Journal: Cells

Article Title: Salicylate-Elicited Activation of AMP-Activated Protein Kinase Directly Triggers Degradation of C-Myc in Colorectal Cancer Cells.

doi: 10.3390/cells14040294

Figure Lengend Snippet: Figure 3. Salicylate affects multiple cell types and has diverse effects. (A) U2OS osteosarcoma cells and (B) MCF-7 breast cancer cells were grown in complete media for 48 h in the presence of salicylate (lane 2, (A,B), respectively), the synthetic activator A76966 (lane 3, (A,B), respectively), phenformin (lane 5, (A,B), respectively), or in glucose-free media for 8 h (lane 6, (A,B), respectively). Cells were also treated with a combination of salicylate (3 mM) and compound C (dorsomorphin 100 nM) for 48 h (lane 4, (A,B), respectively). In MCF-7 cells, the expression of c-Myc was significantly decreased by 4-OHT alone (lane 9) and even more by a combination of salicylate and 4-OHT (lane 10), compared with the negative control (lane 7). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used in all cases as loading control for protein normalization. (C) Cell viability of HCT116 cells was determined by MTT assay after treatment with indicated concentrations of salicylate for 48 h. IC50 for salicylate was determined using Prism v.9 (GraphPad Software, San Diego, CA, USA) based on the changes in HCT116 cell viability. (D) Cell viability was determined after 48 h in the presence of 1 mM or 3 mM of salicylate, the synthetic activator A76966, compound C (dorsomorphin: 100 nM), or combinations of these drugs. Mean values ± SEMs are shown. * p < 0.05; ** p < 0.01; *** p < 0.001; n.s.: not significant. (E,F) Seahorse extracellular flux analysis of the oxygen consumption rate (OCR) shows respiratory changes in HCT-116 cells brought about by sodium salicylate treatment. (E) Seahorse injection series analysis with OCR data presented for one experiment. (F) Calculated parameters from 3 independent experiments include ATP-linked respiration, proton leak, basal respiration, and maximal respiratory capacity. Basal respiration significantly increased when cells were treated with sodium salicylate (1 or 3 mM). Treatment with sodium salicylate caused an increased proton leak (uncoupling) and a decreased percental amount of oxygen being used for ATP production. The maximal respiratory capacity was lowered when treated with sodium salicylate, which suggests a compromised mitochondrial function.

Article Snippet: QPCR primer pairs for human MYC (#HP206146) and human GAPDH (#HP205798) were from OriGene Technologies (Rockville, MD, USA).

Techniques: Expressing, Negative Control, Control, MTT Assay, Software, Injection

Journal: Cell Transplantation

Article Title: Alleviation of Methamphetamine Sensitization by Partially Lesioning Dopaminergic Terminals with 6-Hydroxydopamine in Nucleus Accumbens

doi: 10.1177/09636897211052300

Figure Lengend Snippet: Oligonucleotide Primers Used for Quantitative RT-PCR.

Article Snippet: GAPDH , Forward Reverse , CATCACTGCCACCCAGAAGACTG ATGCCAGTGAGCTTCCCGTTCAG , OriGene Technologies Inc. CAT#: MP205604.

Techniques: Sequencing

Journal: Mediators of Inflammation

Article Title: Simvastatin Inhibits CYR61 Expression in Orbital Fibroblasts in Graves' Ophthalmopathy through the Regulation of FoxO3a Signaling

doi: 10.1155/2021/8888913

Figure Lengend Snippet: Dose- and time-dependent effects of CYR61 on the production of IL-6 and CCL20 in GO orbital fibroblasts. (a, b) GO orbital fibroblasts were treated with different doses (0, 2, 5, and 10 μ g/ml) of CYR61 for 24 h. IL-6 mRNA (a) and CCL20 mRNA (b) expressions were examined by real-time PCR. (c) GO orbital fibroblasts were treated with 2 μ g/ml CYR61 for 0, 24, 48, or 72 h. IL-6 mRNA expression was determined by real-time PCR. (d) GO orbital fibroblasts were treated with 5 μ g/ml CYR61 for 0, 24, 48, or 72 h. CCL20 mRNA expression was determined by real-time PCR. (e, f) GO orbital fibroblasts were treated with 5 μ g/ml CYR61 for 24 and 48 h. The protein levels of IL-6 (e) and CCL20 (f) in the culture supernatant were measured by ELISA. Data are presented as mean ± SD from at least three independent experiments. ∗ p < 0.05, ∗∗ p < 0.01.

Article Snippet: The primers used in this study were HP101467 for CYR61, HP100427 for IL-6, and HP100003 for GAPDH (Sino Biological, Wayne, PA, USA); and the primers for CCL20 were 5′-GTG CGC AAA TCC AAA ACA GA-3′ (forward) and 5′-CCA ACC CCA GCA AGG TTC TT-3′ (reverse).

Techniques: Real-time Polymerase Chain Reaction, Expressing, Enzyme-linked Immunosorbent Assay