frameg Search Results


90
Fette Compacting GmbH three-chamber feed frame fom
Three Chamber Feed Frame Fom, supplied by Fette Compacting GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/frameg/three+chamber+feed+frame+fom/10__1016_slash_j__powtec__2024__119369-86-14-18
Average 90 stars, based on 1 article reviews
three-chamber feed frame fom - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
NSK Americas motor m-ps1006kn002
Motor M Ps1006kn002, supplied by NSK Americas, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/frameg/motor+m+ps1006kn002/10__1016_slash_j__proeng__2016__08__877-87-5-8
Average 90 stars, based on 1 article reviews
motor m-ps1006kn002 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
CBS Scientific gel frames
Gel Frames, supplied by CBS Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/frameg/gel+frames/pmc00019147-54-1-10
Average 90 stars, based on 1 article reviews
gel frames - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Neuralynx inc online frame-capture cohu camera
Online Frame Capture Cohu Camera, supplied by Neuralynx inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/frameg/online+frame+capture+cohu+camera/pmc02516968-231-7-16
Average 90 stars, based on 1 article reviews
online frame-capture cohu camera - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Broad Institute Inc plasmodium strains
Plasmodium Strains, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/frameg/plasmodium+strains/pmc02746569__mmi0072___0229___SD1-52-3-50
Average 90 stars, based on 1 article reviews
plasmodium strains - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
RS Components aluminum frame flexlink aluminium structural system
Aluminum Frame Flexlink Aluminium Structural System, supplied by RS Components, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/frameg/aluminum+frame+flexlink+aluminium+structural+system/pmc02773008-38-22-28
Average 90 stars, based on 1 article reviews
aluminum frame flexlink aluminium structural system - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
imaGenes GmbH clone iralp962p0840q
A) PNS extracted from S-HeLa cells was adjusted to the final OptiPrep concentration, 40.6% (w/v), and underloaded at the bottom of a 5–20% (w/v) continuous OptiPrep gradient. After centrifugation, 27 fractions of equal volume (450 µL each) were collected, pelleted, resolved on the gradient (6–15%) SDS–PAGE and immunoblotted for APPL2 and <t>Annexin</t> <t>A2.</t> B) Western blot shown in A was subjected to densitometric analysis with Odyssey Infrared Imaging System. Fluorescence intensities of APPL2 and Annexin A2 bands in each fraction are expressed in arbitrary units (AU). C and D) Colocalization analysis of APPL2 and Annexin A2 in CCD-1070SK cells. In (C), cells were fixed, permeabilized and immunostained with antibodies against APPL2 (red) and Annexin A2 (HH7 clone; green). In (D), cells were initially permeabilized as described in Materials and Methods in order to wash away the cytoplasmic fraction of Annexin A2, then fixed and immunostained as in D. Single confocal sections are shown in (C) and (D). Scale bar, 20 µm.
Clone Iralp962p0840q, supplied by imaGenes GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/frameg/clone+iralp962p0840q/pmc03380557-142-3-13
Average 90 stars, based on 1 article reviews
clone iralp962p0840q - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
BitFlow Inc frame grabbers bitflow r3
A) PNS extracted from S-HeLa cells was adjusted to the final OptiPrep concentration, 40.6% (w/v), and underloaded at the bottom of a 5–20% (w/v) continuous OptiPrep gradient. After centrifugation, 27 fractions of equal volume (450 µL each) were collected, pelleted, resolved on the gradient (6–15%) SDS–PAGE and immunoblotted for APPL2 and <t>Annexin</t> <t>A2.</t> B) Western blot shown in A was subjected to densitometric analysis with Odyssey Infrared Imaging System. Fluorescence intensities of APPL2 and Annexin A2 bands in each fraction are expressed in arbitrary units (AU). C and D) Colocalization analysis of APPL2 and Annexin A2 in CCD-1070SK cells. In (C), cells were fixed, permeabilized and immunostained with antibodies against APPL2 (red) and Annexin A2 (HH7 clone; green). In (D), cells were initially permeabilized as described in Materials and Methods in order to wash away the cytoplasmic fraction of Annexin A2, then fixed and immunostained as in D. Single confocal sections are shown in (C) and (D). Scale bar, 20 µm.
Frame Grabbers Bitflow R3, supplied by BitFlow Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/frameg/frame+grabbers+bitflow+r3/pmc02742888-128-2-5
Average 90 stars, based on 1 article reviews
frame grabbers bitflow r3 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Genlantis inc phcmv-luc-fsr vector
A) PNS extracted from S-HeLa cells was adjusted to the final OptiPrep concentration, 40.6% (w/v), and underloaded at the bottom of a 5–20% (w/v) continuous OptiPrep gradient. After centrifugation, 27 fractions of equal volume (450 µL each) were collected, pelleted, resolved on the gradient (6–15%) SDS–PAGE and immunoblotted for APPL2 and <t>Annexin</t> <t>A2.</t> B) Western blot shown in A was subjected to densitometric analysis with Odyssey Infrared Imaging System. Fluorescence intensities of APPL2 and Annexin A2 bands in each fraction are expressed in arbitrary units (AU). C and D) Colocalization analysis of APPL2 and Annexin A2 in CCD-1070SK cells. In (C), cells were fixed, permeabilized and immunostained with antibodies against APPL2 (red) and Annexin A2 (HH7 clone; green). In (D), cells were initially permeabilized as described in Materials and Methods in order to wash away the cytoplasmic fraction of Annexin A2, then fixed and immunostained as in D. Single confocal sections are shown in (C) and (D). Scale bar, 20 µm.
Phcmv Luc Fsr Vector, supplied by Genlantis inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/frameg/phcmv+luc+fsr+vector/pmc02672613-140-34-36
Average 90 stars, based on 1 article reviews
phcmv-luc-fsr vector - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
NanoSight ltd video frames
A) PNS extracted from S-HeLa cells was adjusted to the final OptiPrep concentration, 40.6% (w/v), and underloaded at the bottom of a 5–20% (w/v) continuous OptiPrep gradient. After centrifugation, 27 fractions of equal volume (450 µL each) were collected, pelleted, resolved on the gradient (6–15%) SDS–PAGE and immunoblotted for APPL2 and <t>Annexin</t> <t>A2.</t> B) Western blot shown in A was subjected to densitometric analysis with Odyssey Infrared Imaging System. Fluorescence intensities of APPL2 and Annexin A2 bands in each fraction are expressed in arbitrary units (AU). C and D) Colocalization analysis of APPL2 and Annexin A2 in CCD-1070SK cells. In (C), cells were fixed, permeabilized and immunostained with antibodies against APPL2 (red) and Annexin A2 (HH7 clone; green). In (D), cells were initially permeabilized as described in Materials and Methods in order to wash away the cytoplasmic fraction of Annexin A2, then fixed and immunostained as in D. Single confocal sections are shown in (C) and (D). Scale bar, 20 µm.
Video Frames, supplied by NanoSight ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/frameg/video+frames/pmc03137085-577-0-0
Average 90 stars, based on 1 article reviews
video frames - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Matrox Electronic Systems Ltd frame grabber meteor-ii/multi-channel
A) PNS extracted from S-HeLa cells was adjusted to the final OptiPrep concentration, 40.6% (w/v), and underloaded at the bottom of a 5–20% (w/v) continuous OptiPrep gradient. After centrifugation, 27 fractions of equal volume (450 µL each) were collected, pelleted, resolved on the gradient (6–15%) SDS–PAGE and immunoblotted for APPL2 and <t>Annexin</t> <t>A2.</t> B) Western blot shown in A was subjected to densitometric analysis with Odyssey Infrared Imaging System. Fluorescence intensities of APPL2 and Annexin A2 bands in each fraction are expressed in arbitrary units (AU). C and D) Colocalization analysis of APPL2 and Annexin A2 in CCD-1070SK cells. In (C), cells were fixed, permeabilized and immunostained with antibodies against APPL2 (red) and Annexin A2 (HH7 clone; green). In (D), cells were initially permeabilized as described in Materials and Methods in order to wash away the cytoplasmic fraction of Annexin A2, then fixed and immunostained as in D. Single confocal sections are shown in (C) and (D). Scale bar, 20 µm.
Frame Grabber Meteor Ii/Multi Channel, supplied by Matrox Electronic Systems Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/frameg/frame+grabber+meteor+ii+multi+channel/pmc03177614-139-9-12
Average 90 stars, based on 1 article reviews
frame grabber meteor-ii/multi-channel - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Xerox Corporation standard frame format
A) PNS extracted from S-HeLa cells was adjusted to the final OptiPrep concentration, 40.6% (w/v), and underloaded at the bottom of a 5–20% (w/v) continuous OptiPrep gradient. After centrifugation, 27 fractions of equal volume (450 µL each) were collected, pelleted, resolved on the gradient (6–15%) SDS–PAGE and immunoblotted for APPL2 and <t>Annexin</t> <t>A2.</t> B) Western blot shown in A was subjected to densitometric analysis with Odyssey Infrared Imaging System. Fluorescence intensities of APPL2 and Annexin A2 bands in each fraction are expressed in arbitrary units (AU). C and D) Colocalization analysis of APPL2 and Annexin A2 in CCD-1070SK cells. In (C), cells were fixed, permeabilized and immunostained with antibodies against APPL2 (red) and Annexin A2 (HH7 clone; green). In (D), cells were initially permeabilized as described in Materials and Methods in order to wash away the cytoplasmic fraction of Annexin A2, then fixed and immunostained as in D. Single confocal sections are shown in (C) and (D). Scale bar, 20 µm.
Standard Frame Format, supplied by Xerox Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/frameg/standard+frame+format/us08099474-245-16-26
Average 90 stars, based on 1 article reviews
standard frame format - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


A) PNS extracted from S-HeLa cells was adjusted to the final OptiPrep concentration, 40.6% (w/v), and underloaded at the bottom of a 5–20% (w/v) continuous OptiPrep gradient. After centrifugation, 27 fractions of equal volume (450 µL each) were collected, pelleted, resolved on the gradient (6–15%) SDS–PAGE and immunoblotted for APPL2 and Annexin A2. B) Western blot shown in A was subjected to densitometric analysis with Odyssey Infrared Imaging System. Fluorescence intensities of APPL2 and Annexin A2 bands in each fraction are expressed in arbitrary units (AU). C and D) Colocalization analysis of APPL2 and Annexin A2 in CCD-1070SK cells. In (C), cells were fixed, permeabilized and immunostained with antibodies against APPL2 (red) and Annexin A2 (HH7 clone; green). In (D), cells were initially permeabilized as described in Materials and Methods in order to wash away the cytoplasmic fraction of Annexin A2, then fixed and immunostained as in D. Single confocal sections are shown in (C) and (D). Scale bar, 20 µm.

Journal: Traffic (Copenhagen, Denmark)

Article Title: Biochemical Characterization of APPL Endosomes: The Role of Annexin A2 in APPL Membrane Recruitment

doi: 10.1111/j.1600-0854.2011.01226.x

Figure Lengend Snippet: A) PNS extracted from S-HeLa cells was adjusted to the final OptiPrep concentration, 40.6% (w/v), and underloaded at the bottom of a 5–20% (w/v) continuous OptiPrep gradient. After centrifugation, 27 fractions of equal volume (450 µL each) were collected, pelleted, resolved on the gradient (6–15%) SDS–PAGE and immunoblotted for APPL2 and Annexin A2. B) Western blot shown in A was subjected to densitometric analysis with Odyssey Infrared Imaging System. Fluorescence intensities of APPL2 and Annexin A2 bands in each fraction are expressed in arbitrary units (AU). C and D) Colocalization analysis of APPL2 and Annexin A2 in CCD-1070SK cells. In (C), cells were fixed, permeabilized and immunostained with antibodies against APPL2 (red) and Annexin A2 (HH7 clone; green). In (D), cells were initially permeabilized as described in Materials and Methods in order to wash away the cytoplasmic fraction of Annexin A2, then fixed and immunostained as in D. Single confocal sections are shown in (C) and (D). Scale bar, 20 µm.

Article Snippet: To obtain pGEX-AnnexinA2, Annexin A2 open reading frame (ORF) (clone IRALp962P0840Q obtained from http://www.imagenes-bio.de ) was subcloned to pGEX-6P-1 (GE Healthcare), using the following primers: forward TACGGATCCTCTACTGTTCAC, reverse TACCTCGAGTCAGTCATCTCC.

Techniques: Concentration Assay, Centrifugation, SDS Page, Western Blot, Imaging, Fluorescence

A and B) HEK293 cells were co-transfected with the plasmid encoding bacterial biotin-protein ligase (BirA) and one of the plasmids encoding GFP, APPL2 or APPL1 tagged with a BirA target sequence (pBT-GFP, pBT-APPL2, pBT-mycAPPL2 or pBT-mycAPPL1). Forty-eight hours after transfection, cells were lysed and affinity purification of APPL-interacting proteins was performed with streptavidine-conjugated magnetic beads. A) Binding of Annexin A2 to in vivo biotinylated APPL1 or APPL2 proteins is shown. Samples were resolved on 10% SDS–PAGE. Nitrocellulose membrane was stained with Ponceau S (lower panel) and immunoblotted for Annexin A2 (upper panel). B) Binding of Annexin A1 and Annexin A6 to in vivo biotinylated APPL1 or APPL2 proteins was tested. Samples were resolved on 10% SDS–PAGE and immunoblotted for Annexin A1 and Annexin A6, with Annexin A2 serving as a positive control. C) Migration of Annexins A1 and A6 in the OptiPrep density gradient. PNS sample adjusted to the final OptiPrep concentration 40.6% (w/v) was underloaded at the bottom of a 5–20% (w/v) continuous OptiPrep gradient. Twenty-five fractions of equal volume (500 µL each) were collected, pelleted, resolved on the gradient (6–15%) SDS–PAGE and immunoblotted for APPL2, Annexin A6, Annexin A1 and Annexin A2. D–F) GST pull-downs were performed with wild-type GST–Annexin A2 (GST–ANXA2) or GST alone with lysates from HEK293 cells overexpressing HA-APPL1 (D) and HA-APPL2 (E) or in vitro translated APPL2 (F). All samples were resolved on 8% SDS–PAGE and immunoblotted for APPL1 or APPL2, as indicated. As controls, 1 µL of cell lysates (1% of the input) was loaded in (D) and (E), and 1 µL in vitro translated protein (2% of the input) was loaded in F. G) GST pull-downs were performed with GST–Annexin A2 wild-type (GST–ANXA2) or mutants (TCM, Y23D, Y23A, CTΔ9, CTΔ13), or GST alone using lysates from HEK293 cells overexpressing HA-APPL2. All samples were resolved on 10% SDS–PAGE. Nitrocellulose membrane was stained with Ponceau S (lower panel) and immunoblotted for APPL2 (upper panel). As a control, 1 µL of cell lysate (1% of the input) was loaded. MW, lane with a molecular weight marker.

Journal: Traffic (Copenhagen, Denmark)

Article Title: Biochemical Characterization of APPL Endosomes: The Role of Annexin A2 in APPL Membrane Recruitment

doi: 10.1111/j.1600-0854.2011.01226.x

Figure Lengend Snippet: A and B) HEK293 cells were co-transfected with the plasmid encoding bacterial biotin-protein ligase (BirA) and one of the plasmids encoding GFP, APPL2 or APPL1 tagged with a BirA target sequence (pBT-GFP, pBT-APPL2, pBT-mycAPPL2 or pBT-mycAPPL1). Forty-eight hours after transfection, cells were lysed and affinity purification of APPL-interacting proteins was performed with streptavidine-conjugated magnetic beads. A) Binding of Annexin A2 to in vivo biotinylated APPL1 or APPL2 proteins is shown. Samples were resolved on 10% SDS–PAGE. Nitrocellulose membrane was stained with Ponceau S (lower panel) and immunoblotted for Annexin A2 (upper panel). B) Binding of Annexin A1 and Annexin A6 to in vivo biotinylated APPL1 or APPL2 proteins was tested. Samples were resolved on 10% SDS–PAGE and immunoblotted for Annexin A1 and Annexin A6, with Annexin A2 serving as a positive control. C) Migration of Annexins A1 and A6 in the OptiPrep density gradient. PNS sample adjusted to the final OptiPrep concentration 40.6% (w/v) was underloaded at the bottom of a 5–20% (w/v) continuous OptiPrep gradient. Twenty-five fractions of equal volume (500 µL each) were collected, pelleted, resolved on the gradient (6–15%) SDS–PAGE and immunoblotted for APPL2, Annexin A6, Annexin A1 and Annexin A2. D–F) GST pull-downs were performed with wild-type GST–Annexin A2 (GST–ANXA2) or GST alone with lysates from HEK293 cells overexpressing HA-APPL1 (D) and HA-APPL2 (E) or in vitro translated APPL2 (F). All samples were resolved on 8% SDS–PAGE and immunoblotted for APPL1 or APPL2, as indicated. As controls, 1 µL of cell lysates (1% of the input) was loaded in (D) and (E), and 1 µL in vitro translated protein (2% of the input) was loaded in F. G) GST pull-downs were performed with GST–Annexin A2 wild-type (GST–ANXA2) or mutants (TCM, Y23D, Y23A, CTΔ9, CTΔ13), or GST alone using lysates from HEK293 cells overexpressing HA-APPL2. All samples were resolved on 10% SDS–PAGE. Nitrocellulose membrane was stained with Ponceau S (lower panel) and immunoblotted for APPL2 (upper panel). As a control, 1 µL of cell lysate (1% of the input) was loaded. MW, lane with a molecular weight marker.

Article Snippet: To obtain pGEX-AnnexinA2, Annexin A2 open reading frame (ORF) (clone IRALp962P0840Q obtained from http://www.imagenes-bio.de ) was subcloned to pGEX-6P-1 (GE Healthcare), using the following primers: forward TACGGATCCTCTACTGTTCAC, reverse TACCTCGAGTCAGTCATCTCC.

Techniques: Transfection, Plasmid Preparation, Sequencing, Affinity Purification, Magnetic Beads, Binding Assay, In Vivo, SDS Page, Membrane, Staining, Positive Control, Migration, Concentration Assay, In Vitro, Control, Molecular Weight, Marker

A–D) CCD-1070SK cells were transfected with three different siRNAs targeting Annexin A2 (AnxA2 siRNA_1-3) or two non-targeting negative controls (nc1, nc2), or were mock transfected (nt). A) Ninety-six hours after transfection, cells were lysed and the level of Annexin A2 was assessed. Samples were resolved on 8% SDS–PAGE and immunoblotted for APPL2 and Annexin A2, with β-actin as a loading control. B) Cells were fixed and immunostained with antibodies against APPL2. Single confocal images are shown. Scale bar, 20 µm. C and D) Total integral fluorescence intensity of APPL2 vesicles (C) and their average number (D) were quantified using M otion T racking software. At least 20 images of each variant were subjected to the analysis. The data are representative of three independent experiments. Error bars are SEM (standard error of the mean), fluorescence intensity is expressed in arbitrary units (AU). E and F) CCD-1070SK cells were transfected with non-targeting negative siRNA control nc2 (E) or with siRNA AnxA2 siRNA_3 targeting Annexin A2 (F), fixed and immunostained with antibodies against Annexin A2 and endosomal markers EEA1, Rab5 or Rab11, as indicated. Scale bar, 20 µm.

Journal: Traffic (Copenhagen, Denmark)

Article Title: Biochemical Characterization of APPL Endosomes: The Role of Annexin A2 in APPL Membrane Recruitment

doi: 10.1111/j.1600-0854.2011.01226.x

Figure Lengend Snippet: A–D) CCD-1070SK cells were transfected with three different siRNAs targeting Annexin A2 (AnxA2 siRNA_1-3) or two non-targeting negative controls (nc1, nc2), or were mock transfected (nt). A) Ninety-six hours after transfection, cells were lysed and the level of Annexin A2 was assessed. Samples were resolved on 8% SDS–PAGE and immunoblotted for APPL2 and Annexin A2, with β-actin as a loading control. B) Cells were fixed and immunostained with antibodies against APPL2. Single confocal images are shown. Scale bar, 20 µm. C and D) Total integral fluorescence intensity of APPL2 vesicles (C) and their average number (D) were quantified using M otion T racking software. At least 20 images of each variant were subjected to the analysis. The data are representative of three independent experiments. Error bars are SEM (standard error of the mean), fluorescence intensity is expressed in arbitrary units (AU). E and F) CCD-1070SK cells were transfected with non-targeting negative siRNA control nc2 (E) or with siRNA AnxA2 siRNA_3 targeting Annexin A2 (F), fixed and immunostained with antibodies against Annexin A2 and endosomal markers EEA1, Rab5 or Rab11, as indicated. Scale bar, 20 µm.

Article Snippet: To obtain pGEX-AnnexinA2, Annexin A2 open reading frame (ORF) (clone IRALp962P0840Q obtained from http://www.imagenes-bio.de ) was subcloned to pGEX-6P-1 (GE Healthcare), using the following primers: forward TACGGATCCTCTACTGTTCAC, reverse TACCTCGAGTCAGTCATCTCC.

Techniques: Transfection, SDS Page, Control, Fluorescence, Software, Variant Assay

CCD-1070SK cells were transfected with plasmids encoding Annexin A2–GFP, myc-tagged Rab5-S34N or both, as indicated. Cells were fixed and immunostained with antibodies against APPL2 (green), GFP (red) and myc (blue). Single confocal sections are shown. Scale bar, 20 µm.

Journal: Traffic (Copenhagen, Denmark)

Article Title: Biochemical Characterization of APPL Endosomes: The Role of Annexin A2 in APPL Membrane Recruitment

doi: 10.1111/j.1600-0854.2011.01226.x

Figure Lengend Snippet: CCD-1070SK cells were transfected with plasmids encoding Annexin A2–GFP, myc-tagged Rab5-S34N or both, as indicated. Cells were fixed and immunostained with antibodies against APPL2 (green), GFP (red) and myc (blue). Single confocal sections are shown. Scale bar, 20 µm.

Article Snippet: To obtain pGEX-AnnexinA2, Annexin A2 open reading frame (ORF) (clone IRALp962P0840Q obtained from http://www.imagenes-bio.de ) was subcloned to pGEX-6P-1 (GE Healthcare), using the following primers: forward TACGGATCCTCTACTGTTCAC, reverse TACCTCGAGTCAGTCATCTCC.

Techniques: Transfection