Journal: Cancer gene therapy

Article Title: Pals1 functions in redundancy with SMAP1 to inhibit Arf6 in order to prevent Rac1-dependent colorectal cancer cell migration and invasion.

doi: 10.1038/s41417-022-00570-2

Figure Lengend Snippet: Fig. 1 Loss of Pals1 in a colorectal cancer cell line HCT116 results in TJ defects, enhanced migration and invasion. A Immunostaining of confluent HCT116 and HCT116ΔPals1 cells with indicated antibodies, B Activation of Rac1 in wild type and Pals1-deficient HCT116 was quantified using G-LISA assay. C Representative images and quantification of the FRET signal of a biosensor targeting active Rac1, transfected in HCT116 and HCT116ΔPals1 cells. Results are representative of 4 experiments. D Quantification of Rac1 biosensor FRET signals at the cell body and the cell cortex in HCT116 and HCT116ΔPals1 cells. Scale bars are 20 µm in A, C.

Article Snippet: The Rac1 G-LISA activity assay (#BK128, Cytoskeleton Inc.) was performed according to manufacturer’s instructions, using 0.5 mg/ml protein concentration of cell lysates.

Techniques: Migration, Immunostaining, Activation Assay, Transfection

Journal: Cancer gene therapy

Article Title: Pals1 functions in redundancy with SMAP1 to inhibit Arf6 in order to prevent Rac1-dependent colorectal cancer cell migration and invasion.

doi: 10.1038/s41417-022-00570-2

Figure Lengend Snippet: Fig. 2 Deletion of Pals1 in Caco-2 cells does not result in enhanced migration and invasion or upregulation of active Arf6 or Rac1. A Immunostaining of confluent Caco-2 and Caco-2ΔPals1 cells with the indicated antibodies. B Representative images from wound healing assays of Caco-2 and Caco-2ΔPals1 cells and the corresponding quantification (N = 3). C Representative images and quantification of transwell matrigel invasions assays of Caco-2 and Caco-2ΔPals1 cells (N = 5). D Western blot and CBB-stained gel of pulldown experiments to detect active Arf6 from lysates of Caco-2 and Caco-2ΔPals1 cells (N = 6). E Western blot and CBB-stained gel of pulldown experiments to detect active Rac1 from lysates of Caco-2 and Caco-2ΔPals1 cells (N = 3). F Representative images and quantification of the FRET signal of a biosensor targeting active Rac1, transfected in Caco-2 and Caco-2ΔPals1 cells. Results are representative of 4 experiments. Scale bars are 20 µm in A and F, 100 µm in B.

Article Snippet: The Rac1 G-LISA activity assay (#BK128, Cytoskeleton Inc.) was performed according to manufacturer’s instructions, using 0.5 mg/ml protein concentration of cell lysates.

Techniques: Migration, Immunostaining, Western Blot, Staining, Transfection

Journal: Cancer gene therapy

Article Title: Pals1 functions in redundancy with SMAP1 to inhibit Arf6 in order to prevent Rac1-dependent colorectal cancer cell migration and invasion.

doi: 10.1038/s41417-022-00570-2

Figure Lengend Snippet: Fig. 3 Pals1-deficient DLD1 do not exhibit increased Arf6/Rac1 activity or enhanced cell migration/invasion. A Immunostaining of confluent DLD1 and DLD1ΔPals1 cells with the indicated antibodies. B Representative images from wound healing assays of DLD1 and DLD1ΔPals1 cells and the corresponding quantification (N = 3). C Representative images and quantification of transwell matrigel invasion assays of DLD1 and DLD1ΔPals1 cells (N = 3). D Western blot and CBB-stained gel of pulldown experiments to detect active Arf6 from cell lysates of DLD1 and DLD1ΔPals1 cells (N = 8). E Western blot and CBB-stained gel of pulldown experiments to detect active Rac1 from cell lysates of DLD1 and DLD1ΔPals1 cells (N = 3). Scale bars are 20 µm in A and 100 µm in B.

Article Snippet: The Rac1 G-LISA activity assay (#BK128, Cytoskeleton Inc.) was performed according to manufacturer’s instructions, using 0.5 mg/ml protein concentration of cell lysates.

Techniques: Activity Assay, Migration, Immunostaining, Western Blot, Staining

Journal: Cancer gene therapy

Article Title: Pals1 functions in redundancy with SMAP1 to inhibit Arf6 in order to prevent Rac1-dependent colorectal cancer cell migration and invasion.

doi: 10.1038/s41417-022-00570-2

Figure Lengend Snippet: Fig. 4 Knockout of Pals1 in mesenchymal-like RKO cells does not affect cell motility. A Western blot analysis of the expression of E-Cadherin in different colorectal cancer cell lines. B Representative images from wound healing assays of RKO and RKOΔPals1 cells and the corresponding quantification (N = 6). C Representative images and quantification of transwell matrigel invasion assays of RKO and RKOΔPals1 cells (N = 4). D Western blot and CBB-stained gel of pulldown experiments to detect active Arf6 from cell lysates of RKO and RKOΔPals1 cells (N = 6). E Western blot and CBB-stained gel of pulldown experiments to detect active Rac1 from cell lysates of RKO and RKOΔPals1 cells (N = 3). Scale bars are 100 µm in B.

Article Snippet: The Rac1 G-LISA activity assay (#BK128, Cytoskeleton Inc.) was performed according to manufacturer’s instructions, using 0.5 mg/ml protein concentration of cell lysates.

Techniques: Knock-Out, Western Blot, Expressing, Staining

Journal: Cancer gene therapy

Article Title: Pals1 functions in redundancy with SMAP1 to inhibit Arf6 in order to prevent Rac1-dependent colorectal cancer cell migration and invasion.

doi: 10.1038/s41417-022-00570-2

Figure Lengend Snippet: Fig. 6 SW48ΔPals1 cells display enhanced Arf6/Rac1 activation and increased cell migration, which can be rescued by SMAP1 transfection. A Immunostaining of confluent SW48 and SW48ΔPals1 cells with the indicated antibodies. B Representative images and quantification of the FRET signal of a biosensor targeting active Rac1, transfected in SW48 and SW48ΔPals1 cells. Results are representative of 3 experiments. C Western blot of cell lines with and without SMAP1 overexpression. Empty vector was used as negative control. D, E Quantification of cell migration (scratch assay, D) and invasions assay (E) of the indicated cell lines. F Rac1 activation of the indicated cell lines quantified by G-LISA. G Western blot and CBB-stained gel of pulldown experiments to detect active Arf6 from cell lysates of the indicated cell lines (N = 3). H Survival probability of colorectal cancer patients with only low Pals1 expression, only low SMAP1 expression or low Pals1 and low SMAP1 expression. Scale bars are 20 µm in A and B.

Article Snippet: The Rac1 G-LISA activity assay (#BK128, Cytoskeleton Inc.) was performed according to manufacturer’s instructions, using 0.5 mg/ml protein concentration of cell lysates.

Techniques: Activation Assay, Migration, Transfection, Immunostaining, Western Blot, Over Expression, Plasmid Preparation, Negative Control, Wound Healing Assay, Staining, Expressing

Journal: Cell

Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss

doi: 10.1016/j.cell.2019.12.002

Figure Lengend Snippet: (A) IF staining of MM from the ileum of LysMRiboTag mice using anti-MHC II (green) and anti-hemagglutinin (HA, red) antibodies. White arrows indicate MHC II+ HA- macrophages. Scale bars = 50 μm. Images representative of n=2 mice per group. (B) Volcano plot of differential expression analysis (DEseq2) of TRAPseq from LysMAdrb2fl/+:RiboTag mice comparing input (ileum tissue) to immunoprecipitated (i.p.) transcripts (red dots) All i.p. samples indicated by red dots are log2FoldChange > 0.5 and padj > 0.05. Relevant macrophage genes highlighted in black text and Nlrp6 (neuronal specific) highlighted in blue text. (C) Transcripts per million (TPM) as calculated by Kallisto alignment of Adrb2 transcript comparing input (ileum tissue) or immunoprecipitated transcripts from LysMAdrb2fl/+:RiboTag and LysMΔAdrb2:RiboTag mice. (D-H) LysMΔAdrb2 and wild-type (WT) littermate control mice were orally infected with spiB. (D) Quantification of fecal colony forming units (CFU) on the indicated days post-infection (E) Quantification of fecal lipocalin-2 (Lcn-2) on the indicated days post-infection. (F) Total gastrointestinal transit time; experiments were ended at 450 min (dashed line); (G, H) Neuronal quantification in the ileum myenteric plexus on day 7 post-spiB infection of (G) LysMΔAdrb2 mice and WT littermates; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 mice and WT littermates (Figure S5B); (H) LysMΔAdrb2 and WT littermates receiving salbutamol via subcutaneous osmotic pumps and infected with spiB post-implantation; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 and WT littermate mice (Figure S5B). Unless indicated otherwise, data are representative of 3–6 mice per condition, were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S5 and Supplemental Information.

Article Snippet: NCBI GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse: Adrb2 flox G. Karsenty N/A Mouse: Arg1 flox Jackson Laboratory #008817 Mouse: Cx3cr1 GFP Mouse: Nestin GFP P. Frenette, G. Enikolopov N/A Mouse: Casp11 −/− Jackson Laboratory #024698 Mouse: R26-CAG-ASC-citrine Jackson Laboratory #030744 Mouse: NSG Jackson Laboratory #005557 Mouse: Phox2b cre Jackson Laboratory # 016223 #Mouse: Plp1 CreERT Jackson Laboratory # 005975 Mouse: Rosa26 DTA Jackson Laboratory # 009669 Mouse: R26-hM4Di/mCitrine Jackson Laboratory # 026219 Mouse: Sox10 CreERT2 B. Gulbransen, V. Pachnis N/A Mouse: SNS cre R. Kuhner N/A Mouse: Nlrp6 flox P. Rosenstiel N/A Mouse: Casp11 flox KOMP N/A Oligonucleotides Casp11 forward 5’-AGGCATATCTATAATCCCTTCACTG-3’ IDT N/A Casp11 reverse 5’-GAATATATCAAAGAGATGACAAGAGC- 3’ IDT N/A Arg1 forward 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ IDT N/A Arg1 reverse 5’-AGGAGCTGTCATTAGGGACATC-3’ IDT N/A Ym1 forward 5’-AGACTTGCGTGACTATGAAGCATT-3’ IDT N/A Ym1 reverse 5’-GCAGGTCCAAACTTCCATCCTC-3’ IDT N/A Rpl32 forward 5’-ACAATGTCAAGGAGCTGGAG-3’ IDT N/A Rpl32 reverse 5’-TTGGGATTGGTGACTCTGATG-3’ IDT N/A Nlrp6 E1 forward 5’-TTGACTGTCAGCAAGAGTCC-3’ IDT N/A Nlrp6 E1 reverse 5’-GGTGATCCTTTCTGGGCTAAA-3’ IDT N/A Nlrp6 E4 forward 5’-CAGACGCTGTGGACCTTGT-3’ IDT N/A Nlrp6 E4 reverse 5’- ACGTGCTCGCGGTACTTCTT-3’ IDT N/A Elavl4 forward 5’-GAT CAGGGATGCTAACCTGTATG-3’ IDT N/A Elavl4 reverse 5’- GGTGATGATGCGACCGTATT -3’ IDT N/A Recombinant DNA AAV9-hSyn-eGFP-WPRE-bGH Addgene #105539-AAV9 AAV9-hSyn-HI-eGFP-Cre-WPRE-SV40 Addgene #105540-AAV9 Software and Algorithms GraphPad Prism version 8 for MacOS Graphpad Software Inc. https://www.graphpad.com RStudio RStudio® https://www.rstudio.com DEseq2 Bioconstructor https://bioconductor.org/packages/release/bioc/html/DESeq2.html Imaris (v. 8.4) Bitplane Fiji ImageJ https://imagej.net/Welcome Microsoft Excel for MacOS Microsoft https://products.office.com/en-us/excel Other Salmonella Shigella Agar (SS Agar) BD Cat# 211597 Luria’s Broth base (LB) Thermo-Fisher Scientific Cat# 12795027 O.C.T.

Techniques: Staining, Quantitative Proteomics, Immunoprecipitation, Control, Infection

Journal: Cell

Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss

doi: 10.1016/j.cell.2019.12.002

Figure Lengend Snippet: Data and Software Availability

Article Snippet: NCBI GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse: Adrb2 flox G. Karsenty N/A Mouse: Arg1 flox Jackson Laboratory #008817 Mouse: Cx3cr1 GFP Mouse: Nestin GFP P. Frenette, G. Enikolopov N/A Mouse: Casp11 −/− Jackson Laboratory #024698 Mouse: R26-CAG-ASC-citrine Jackson Laboratory #030744 Mouse: NSG Jackson Laboratory #005557 Mouse: Phox2b cre Jackson Laboratory # 016223 #Mouse: Plp1 CreERT Jackson Laboratory # 005975 Mouse: Rosa26 DTA Jackson Laboratory # 009669 Mouse: R26-hM4Di/mCitrine Jackson Laboratory # 026219 Mouse: Sox10 CreERT2 B. Gulbransen, V. Pachnis N/A Mouse: SNS cre R. Kuhner N/A Mouse: Nlrp6 flox P. Rosenstiel N/A Mouse: Casp11 flox KOMP N/A Oligonucleotides Casp11 forward 5’-AGGCATATCTATAATCCCTTCACTG-3’ IDT N/A Casp11 reverse 5’-GAATATATCAAAGAGATGACAAGAGC- 3’ IDT N/A Arg1 forward 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ IDT N/A Arg1 reverse 5’-AGGAGCTGTCATTAGGGACATC-3’ IDT N/A Ym1 forward 5’-AGACTTGCGTGACTATGAAGCATT-3’ IDT N/A Ym1 reverse 5’-GCAGGTCCAAACTTCCATCCTC-3’ IDT N/A Rpl32 forward 5’-ACAATGTCAAGGAGCTGGAG-3’ IDT N/A Rpl32 reverse 5’-TTGGGATTGGTGACTCTGATG-3’ IDT N/A Nlrp6 E1 forward 5’-TTGACTGTCAGCAAGAGTCC-3’ IDT N/A Nlrp6 E1 reverse 5’-GGTGATCCTTTCTGGGCTAAA-3’ IDT N/A Nlrp6 E4 forward 5’-CAGACGCTGTGGACCTTGT-3’ IDT N/A Nlrp6 E4 reverse 5’- ACGTGCTCGCGGTACTTCTT-3’ IDT N/A Elavl4 forward 5’-GAT CAGGGATGCTAACCTGTATG-3’ IDT N/A Elavl4 reverse 5’- GGTGATGATGCGACCGTATT -3’ IDT N/A Recombinant DNA AAV9-hSyn-eGFP-WPRE-bGH Addgene #105539-AAV9 AAV9-hSyn-HI-eGFP-Cre-WPRE-SV40 Addgene #105540-AAV9 Software and Algorithms GraphPad Prism version 8 for MacOS Graphpad Software Inc. https://www.graphpad.com RStudio RStudio® https://www.rstudio.com DEseq2 Bioconstructor https://bioconductor.org/packages/release/bioc/html/DESeq2.html Imaris (v. 8.4) Bitplane Fiji ImageJ https://imagej.net/Welcome Microsoft Excel for MacOS Microsoft https://products.office.com/en-us/excel Other Salmonella Shigella Agar (SS Agar) BD Cat# 211597 Luria’s Broth base (LB) Thermo-Fisher Scientific Cat# 12795027 O.C.T.

Techniques: Software, Staining, Recombinant, Saline, DNA Extraction, RNAscope, Binding Assay, Enzyme-linked Immunosorbent Assay, Isolation, Generated, RNA Sequencing, Gene Expression