GDF10 in human liver (Human Protein Atlas database). C) qPCR analysis of Gdf10 mRNA levels in LSECs, MACs, HSCs, and HCs from the normal, CCl4‐induced fibrotic, and AMLN diet‐induced fibrotic liver. D) IF staining analysis of GDF10 and Desmin protein levels in the liver, scale bars, 20 µm. E,F) UMAP visualization of the Gdf10 and Acta2 mRNA levels in the qHSCs and aHSCs, data from GSE218299 (E) and GSE171904 (F). G) Heat map representation of the indicated genes in HSCs from CCl4 treated or AMLN diet‐fed mice ( GSE134512 ). H,I) qPCR (H) ( n = 6) and IF staining (I) analysis of indicated genes in HSCs isolated from normal and CCl4‐induced fibrotic liver, scale bars, 5 µm. J,K) qPCR (J) ( n = 6) and IF staining (K) analysis of indicated genes in HSCs isolated from normal and AMLN diet‐induced fibrotic liver, scale bars, 5 µm. L,M) qPCR analysis of Desmin ( Des ) mRNA levels (normalized to 36B4) and Gdf10 and Acta2 mRNA levels (normalized to Des ) in fibrotic liver. N) Analysis of DES mRNA levels and GDF10 and ACTA2 mRNA levels (normalized to DES ) in human health and fibrotic liver tissues from dataset GSE159676 . Data are mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001 by the two‐tailed Student's t ‐test.
Gene Exp Gdf10 Mm00521349 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp gdf10 mm00521349 m1/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
gene exp gdf10 mm00521349 m1 - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier

92
R&D Systems gdf10 bmp 3b
Hepatic <t>GDF10</t> is specifically expressed by HSCs and is downregulated in activated HSCs. A) UMAP visualization of the cell type expresses Gdf10 in the liver ( GSE218299 ). B) Cell type enrichment of GDF10 in human liver (Human Protein Atlas database). C) qPCR analysis of Gdf10 mRNA levels in LSECs, MACs, HSCs, and HCs from the normal, CCl4‐induced fibrotic, and AMLN diet‐induced fibrotic liver. D) IF staining analysis of GDF10 and Desmin protein levels in the liver, scale bars, 20 µm. E,F) UMAP visualization of the Gdf10 and Acta2 mRNA levels in the qHSCs and aHSCs, data from GSE218299 (E) and GSE171904 (F). G) Heat map representation of the indicated genes in HSCs from CCl4 treated or AMLN diet‐fed mice ( GSE134512 ). H,I) qPCR (H) ( n = 6) and IF staining (I) analysis of indicated genes in HSCs isolated from normal and CCl4‐induced fibrotic liver, scale bars, 5 µm. J,K) qPCR (J) ( n = 6) and IF staining (K) analysis of indicated genes in HSCs isolated from normal and AMLN diet‐induced fibrotic liver, scale bars, 5 µm. L,M) qPCR analysis of Desmin ( Des ) mRNA levels (normalized to 36B4) and Gdf10 and Acta2 mRNA levels (normalized to Des ) in fibrotic liver. N) Analysis of DES mRNA levels and GDF10 and ACTA2 mRNA levels (normalized to DES ) in human health and fibrotic liver tissues from dataset GSE159676 . Data are mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001 by the two‐tailed Student's t ‐test.
Gdf10 Bmp 3b, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gdf10 bmp 3b/product/R&D Systems
Average 92 stars, based on 1 article reviews
gdf10 bmp 3b - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

89
Thermo Fisher gene exp gdf10 mm01220860 m1
Expression of Sost ( A ), <t>Gdf10</t> ( B ), Gli1 ( C ), Ihh ( D ), Mmp10 ( E ), and Phex ( F ) in the differentiated IDG-SW3 cells after FasL stimulation with (FasL + OPh) and without (FasL) caspase inhibition. Expression levels were compared with those in the untreated controls. The results are shown in %, indicating the mean ± standard deviation of three replicates (expression in the control cells was set to 100%).
Gene Exp Gdf10 Mm01220860 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp gdf10 mm01220860 m1/product/Thermo Fisher
Average 89 stars, based on 1 article reviews
gene exp gdf10 mm01220860 m1 - by Bioz Stars, 2026-03
89/100 stars
  Buy from Supplier

90
R&D Systems gdf 10
Expression of Sost ( A ), <t>Gdf10</t> ( B ), Gli1 ( C ), Ihh ( D ), Mmp10 ( E ), and Phex ( F ) in the differentiated IDG-SW3 cells after FasL stimulation with (FasL + OPh) and without (FasL) caspase inhibition. Expression levels were compared with those in the untreated controls. The results are shown in %, indicating the mean ± standard deviation of three replicates (expression in the control cells was set to 100%).
Gdf 10, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gdf 10/product/R&D Systems
Average 90 stars, based on 1 article reviews
gdf 10 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

92
Cusabio rabbit anti gdf10 antibody
Expression of Sost ( A ), <t>Gdf10</t> ( B ), Gli1 ( C ), Ihh ( D ), Mmp10 ( E ), and Phex ( F ) in the differentiated IDG-SW3 cells after FasL stimulation with (FasL + OPh) and without (FasL) caspase inhibition. Expression levels were compared with those in the untreated controls. The results are shown in %, indicating the mean ± standard deviation of three replicates (expression in the control cells was set to 100%).
Rabbit Anti Gdf10 Antibody, supplied by Cusabio, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit anti gdf10 antibody/product/Cusabio
Average 92 stars, based on 1 article reviews
rabbit anti gdf10 antibody - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

91
Bioss anti gdf10
Expression of Sost ( A ), <t>Gdf10</t> ( B ), Gli1 ( C ), Ihh ( D ), Mmp10 ( E ), and Phex ( F ) in the differentiated IDG-SW3 cells after FasL stimulation with (FasL + OPh) and without (FasL) caspase inhibition. Expression levels were compared with those in the untreated controls. The results are shown in %, indicating the mean ± standard deviation of three replicates (expression in the control cells was set to 100%).
Anti Gdf10, supplied by Bioss, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti gdf10/product/Bioss
Average 91 stars, based on 1 article reviews
anti gdf10 - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

90
R&D Systems human bmp 3b
Expression of Sost ( A ), <t>Gdf10</t> ( B ), Gli1 ( C ), Ihh ( D ), Mmp10 ( E ), and Phex ( F ) in the differentiated IDG-SW3 cells after FasL stimulation with (FasL + OPh) and without (FasL) caspase inhibition. Expression levels were compared with those in the untreated controls. The results are shown in %, indicating the mean ± standard deviation of three replicates (expression in the control cells was set to 100%).
Human Bmp 3b, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human bmp 3b/product/R&D Systems
Average 90 stars, based on 1 article reviews
human bmp 3b - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Proteintech gdf10
(A) RNAs from undifferentiated (Day 0) or differentiated (Day 30) osteoblasts were used in a whole-genome microarray analysis. 42 transcripts encoding secreted factors upregulated in Day 30 osteoblasts were subdivided into three groups, based on p values and false discovery rate (FDR). Fold increase is shown on right. (B) RNA levels of select TGFβ and GDF family genes during osteoblast differentiation. (C) TGFβ2 or <t>GDF10</t> expression by qRT-PCR (upper) or western blot (lower). Undifferentiated osteoblast precursor MC3T3-E1 cells were used as a control. (D) TGFβ1 RNA levels. *p < 0.01 by t test. (E) TGFβ2 and GDF10 are two of many factors upregulated and secreted by osteoblasts over 30 days of differentiation in culture.
Gdf10, supplied by Proteintech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gdf10/product/Proteintech
Average 90 stars, based on 1 article reviews
gdf10 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

86
Thermo Fisher gene exp gdf10 bt03248749 m1
(A) RNAs from undifferentiated (Day 0) or differentiated (Day 30) osteoblasts were used in a whole-genome microarray analysis. 42 transcripts encoding secreted factors upregulated in Day 30 osteoblasts were subdivided into three groups, based on p values and false discovery rate (FDR). Fold increase is shown on right. (B) RNA levels of select TGFβ and GDF family genes during osteoblast differentiation. (C) TGFβ2 or <t>GDF10</t> expression by qRT-PCR (upper) or western blot (lower). Undifferentiated osteoblast precursor MC3T3-E1 cells were used as a control. (D) TGFβ1 RNA levels. *p < 0.01 by t test. (E) TGFβ2 and GDF10 are two of many factors upregulated and secreted by osteoblasts over 30 days of differentiation in culture.
Gene Exp Gdf10 Bt03248749 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp gdf10 bt03248749 m1/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
gene exp gdf10 bt03248749 m1 - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier

88
Thermo Fisher gene exp gdf10 rn00577682 m1
Expression of growth plate cartilage zonal markers in superficial and intermediate/deep zones of articular cartilage.
Gene Exp Gdf10 Rn00577682 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp gdf10 rn00577682 m1/product/Thermo Fisher
Average 88 stars, based on 1 article reviews
gene exp gdf10 rn00577682 m1 - by Bioz Stars, 2026-03
88/100 stars
  Buy from Supplier

Image Search Results


Hepatic GDF10 is specifically expressed by HSCs and is downregulated in activated HSCs. A) UMAP visualization of the cell type expresses Gdf10 in the liver ( GSE218299 ). B) Cell type enrichment of GDF10 in human liver (Human Protein Atlas database). C) qPCR analysis of Gdf10 mRNA levels in LSECs, MACs, HSCs, and HCs from the normal, CCl4‐induced fibrotic, and AMLN diet‐induced fibrotic liver. D) IF staining analysis of GDF10 and Desmin protein levels in the liver, scale bars, 20 µm. E,F) UMAP visualization of the Gdf10 and Acta2 mRNA levels in the qHSCs and aHSCs, data from GSE218299 (E) and GSE171904 (F). G) Heat map representation of the indicated genes in HSCs from CCl4 treated or AMLN diet‐fed mice ( GSE134512 ). H,I) qPCR (H) ( n = 6) and IF staining (I) analysis of indicated genes in HSCs isolated from normal and CCl4‐induced fibrotic liver, scale bars, 5 µm. J,K) qPCR (J) ( n = 6) and IF staining (K) analysis of indicated genes in HSCs isolated from normal and AMLN diet‐induced fibrotic liver, scale bars, 5 µm. L,M) qPCR analysis of Desmin ( Des ) mRNA levels (normalized to 36B4) and Gdf10 and Acta2 mRNA levels (normalized to Des ) in fibrotic liver. N) Analysis of DES mRNA levels and GDF10 and ACTA2 mRNA levels (normalized to DES ) in human health and fibrotic liver tissues from dataset GSE159676 . Data are mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001 by the two‐tailed Student's t ‐test.

Journal: Advanced Science

Article Title: Autocrine GDF10 Inhibits Hepatic Stellate Cell Activation via BMPR2/ALK3 Receptor to Prevent Liver Fibrosis

doi: 10.1002/advs.202500616

Figure Lengend Snippet: Hepatic GDF10 is specifically expressed by HSCs and is downregulated in activated HSCs. A) UMAP visualization of the cell type expresses Gdf10 in the liver ( GSE218299 ). B) Cell type enrichment of GDF10 in human liver (Human Protein Atlas database). C) qPCR analysis of Gdf10 mRNA levels in LSECs, MACs, HSCs, and HCs from the normal, CCl4‐induced fibrotic, and AMLN diet‐induced fibrotic liver. D) IF staining analysis of GDF10 and Desmin protein levels in the liver, scale bars, 20 µm. E,F) UMAP visualization of the Gdf10 and Acta2 mRNA levels in the qHSCs and aHSCs, data from GSE218299 (E) and GSE171904 (F). G) Heat map representation of the indicated genes in HSCs from CCl4 treated or AMLN diet‐fed mice ( GSE134512 ). H,I) qPCR (H) ( n = 6) and IF staining (I) analysis of indicated genes in HSCs isolated from normal and CCl4‐induced fibrotic liver, scale bars, 5 µm. J,K) qPCR (J) ( n = 6) and IF staining (K) analysis of indicated genes in HSCs isolated from normal and AMLN diet‐induced fibrotic liver, scale bars, 5 µm. L,M) qPCR analysis of Desmin ( Des ) mRNA levels (normalized to 36B4) and Gdf10 and Acta2 mRNA levels (normalized to Des ) in fibrotic liver. N) Analysis of DES mRNA levels and GDF10 and ACTA2 mRNA levels (normalized to DES ) in human health and fibrotic liver tissues from dataset GSE159676 . Data are mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001 by the two‐tailed Student's t ‐test.

Article Snippet: GDF10‐Fc was purchased from Sino Biological (Cat: 50165‐M01H).

Techniques: Staining, Isolation, Two Tailed Test

GDF10 inhibits TGF‐β‐induced HSC activation. A) qPCR analysis of GDF10 mRNA levels in primary mouse HSCs and LX‐2 cells treated with TGF‐β1 (2 ng mL −1 ), PDGF (20 ng mL −1 ), or vehicle (Veh) for 24 h ( n = 6). B) IF staining analysis of GDF10 protein levels in primary mouse HSCs and LX‐2 cells treated with TGF‐β1 (2 ng mL −1 ) or vehicle for 24 h ( n = 6), the relative fluorescence intensity (RFI) of ACTA2 and GDF10 is also shown, scale bars, 20 µm. C) Heat map representation of the indicated genes in primary human HSCs ( GSE119606 ) and LX‐2 cells ( GSE151251 ) treated with TGF‐β1 or vehicle. D, E) qPCR analysis of Gdf10 and Tgfb1 mRNA levels (D) ( n = 6) and IF staining analysis of GDF10 and ACTA2 protein levels (E) ( n = 3) in HSCs during the culture activation. F) Heat map representation of the indicated genes in HSCs during the culture activation ( GSE116987 ). G–I) qPCR (G) ( n = 6), Western blot (H), and IF staining (I) ( n = 3) analysis of indicated genes in primary mouse HSCs infected with LV‐sh‐Luc or LV‐sh‐Gdf10 for 24 h and then treated with TGF‐β1 (2 ng mL −1 ) or vehicle for another 24 h, scale bars, 20 µm. J–L) qPCR (J) ( n = 6), Western blot (K), and IF staining (L) ( n = 3) analysis of indicated genes in primary mouse HSCs infected with LV‐Con or LV‐Gdf10 for 24 h and then treated with TGF‐β1 (2 ng mL −1 ) or vehicle for another 24 h, scale bars, 20 µm. Data are mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001 by the two‐tailed Student's t ‐test (B,D,E), one‐way ANOVA (A, G (left), J (left), I, and L), or two‐way ANOVA (G (right) and J (right)).

Journal: Advanced Science

Article Title: Autocrine GDF10 Inhibits Hepatic Stellate Cell Activation via BMPR2/ALK3 Receptor to Prevent Liver Fibrosis

doi: 10.1002/advs.202500616

Figure Lengend Snippet: GDF10 inhibits TGF‐β‐induced HSC activation. A) qPCR analysis of GDF10 mRNA levels in primary mouse HSCs and LX‐2 cells treated with TGF‐β1 (2 ng mL −1 ), PDGF (20 ng mL −1 ), or vehicle (Veh) for 24 h ( n = 6). B) IF staining analysis of GDF10 protein levels in primary mouse HSCs and LX‐2 cells treated with TGF‐β1 (2 ng mL −1 ) or vehicle for 24 h ( n = 6), the relative fluorescence intensity (RFI) of ACTA2 and GDF10 is also shown, scale bars, 20 µm. C) Heat map representation of the indicated genes in primary human HSCs ( GSE119606 ) and LX‐2 cells ( GSE151251 ) treated with TGF‐β1 or vehicle. D, E) qPCR analysis of Gdf10 and Tgfb1 mRNA levels (D) ( n = 6) and IF staining analysis of GDF10 and ACTA2 protein levels (E) ( n = 3) in HSCs during the culture activation. F) Heat map representation of the indicated genes in HSCs during the culture activation ( GSE116987 ). G–I) qPCR (G) ( n = 6), Western blot (H), and IF staining (I) ( n = 3) analysis of indicated genes in primary mouse HSCs infected with LV‐sh‐Luc or LV‐sh‐Gdf10 for 24 h and then treated with TGF‐β1 (2 ng mL −1 ) or vehicle for another 24 h, scale bars, 20 µm. J–L) qPCR (J) ( n = 6), Western blot (K), and IF staining (L) ( n = 3) analysis of indicated genes in primary mouse HSCs infected with LV‐Con or LV‐Gdf10 for 24 h and then treated with TGF‐β1 (2 ng mL −1 ) or vehicle for another 24 h, scale bars, 20 µm. Data are mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001 by the two‐tailed Student's t ‐test (B,D,E), one‐way ANOVA (A, G (left), J (left), I, and L), or two‐way ANOVA (G (right) and J (right)).

Article Snippet: GDF10‐Fc was purchased from Sino Biological (Cat: 50165‐M01H).

Techniques: Activation Assay, Staining, Fluorescence, Western Blot, Infection, Two Tailed Test

Gdf10 knockout promotes HSC activation and exacerbates CCl4‐induced liver fibrosis. A) qPCR analysis of Gdf10 mRNA levels in the HSCs isolated from 12‐week‐old male WT and Gdf10KO mice. B) ELISA analysis of serum GDF10 content in WT and Gdf10KO mice ( n = 6). C) Schematic drawing of the experimental procedure. D) Representative images of H&E, Sirius Red, and ACTA2 IHC staining, scale bars, 50 µm ( n = 3). E) Hydroxyproline assay analysis of total liver collagen content ( n = 6). F‐H) qPCR (F) ( n = 6), Western blot (G), and IF staining (H) ( n = 3) analysis of indicated genes in the liver, scale bars, 50 µm. I, J) Measurement of serum ALT (I) and AST (J) levels of WT and Gdf10KO mice. K, L) qPCR (K) ( n = 3) and IF staining (L) analysis of indicated genes in the primary mouse HSCs, scale bars, 5 µm. Data are mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001 by the two‐tailed Student's t ‐test.

Journal: Advanced Science

Article Title: Autocrine GDF10 Inhibits Hepatic Stellate Cell Activation via BMPR2/ALK3 Receptor to Prevent Liver Fibrosis

doi: 10.1002/advs.202500616

Figure Lengend Snippet: Gdf10 knockout promotes HSC activation and exacerbates CCl4‐induced liver fibrosis. A) qPCR analysis of Gdf10 mRNA levels in the HSCs isolated from 12‐week‐old male WT and Gdf10KO mice. B) ELISA analysis of serum GDF10 content in WT and Gdf10KO mice ( n = 6). C) Schematic drawing of the experimental procedure. D) Representative images of H&E, Sirius Red, and ACTA2 IHC staining, scale bars, 50 µm ( n = 3). E) Hydroxyproline assay analysis of total liver collagen content ( n = 6). F‐H) qPCR (F) ( n = 6), Western blot (G), and IF staining (H) ( n = 3) analysis of indicated genes in the liver, scale bars, 50 µm. I, J) Measurement of serum ALT (I) and AST (J) levels of WT and Gdf10KO mice. K, L) qPCR (K) ( n = 3) and IF staining (L) analysis of indicated genes in the primary mouse HSCs, scale bars, 5 µm. Data are mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001 by the two‐tailed Student's t ‐test.

Article Snippet: GDF10‐Fc was purchased from Sino Biological (Cat: 50165‐M01H).

Techniques: Knock-Out, Activation Assay, Isolation, Enzyme-linked Immunosorbent Assay, Immunohistochemistry, Hydroxyproline Assay, Western Blot, Staining, Two Tailed Test

HSC‐specific Gdf10 transgene inhibits HSC activation and attenuates liver fibrosis in mice. A) qPCR analysis of Gdf10 mRNA levels in the HSCs isolated of 12‐week‐old male Rosa26‐Gdf10 flox/flox (LoxP) and Rosa26‐Gdf10 flox/flox ; Lrat‐Cre (Gdf10TG) mice ( n = 6). B) ELISA analysis of serum GDF10 content in LoxP and Gdf10TG mice ( n = 6). C) Schematic drawing of the experimental procedure. D) Representative images of H&E, Sirius Red, and ACTA2 IHC staining, scale bars, 50 µm ( n = 3). E) Hydroxyproline assay analysis of total liver collagen content ( n = 6). F–H) qPCR (F) ( n = 6), Western blot (G), and IF staining (H) ( n = 3) analysis of indicated genes in the liver, scale bars, 50 µm. I,J) Measurement of serum ALT (I) and AST (J) levels of LoxP and Gdf10TG mice. K,L) qPCR (K) ( n = 3) and IF staining (L) analysis of indicated genes in the primary mouse HSCs, scale bars, 5 µm. Data are mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001 by the two‐tailed Student's t ‐test.

Journal: Advanced Science

Article Title: Autocrine GDF10 Inhibits Hepatic Stellate Cell Activation via BMPR2/ALK3 Receptor to Prevent Liver Fibrosis

doi: 10.1002/advs.202500616

Figure Lengend Snippet: HSC‐specific Gdf10 transgene inhibits HSC activation and attenuates liver fibrosis in mice. A) qPCR analysis of Gdf10 mRNA levels in the HSCs isolated of 12‐week‐old male Rosa26‐Gdf10 flox/flox (LoxP) and Rosa26‐Gdf10 flox/flox ; Lrat‐Cre (Gdf10TG) mice ( n = 6). B) ELISA analysis of serum GDF10 content in LoxP and Gdf10TG mice ( n = 6). C) Schematic drawing of the experimental procedure. D) Representative images of H&E, Sirius Red, and ACTA2 IHC staining, scale bars, 50 µm ( n = 3). E) Hydroxyproline assay analysis of total liver collagen content ( n = 6). F–H) qPCR (F) ( n = 6), Western blot (G), and IF staining (H) ( n = 3) analysis of indicated genes in the liver, scale bars, 50 µm. I,J) Measurement of serum ALT (I) and AST (J) levels of LoxP and Gdf10TG mice. K,L) qPCR (K) ( n = 3) and IF staining (L) analysis of indicated genes in the primary mouse HSCs, scale bars, 5 µm. Data are mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001 by the two‐tailed Student's t ‐test.

Article Snippet: GDF10‐Fc was purchased from Sino Biological (Cat: 50165‐M01H).

Techniques: Activation Assay, Isolation, Enzyme-linked Immunosorbent Assay, Immunohistochemistry, Hydroxyproline Assay, Western Blot, Staining, Two Tailed Test

Characterization of the interaction between GDF10 and BMPR2/ALK3. A) Percentage of expression + binding + transfectants of HEK293 cells expressing a single TGF‐β superfamily receptor incubated with GDF10‐Fc. B) Percentage of expression + binding + transfectants of HEK293 cells expressing BMPR2 and type I TGF‐β receptor incubated with GDF10‐Fc. C) HEK293 cells were transfected to express BMPR2 and ALK3 and then incubated with GDF10‐Fc, scale bars, 50 µm. D) Association of BMPR2 with ALK3. HEK293 cells were transfected to express BMPR2‐FLAG and ALK3‐HIS. E) The overall structure of mature GDF10 with the extracellular domains (ECD) of mouse BMPR2 and ALK3 (GDF10: blue‐purple, BMPR2: pink‐green, ALK3: pink). F) Western blot analysis of cell lysates from HEK293 cells transfected to express C‐terminal FLAG‐tagged BMPR2 and FLAG‐tagged ALK3 incubated with GDF10‐Fc and then immunoprecipitated with anti‐FLAG antibody. G) Biacore sensorgrams and binding kinetics were determined by SPR spectroscopy for GDF10 with the ECD of mouse BMPR2 and ALK3. H) qPCR analysis of the expression Bmpr2 and Alk3 in mouse LSECs, MACs, HSCs, and HCs ( n = 6). I) Cell type enrichment of BMPR2 and ALK3 in human liver (Human Protein Atlas database).

Journal: Advanced Science

Article Title: Autocrine GDF10 Inhibits Hepatic Stellate Cell Activation via BMPR2/ALK3 Receptor to Prevent Liver Fibrosis

doi: 10.1002/advs.202500616

Figure Lengend Snippet: Characterization of the interaction between GDF10 and BMPR2/ALK3. A) Percentage of expression + binding + transfectants of HEK293 cells expressing a single TGF‐β superfamily receptor incubated with GDF10‐Fc. B) Percentage of expression + binding + transfectants of HEK293 cells expressing BMPR2 and type I TGF‐β receptor incubated with GDF10‐Fc. C) HEK293 cells were transfected to express BMPR2 and ALK3 and then incubated with GDF10‐Fc, scale bars, 50 µm. D) Association of BMPR2 with ALK3. HEK293 cells were transfected to express BMPR2‐FLAG and ALK3‐HIS. E) The overall structure of mature GDF10 with the extracellular domains (ECD) of mouse BMPR2 and ALK3 (GDF10: blue‐purple, BMPR2: pink‐green, ALK3: pink). F) Western blot analysis of cell lysates from HEK293 cells transfected to express C‐terminal FLAG‐tagged BMPR2 and FLAG‐tagged ALK3 incubated with GDF10‐Fc and then immunoprecipitated with anti‐FLAG antibody. G) Biacore sensorgrams and binding kinetics were determined by SPR spectroscopy for GDF10 with the ECD of mouse BMPR2 and ALK3. H) qPCR analysis of the expression Bmpr2 and Alk3 in mouse LSECs, MACs, HSCs, and HCs ( n = 6). I) Cell type enrichment of BMPR2 and ALK3 in human liver (Human Protein Atlas database).

Article Snippet: GDF10‐Fc was purchased from Sino Biological (Cat: 50165‐M01H).

Techniques: Expressing, Binding Assay, Incubation, Transfection, Western Blot, Immunoprecipitation, Spectroscopy

GDF10 inhibits HSC activation via the BMPR2/ALK3‐SMAD1/5/8‐SMAD7 signaling pathway. A,B) qPCR (A) ( n = 6) and Western blot (B) analysis of indicated genes in the primary mouse HSCs infected with LV‐sh‐Luc or LV‐sh‐Bmpr2 and LV‐sh‐Alk3 for 24 h and then treated with TGF‐β1 plus Fc or GDF10‐Fc for another 24 h. C) IF staining analysis of ACTA2 expression in HSCs treated as in (A), scale bars, 20 µm ( n = 3). D, E) qPCR ( n = 6) (D) and Western blot (E) analysis of indicated genes in the HSCs treated with TGF‐β1 plus GDF10‐Fc and/or LDN for 24 h. F) IF analysis of ACTA2 stating in HSCs treated as in (D). G) Heat map shows the indicated genes in JS1 cells treated with TGF‐β1 plus LDN and/or GDF10‐Fc for 24 h. H) qPCR (top) ( n = 6) and Western blot (bottom) analysis of SMAD7 mRNA and protein levels in HSCs treated as in (G). I) qPCR (top) ( n = 6) and Western blot (bottom) analysis of SMAD7 mRNA and protein levels in HSCs treated with TGF‐β1 plus DM and/or GDF10‐Fc for 24 h. J) Alignment of the SMAD7 promoter regions containing the GC‐BRE sites (GGCGCC) in the indicated species. K) Luciferase reporter gene assay in JS1 cells transfected with the indicated plasmids and then treated with Fc or GDF10‐Fc. L) ChIP assay showing the recruitment of phosphorylated SMAD1/5/8 to the Smad7 gene promoter in JS1 cells ( n = 3). M,N) qPCR (M) ( n = 6) and Western blot (N) analysis of indicated genes in the primary mouse HSCs infected with LV‐sh‐Luc or LV‐sh‐Smad7 for 24 h, then treated with TGF‐β1 plus Fc or GDF10‐Fc for another 24 h. O) IF staining analysis of ACTA2 expression in HSCs treated as in (M), scale bars, 20 µm ( n = 3). Data are mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001 by the two‐tailed Student's t ‐test (K,L), one‐way ANOVA (C,F,H,I,O), or two‐way ANOVA (A,D,M).

Journal: Advanced Science

Article Title: Autocrine GDF10 Inhibits Hepatic Stellate Cell Activation via BMPR2/ALK3 Receptor to Prevent Liver Fibrosis

doi: 10.1002/advs.202500616

Figure Lengend Snippet: GDF10 inhibits HSC activation via the BMPR2/ALK3‐SMAD1/5/8‐SMAD7 signaling pathway. A,B) qPCR (A) ( n = 6) and Western blot (B) analysis of indicated genes in the primary mouse HSCs infected with LV‐sh‐Luc or LV‐sh‐Bmpr2 and LV‐sh‐Alk3 for 24 h and then treated with TGF‐β1 plus Fc or GDF10‐Fc for another 24 h. C) IF staining analysis of ACTA2 expression in HSCs treated as in (A), scale bars, 20 µm ( n = 3). D, E) qPCR ( n = 6) (D) and Western blot (E) analysis of indicated genes in the HSCs treated with TGF‐β1 plus GDF10‐Fc and/or LDN for 24 h. F) IF analysis of ACTA2 stating in HSCs treated as in (D). G) Heat map shows the indicated genes in JS1 cells treated with TGF‐β1 plus LDN and/or GDF10‐Fc for 24 h. H) qPCR (top) ( n = 6) and Western blot (bottom) analysis of SMAD7 mRNA and protein levels in HSCs treated as in (G). I) qPCR (top) ( n = 6) and Western blot (bottom) analysis of SMAD7 mRNA and protein levels in HSCs treated with TGF‐β1 plus DM and/or GDF10‐Fc for 24 h. J) Alignment of the SMAD7 promoter regions containing the GC‐BRE sites (GGCGCC) in the indicated species. K) Luciferase reporter gene assay in JS1 cells transfected with the indicated plasmids and then treated with Fc or GDF10‐Fc. L) ChIP assay showing the recruitment of phosphorylated SMAD1/5/8 to the Smad7 gene promoter in JS1 cells ( n = 3). M,N) qPCR (M) ( n = 6) and Western blot (N) analysis of indicated genes in the primary mouse HSCs infected with LV‐sh‐Luc or LV‐sh‐Smad7 for 24 h, then treated with TGF‐β1 plus Fc or GDF10‐Fc for another 24 h. O) IF staining analysis of ACTA2 expression in HSCs treated as in (M), scale bars, 20 µm ( n = 3). Data are mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001 by the two‐tailed Student's t ‐test (K,L), one‐way ANOVA (C,F,H,I,O), or two‐way ANOVA (A,D,M).

Article Snippet: GDF10‐Fc was purchased from Sino Biological (Cat: 50165‐M01H).

Techniques: Activation Assay, Western Blot, Infection, Staining, Expressing, Luciferase, Reporter Gene Assay, Transfection, Two Tailed Test

BMPR2:ALK3‐Fc prevents the antifibrotic effect of GDF10 in the liver. A) Schematic drawing of the experimental procedure in 3‐month‐old male LoxP and Gdf10TG mice. B) Representative images of H&E, Sirius Red, and ACTA2 IHC staining, scale bars, 50 µm ( n = 3). C) Hydroxyproline assay analysis of the total liver collagen of mice treated as in (A) ( n = 6). D,E) qPCR (D) ( n = 6) and Western blot (E) analysis of indicated genes in the liver of mice treated as in (A). F,G) qPCR (F) ( n = 6) and Western blot (G) analysis of indicated genes in the HSCs from mice treated as in (A) ( n = 3). H,I) IF staining (H) and Western blot (I) analysis of indicated protein in the HSCs from mice treated as in (A), scale bars, 5 µm. Data are mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001 by the one‐way ANOVA (C,E,G,I) or two‐way ANOVA (D,F).

Journal: Advanced Science

Article Title: Autocrine GDF10 Inhibits Hepatic Stellate Cell Activation via BMPR2/ALK3 Receptor to Prevent Liver Fibrosis

doi: 10.1002/advs.202500616

Figure Lengend Snippet: BMPR2:ALK3‐Fc prevents the antifibrotic effect of GDF10 in the liver. A) Schematic drawing of the experimental procedure in 3‐month‐old male LoxP and Gdf10TG mice. B) Representative images of H&E, Sirius Red, and ACTA2 IHC staining, scale bars, 50 µm ( n = 3). C) Hydroxyproline assay analysis of the total liver collagen of mice treated as in (A) ( n = 6). D,E) qPCR (D) ( n = 6) and Western blot (E) analysis of indicated genes in the liver of mice treated as in (A). F,G) qPCR (F) ( n = 6) and Western blot (G) analysis of indicated genes in the HSCs from mice treated as in (A) ( n = 3). H,I) IF staining (H) and Western blot (I) analysis of indicated protein in the HSCs from mice treated as in (A), scale bars, 5 µm. Data are mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001 by the one‐way ANOVA (C,E,G,I) or two‐way ANOVA (D,F).

Article Snippet: GDF10‐Fc was purchased from Sino Biological (Cat: 50165‐M01H).

Techniques: Immunohistochemistry, Hydroxyproline Assay, Western Blot, Staining

Therapeutic administration of GDF10‐Fc ameliorates hepatic fibrosis. A) Schematic drawing of the experimental procedure. B) Representative images of H&E and Sirius Red staining of liver from mice treated as in (A), scale bars, 50 µm ( n = 3). C,D) Measurement of the total liver collagen content by hydroxyproline assay (C) and serum ALT and AST levels (D) in the mice treated as in (A) ( n = 6). E, F) qPCR (E) ( n = 6) and Western blot (F) analysis of indicated genes in the liver of mice treated as in (A). G) Schematic drawing of the experimental procedure and representative images of H&E and Sirius Red staining of liver from AMLN diet‐induced fibrosis, scale bars, 50 µm ( n = 3). H,I) Measurement of the total liver collagen content by hydroxyproline assay (H) and serum ALT and AST levels (I) of the mice treated as in (G) ( n = 6). J,K) qPCR (J) ( n = 6) and Western blot (K) analysis of indicated genes in the liver of mice treated as in (G). L) Schematic drawing of the experimental procedure and representative images of H&E and Sirius Red staining of liver from the MCD diet‐induced fibrosis, scale bars, 50 µm ( n = 3). M,N) Measurement of the total liver collagen content by hydroxyproline assay (M) and serum ALT and AST levels (N) of the mice treated as in (L) ( n = 6). O, P) Western blot (O) and qPCR (P) ( n = 6) analysis of indicated genes in the liver of mice treated as in (L). Q) The proposed model of GDF10 prevents liver fibrosis. Data are mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001 by the two‐tailed Student's t ‐test (G–P), one‐way ANOVA (B,C,D,F), or two‐way ANOVA (E).

Journal: Advanced Science

Article Title: Autocrine GDF10 Inhibits Hepatic Stellate Cell Activation via BMPR2/ALK3 Receptor to Prevent Liver Fibrosis

doi: 10.1002/advs.202500616

Figure Lengend Snippet: Therapeutic administration of GDF10‐Fc ameliorates hepatic fibrosis. A) Schematic drawing of the experimental procedure. B) Representative images of H&E and Sirius Red staining of liver from mice treated as in (A), scale bars, 50 µm ( n = 3). C,D) Measurement of the total liver collagen content by hydroxyproline assay (C) and serum ALT and AST levels (D) in the mice treated as in (A) ( n = 6). E, F) qPCR (E) ( n = 6) and Western blot (F) analysis of indicated genes in the liver of mice treated as in (A). G) Schematic drawing of the experimental procedure and representative images of H&E and Sirius Red staining of liver from AMLN diet‐induced fibrosis, scale bars, 50 µm ( n = 3). H,I) Measurement of the total liver collagen content by hydroxyproline assay (H) and serum ALT and AST levels (I) of the mice treated as in (G) ( n = 6). J,K) qPCR (J) ( n = 6) and Western blot (K) analysis of indicated genes in the liver of mice treated as in (G). L) Schematic drawing of the experimental procedure and representative images of H&E and Sirius Red staining of liver from the MCD diet‐induced fibrosis, scale bars, 50 µm ( n = 3). M,N) Measurement of the total liver collagen content by hydroxyproline assay (M) and serum ALT and AST levels (N) of the mice treated as in (L) ( n = 6). O, P) Western blot (O) and qPCR (P) ( n = 6) analysis of indicated genes in the liver of mice treated as in (L). Q) The proposed model of GDF10 prevents liver fibrosis. Data are mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001 by the two‐tailed Student's t ‐test (G–P), one‐way ANOVA (B,C,D,F), or two‐way ANOVA (E).

Article Snippet: GDF10‐Fc was purchased from Sino Biological (Cat: 50165‐M01H).

Techniques: Staining, Hydroxyproline Assay, Western Blot, Two Tailed Test

Expression of Sost ( A ), Gdf10 ( B ), Gli1 ( C ), Ihh ( D ), Mmp10 ( E ), and Phex ( F ) in the differentiated IDG-SW3 cells after FasL stimulation with (FasL + OPh) and without (FasL) caspase inhibition. Expression levels were compared with those in the untreated controls. The results are shown in %, indicating the mean ± standard deviation of three replicates (expression in the control cells was set to 100%).

Journal: Biology

Article Title: Impact of FasL Stimulation on Sclerostin Expression and Osteogenic Profile in IDG-SW3 Osteocytes

doi: 10.3390/biology10080757

Figure Lengend Snippet: Expression of Sost ( A ), Gdf10 ( B ), Gli1 ( C ), Ihh ( D ), Mmp10 ( E ), and Phex ( F ) in the differentiated IDG-SW3 cells after FasL stimulation with (FasL + OPh) and without (FasL) caspase inhibition. Expression levels were compared with those in the untreated controls. The results are shown in %, indicating the mean ± standard deviation of three replicates (expression in the control cells was set to 100%).

Article Snippet: The TaqMan Gene Expression Assay (Thermo Fisher Scientific) was applied for detecting the gene expression of Dmp1 (Mm01208363_m1), Gdf10 (Mm01220860_m1), Gli1 (Mm00494654_m1), Ihh (Mm00439613_m1), Mmp10 (Mm01168399_m1), Phex (Mm00448119_m1), and Sost (Mm00470479_m1).

Techniques: Expressing, Inhibition, Standard Deviation, Control

Expression levels of cells treated with (FasL + OPh) compared with those treated with OPh only ( Sost , Gdf10 , Gli1, Ihh , Mmp10 , and Phex , respectively) ( A – F ). The results are shown in %, indicating the mean ± standard deviation of three replicates (expression in the control cells was set to 100%).

Journal: Biology

Article Title: Impact of FasL Stimulation on Sclerostin Expression and Osteogenic Profile in IDG-SW3 Osteocytes

doi: 10.3390/biology10080757

Figure Lengend Snippet: Expression levels of cells treated with (FasL + OPh) compared with those treated with OPh only ( Sost , Gdf10 , Gli1, Ihh , Mmp10 , and Phex , respectively) ( A – F ). The results are shown in %, indicating the mean ± standard deviation of three replicates (expression in the control cells was set to 100%).

Article Snippet: The TaqMan Gene Expression Assay (Thermo Fisher Scientific) was applied for detecting the gene expression of Dmp1 (Mm01208363_m1), Gdf10 (Mm01220860_m1), Gli1 (Mm00494654_m1), Ihh (Mm00439613_m1), Mmp10 (Mm01168399_m1), Phex (Mm00448119_m1), and Sost (Mm00470479_m1).

Techniques: Expressing, Standard Deviation, Control

(A) RNAs from undifferentiated (Day 0) or differentiated (Day 30) osteoblasts were used in a whole-genome microarray analysis. 42 transcripts encoding secreted factors upregulated in Day 30 osteoblasts were subdivided into three groups, based on p values and false discovery rate (FDR). Fold increase is shown on right. (B) RNA levels of select TGFβ and GDF family genes during osteoblast differentiation. (C) TGFβ2 or GDF10 expression by qRT-PCR (upper) or western blot (lower). Undifferentiated osteoblast precursor MC3T3-E1 cells were used as a control. (D) TGFβ1 RNA levels. *p < 0.01 by t test. (E) TGFβ2 and GDF10 are two of many factors upregulated and secreted by osteoblasts over 30 days of differentiation in culture.

Journal: Cancer research

Article Title: Osteoblast-secreted factors mediate dormancy of metastatic prostate cancer in the bone via activation of the TGFβRIII-p38MAPK-pS249/T252RB pathway

doi: 10.1158/0008-5472.CAN-17-1051

Figure Lengend Snippet: (A) RNAs from undifferentiated (Day 0) or differentiated (Day 30) osteoblasts were used in a whole-genome microarray analysis. 42 transcripts encoding secreted factors upregulated in Day 30 osteoblasts were subdivided into three groups, based on p values and false discovery rate (FDR). Fold increase is shown on right. (B) RNA levels of select TGFβ and GDF family genes during osteoblast differentiation. (C) TGFβ2 or GDF10 expression by qRT-PCR (upper) or western blot (lower). Undifferentiated osteoblast precursor MC3T3-E1 cells were used as a control. (D) TGFβ1 RNA levels. *p < 0.01 by t test. (E) TGFβ2 and GDF10 are two of many factors upregulated and secreted by osteoblasts over 30 days of differentiation in culture.

Article Snippet: Antibodies: phospho-p38MAPK, p38MAPK, RB, Smad2/3, phospho-Smad1/5, p27Kip1, GAPDH, β-actin (Cell Signaling); phospho(S249/T252)-RB ( 8 ); Ki-67 (Dako); TGFβ2 and TGFβRIII (Proteintech); GDF10, p21 and TGFβRIII (R&D); β-tubulin, α-tubulin (GeneTex).

Techniques: Microarray, Expressing, Quantitative RT-PCR, Western Blot, Control

(A) C4-2B4 cells treated with TGFβ2, GDF10 or TGFβ1 for 72 h were analyzed by live-cell imaging. Quiescent cells that did not divide in 60–72 h relative to total cells counted were quantified (mean ± s.e.m). n cells were analyzed in multiple experiments: TGFβ2 (N=5–8), GDF10 (N=4), and TGFβ1 (N=5), except for TGFβ2 or GDF10 dose response (N=1). P values were by t test. Live-cell images (h:min) of cells treated with TGFβ2 (B) or GDF10 (C), followed by co-immunostaining for Ki-67 and p27. Colored asterisks, control cell progenies. Red box, enlarged. Cells a-d, quiescent cells following TGFβ2 or GDF10 treatment. All bars, 10 μm. (D) Cellular quiescence of several other PCa cells treated and analyzed as in (A) in multiple experiments: C4-2b (N=3–5), PC3-mm2 (N=2–3), 22Rv1 (N=2–3), BPH-1 (N=2–3).

Journal: Cancer research

Article Title: Osteoblast-secreted factors mediate dormancy of metastatic prostate cancer in the bone via activation of the TGFβRIII-p38MAPK-pS249/T252RB pathway

doi: 10.1158/0008-5472.CAN-17-1051

Figure Lengend Snippet: (A) C4-2B4 cells treated with TGFβ2, GDF10 or TGFβ1 for 72 h were analyzed by live-cell imaging. Quiescent cells that did not divide in 60–72 h relative to total cells counted were quantified (mean ± s.e.m). n cells were analyzed in multiple experiments: TGFβ2 (N=5–8), GDF10 (N=4), and TGFβ1 (N=5), except for TGFβ2 or GDF10 dose response (N=1). P values were by t test. Live-cell images (h:min) of cells treated with TGFβ2 (B) or GDF10 (C), followed by co-immunostaining for Ki-67 and p27. Colored asterisks, control cell progenies. Red box, enlarged. Cells a-d, quiescent cells following TGFβ2 or GDF10 treatment. All bars, 10 μm. (D) Cellular quiescence of several other PCa cells treated and analyzed as in (A) in multiple experiments: C4-2b (N=3–5), PC3-mm2 (N=2–3), 22Rv1 (N=2–3), BPH-1 (N=2–3).

Article Snippet: Antibodies: phospho-p38MAPK, p38MAPK, RB, Smad2/3, phospho-Smad1/5, p27Kip1, GAPDH, β-actin (Cell Signaling); phospho(S249/T252)-RB ( 8 ); Ki-67 (Dako); TGFβ2 and TGFβRIII (Proteintech); GDF10, p21 and TGFβRIII (R&D); β-tubulin, α-tubulin (GeneTex).

Techniques: Live Cell Imaging, Immunostaining, Control

(A) TGFβRIII levels in knockdown clones C4-2B4-shTβRIII-#2 and #3 were analyzed by immunoprecipitation followed by immunoblotting, quantified against pGIPZ-sh-Vector cells, and signals normalized against actin controls. Bar, TGFβRIII 100-kDa core protein and glycosylated forms. (B) Cells in (A) were treated with 50 ng/ml TGFβ2 or GDF10 for 72 h. Cellular quiescence was determined by live-cell imaging. n cells were monitored in N=3–5 experiments, except for shTβRIII-#3 cells (N=2). P values are by t test. (C) Left, C4-2B4 cells were treated with TGFβ2, immunostained for p38MAPK, and counterstained with DAPI. Images were captured by confocal microscopy. Box, enlarged. Right, phospho-p38MAPK (p-p38) immunostaining following TGFβ2 or GDF10 time course. (D) C4-2b and PC3-mm2 cells and (E) C4-2B4-sh-Vector, C4-2B4-shTβRIII-#2 and C4-2B4-shTβRIII-#3 cells were immunostained for p-p38 after treatment with TGFβ2 or GDF10 for 60 min. All bars, 10 μm.

Journal: Cancer research

Article Title: Osteoblast-secreted factors mediate dormancy of metastatic prostate cancer in the bone via activation of the TGFβRIII-p38MAPK-pS249/T252RB pathway

doi: 10.1158/0008-5472.CAN-17-1051

Figure Lengend Snippet: (A) TGFβRIII levels in knockdown clones C4-2B4-shTβRIII-#2 and #3 were analyzed by immunoprecipitation followed by immunoblotting, quantified against pGIPZ-sh-Vector cells, and signals normalized against actin controls. Bar, TGFβRIII 100-kDa core protein and glycosylated forms. (B) Cells in (A) were treated with 50 ng/ml TGFβ2 or GDF10 for 72 h. Cellular quiescence was determined by live-cell imaging. n cells were monitored in N=3–5 experiments, except for shTβRIII-#3 cells (N=2). P values are by t test. (C) Left, C4-2B4 cells were treated with TGFβ2, immunostained for p38MAPK, and counterstained with DAPI. Images were captured by confocal microscopy. Box, enlarged. Right, phospho-p38MAPK (p-p38) immunostaining following TGFβ2 or GDF10 time course. (D) C4-2b and PC3-mm2 cells and (E) C4-2B4-sh-Vector, C4-2B4-shTβRIII-#2 and C4-2B4-shTβRIII-#3 cells were immunostained for p-p38 after treatment with TGFβ2 or GDF10 for 60 min. All bars, 10 μm.

Article Snippet: Antibodies: phospho-p38MAPK, p38MAPK, RB, Smad2/3, phospho-Smad1/5, p27Kip1, GAPDH, β-actin (Cell Signaling); phospho(S249/T252)-RB ( 8 ); Ki-67 (Dako); TGFβ2 and TGFβRIII (Proteintech); GDF10, p21 and TGFβRIII (R&D); β-tubulin, α-tubulin (GeneTex).

Techniques: Knockdown, Clone Assay, Immunoprecipitation, Western Blot, Plasmid Preparation, Live Cell Imaging, Confocal Microscopy, Immunostaining

(A) C4-2B4 cells were treated with 50 ng/ml TGFβ2 or GDF10 and co-immunostained for p-p38 and phospho-S249/T252-RB (8). (B) Cells treated as in (A) for 180 min were co-immunostained as in (A), followed with proximity ligation assay. Cells incubated with either primary antibodies alone or no antibodies served as negative controls. Boxes, enlarged. All bars, 10 μm. PLA spots/nucleus were quantified in n nuclei. P values are by t test. #, no spots detected.

Journal: Cancer research

Article Title: Osteoblast-secreted factors mediate dormancy of metastatic prostate cancer in the bone via activation of the TGFβRIII-p38MAPK-pS249/T252RB pathway

doi: 10.1158/0008-5472.CAN-17-1051

Figure Lengend Snippet: (A) C4-2B4 cells were treated with 50 ng/ml TGFβ2 or GDF10 and co-immunostained for p-p38 and phospho-S249/T252-RB (8). (B) Cells treated as in (A) for 180 min were co-immunostained as in (A), followed with proximity ligation assay. Cells incubated with either primary antibodies alone or no antibodies served as negative controls. Boxes, enlarged. All bars, 10 μm. PLA spots/nucleus were quantified in n nuclei. P values are by t test. #, no spots detected.

Article Snippet: Antibodies: phospho-p38MAPK, p38MAPK, RB, Smad2/3, phospho-Smad1/5, p27Kip1, GAPDH, β-actin (Cell Signaling); phospho(S249/T252)-RB ( 8 ); Ki-67 (Dako); TGFβ2 and TGFβRIII (Proteintech); GDF10, p21 and TGFβRIII (R&D); β-tubulin, α-tubulin (GeneTex).

Techniques: Proximity Ligation Assay, Incubation

(A) C4-2B4 cells stably-expressing empty vector or p38DN were examined by western blot for p-p38 followed by p38MAPK. β-tubulin, loading control. (B) Cells in (A) were treated with 50 ng/ml TGFβ2 or GDF10 for 60 min and immunostained for p-p38. (C) Cells in (A) were treated with TGFβ2 or GDF10 for 72 h. Cellular quiescence was determined by live-cell imaging. n cells were monitored in multiple experiments: C4-2B4-Vector (N=5–7), C4-2B4-p38DN (N=4–5). P values are by t test. (D) C4-2b-Vector or C4-2b-p38DN cells were generated and examined by western blot as in (A). (E) Cells in (D) were treated as in (B) and immunostained for p-p38. All bars, 10 μm. (F) Cellular quiescence in C4-2b-Vector or C4-2b-p38DN cells after TGFβ2 or GDF10 incubation was determined as in (C). n cells were followed in multiple experiments: C4-2b-Vector (N=4–5), C4-2b-p38DN (N=3–5).

Journal: Cancer research

Article Title: Osteoblast-secreted factors mediate dormancy of metastatic prostate cancer in the bone via activation of the TGFβRIII-p38MAPK-pS249/T252RB pathway

doi: 10.1158/0008-5472.CAN-17-1051

Figure Lengend Snippet: (A) C4-2B4 cells stably-expressing empty vector or p38DN were examined by western blot for p-p38 followed by p38MAPK. β-tubulin, loading control. (B) Cells in (A) were treated with 50 ng/ml TGFβ2 or GDF10 for 60 min and immunostained for p-p38. (C) Cells in (A) were treated with TGFβ2 or GDF10 for 72 h. Cellular quiescence was determined by live-cell imaging. n cells were monitored in multiple experiments: C4-2B4-Vector (N=5–7), C4-2B4-p38DN (N=4–5). P values are by t test. (D) C4-2b-Vector or C4-2b-p38DN cells were generated and examined by western blot as in (A). (E) Cells in (D) were treated as in (B) and immunostained for p-p38. All bars, 10 μm. (F) Cellular quiescence in C4-2b-Vector or C4-2b-p38DN cells after TGFβ2 or GDF10 incubation was determined as in (C). n cells were followed in multiple experiments: C4-2b-Vector (N=4–5), C4-2b-p38DN (N=3–5).

Article Snippet: Antibodies: phospho-p38MAPK, p38MAPK, RB, Smad2/3, phospho-Smad1/5, p27Kip1, GAPDH, β-actin (Cell Signaling); phospho(S249/T252)-RB ( 8 ); Ki-67 (Dako); TGFβ2 and TGFβRIII (Proteintech); GDF10, p21 and TGFβRIII (R&D); β-tubulin, α-tubulin (GeneTex).

Techniques: Stable Transfection, Expressing, Plasmid Preparation, Western Blot, Control, Live Cell Imaging, Generated, Incubation

Expression of growth plate cartilage zonal markers in superficial and intermediate/deep zones of articular cartilage.

Journal: PLoS ONE

Article Title: Gene Expression Profiling Reveals Similarities between the Spatial Architectures of Postnatal Articular and Growth Plate Cartilage

doi: 10.1371/journal.pone.0103061

Figure Lengend Snippet: Expression of growth plate cartilage zonal markers in superficial and intermediate/deep zones of articular cartilage.

Article Snippet: Intron spanning primers were purchased as prepared assays containing VIC (18S rRNA)- or FAM-labeled TaqMan MGB probes (Applied Biosystems): 18S rRNA (18S-4319413E), Alpl (Rn00564931_m1), Adamts1 (Rn00577887_m1), Mmp9 (Rn00579162_m1), Mmp13 (Rn01448194_m1), Bmp3 (Rn00567346_m1), and Gdf10 (Rn00577682_m1); or designed using Primer Express 2.0 (Applied Biosystems): Prg4 forward ( GCATTAACATCCATCCCATGTTT ), Prg4 reverse ( CCATCCACTGGCTTACCATTG ), Col10a1 forward ( GCAGCAGCCAGAATCCATTT ), Col10a1 reverse ( AAGTGCGCTCTTCACACCTGT ), Prelp forward ( AAGCTGGAACACCTGTACCTCAA ), Prelp reverse ( GGCAAATCTGGGTCCCATT ), Olfml3 forward ( ACATGGAACGCCGACTAGCT ), Olfml3 reverse ( CCGCTTCAGGATCTTCATTGA ), Sfrp5 forward ( CATCATCGAACATCTCTGTGCAA ), and Sfrp5 reverse ( CCGTTTTCCTTTTTTACTTCTTTGA ).

Techniques: Expressing

Relative expression of selected genes that overlap between RZ and IDZ, including Bmp3 , Grem1 , and Sfrp5 ( D–F ), PZ and SZ, including Gdf10 , Prelp , and Olfml3 ( G–I ), as well as HZ and SZ, including Adamts1 , Mmp13 , and Mmp9 ( J–L ), was determined in proximal tibial epiphyses of 10-day-old rats (n = 4) and values were normalized to 18S rRNA. Accuracy of the microdissection technique was validated by inspecting relative expression of Prg4 , Col10a1 , and Alpl ( A–C ). SZ, superficial zone; IDZ, intermediate/deep zone; RZ, resting zone; PZ, proliferative zone; HZ, hypertrophic zone; N.S., not significant; * P <0.05; ** P <0.01; *** P <0.001.

Journal: PLoS ONE

Article Title: Gene Expression Profiling Reveals Similarities between the Spatial Architectures of Postnatal Articular and Growth Plate Cartilage

doi: 10.1371/journal.pone.0103061

Figure Lengend Snippet: Relative expression of selected genes that overlap between RZ and IDZ, including Bmp3 , Grem1 , and Sfrp5 ( D–F ), PZ and SZ, including Gdf10 , Prelp , and Olfml3 ( G–I ), as well as HZ and SZ, including Adamts1 , Mmp13 , and Mmp9 ( J–L ), was determined in proximal tibial epiphyses of 10-day-old rats (n = 4) and values were normalized to 18S rRNA. Accuracy of the microdissection technique was validated by inspecting relative expression of Prg4 , Col10a1 , and Alpl ( A–C ). SZ, superficial zone; IDZ, intermediate/deep zone; RZ, resting zone; PZ, proliferative zone; HZ, hypertrophic zone; N.S., not significant; * P <0.05; ** P <0.01; *** P <0.001.

Article Snippet: Intron spanning primers were purchased as prepared assays containing VIC (18S rRNA)- or FAM-labeled TaqMan MGB probes (Applied Biosystems): 18S rRNA (18S-4319413E), Alpl (Rn00564931_m1), Adamts1 (Rn00577887_m1), Mmp9 (Rn00579162_m1), Mmp13 (Rn01448194_m1), Bmp3 (Rn00567346_m1), and Gdf10 (Rn00577682_m1); or designed using Primer Express 2.0 (Applied Biosystems): Prg4 forward ( GCATTAACATCCATCCCATGTTT ), Prg4 reverse ( CCATCCACTGGCTTACCATTG ), Col10a1 forward ( GCAGCAGCCAGAATCCATTT ), Col10a1 reverse ( AAGTGCGCTCTTCACACCTGT ), Prelp forward ( AAGCTGGAACACCTGTACCTCAA ), Prelp reverse ( GGCAAATCTGGGTCCCATT ), Olfml3 forward ( ACATGGAACGCCGACTAGCT ), Olfml3 reverse ( CCGCTTCAGGATCTTCATTGA ), Sfrp5 forward ( CATCATCGAACATCTCTGTGCAA ), and Sfrp5 reverse ( CCGTTTTCCTTTTTTACTTCTTTGA ).

Techniques: Expressing, Laser Capture Microdissection