Journal: Yonago Acta Medica

Article Title: Rapid Multiplex RT-PCR for Influenza A and B by Genesoc ® , a Microfluidic PCR System

doi: 10.33160/yam.2023.05.007

Figure Lengend Snippet: The primers and probes used in this study

Article Snippet: Primers & Probes Sequence (5’-3’) Product size (bp) Primers for Endpoint RT-PCR, Real-time RT-PCR and GeneSoC ® RT-PCR FluA F CCMAGGTCGAAACGTAYGTTCTCTCTATC 146 FluA R TGACAGRATYGGTCTTGTCTTTAGCCAYTCCA FluB F GGAGCAACCAATGCCAC 105 FluB R GTKTAGGCGGTCTTGACCAG Probes for GeneSoC ® RT-PCR FluA probe* (FAM) ATYTCGGCTTTGAGGGGGCCTG (BHQ1) FluB probe* (Cy5) ATAAACTTTGAAGCAGGAAT (BHQ3) Open in a separate window *Fluorescence labeling and quenching was optimized for GeneSoC ® by Kyorin Pharmaceutical Co., Ltd.

Techniques: Quantitative RT-PCR

Journal: iScience

Article Title: Portable wide-field femtoliter-chamber imaging system for point-of-care digital bioanalysis

doi: 10.1016/j.isci.2024.110868

Figure Lengend Snippet: Digital counting of viral RNAs (A) Number of positive chambers obtained with COWFISH2 (red), COWFISH (blue) or confocal microscopy (green). The linear regressions are represented by solid lines. The values of the blank mean +3 SD are shown as dotted lines ( n = 3 technical replicates). (B) Number of positive chambers obtained using COWFISH2 for SARS-CoV-2 (red), FluA (blue), or FluB (green). The linear regressions are represented by solid lines. The values of the blank mean + 3 SD are shown as dotted lines ( n = 3 technical replicates). (C) Number of positive chambers obtained using crRNA for SARS-CoV-2 (red), FluA (blue) or FluB (green). The concentration of tgRNA was 300 fM. Asterisks represent the significant differences determined by unpaired two-tailed Student’s t test with equal variance (∗∗: p < 0.01, ∗∗∗: p < 0.001, and ∗∗∗∗: p < 0.0001).

Article Snippet: crRNA for FluB , GeneDesign , N/A.

Techniques: Confocal Microscopy, Concentration Assay, Two Tailed Test

Journal: iScience

Article Title: Portable wide-field femtoliter-chamber imaging system for point-of-care digital bioanalysis

doi: 10.1016/j.isci.2024.110868

Figure Lengend Snippet:

Article Snippet: crRNA for FluB , GeneDesign , N/A.

Techniques: Virus, Recombinant, Modification, Plasmid Preparation, Software

Journal: NPJ Vaccines

Article Title: DMAb inoculation of synthetic cross reactive antibodies protects against lethal influenza A and B infections

doi: 10.1038/s41541-017-0020-x

Figure Lengend Snippet: In vitro and in vivo expression of DNA-encoded monoclonal antibody (DMAb) constructs. a 293 T cells were transfected with FluA or FluB DMAb plasmid constructs, or empty plasmid (pVax1). Human IgG expression in cell supernatants ( left ) and lysates ( right ) was quantified by ELISA. ( n = 3 biological replicates, mean ± SEM). b Western blot of human IgG heavy-chain and light-chain peptides in reduced DMAb-transfected 293 T cell supernatants (S) and lysates (L) ( left ), and purified protein monoclonal antibody FluA and FluB (IgG, right ). Samples derive from the same experiment and gels/blots were processed in parallel. c , d DMAb human IgG in CAnN.Cg- Foxn1 nu /Crl nude mouse sera after intramuscular electroporation (IM-EP) (Day 0) with 100–300 μg of FluA ( c ) or FluB ( d ) DMAb plasmid DNA. Sera were collected up to 35 days post electroporation in mice treated with 100 μg FluA DMAb, and up to 70 days in all other groups. ( n = 5 animals per group, mean ± SEM). e , f Levels of DMAb human IgG in BALB/c mouse sera 5 days post administration of 100–300 μg of FluA ( e ) or FluB ( f ) DMAb plasmid DNA. Dotted line indicates limit of detection (LOD). ( n = 5 animals per group, mean ± SEM)

Article Snippet: Six- to eight-week-old BALB/c mice (Harlan Laboratories) received FluA DMAb, FluB DMAb, or an irrelevant control DMAb (DVSF-3, previously described) via IM-EP 4–5 days prior to infection.

Techniques: In Vitro, In Vivo, Expressing, Construct, Transfection, Plasmid Preparation, Enzyme-linked Immunosorbent Assay, Western Blot, Purification, Electroporation

Journal: NPJ Vaccines

Article Title: DMAb inoculation of synthetic cross reactive antibodies protects against lethal influenza A and B infections

doi: 10.1038/s41541-017-0020-x

Figure Lengend Snippet: Serum FluA DMAb and FluB DMAb are functional. Functional assays performed with sera from BALB/c mice collected 5 days after treatment with 100–300 μg of FluA DMAb plasmid DNA ( a ) or FluB DMAb plasmid DNA ( b ) and ( c ). a ELISA binding EC 50 values (reciprocal dilution) for individual mouse serum samples to influenza A HA proteins from Group 1 (H1, A/California/07/2009 H1N1; H2, A/Missouri/2006 H2N3; H5, A/Vietnam/1203/2004 H5N1; H6, A/teal/Hong Kong/W312/97 H6N1; H9, A/chicken/Hong Kong/G9/1997 H9N2) and Group 2 (H3, A/Perth/16/2009 H3N2; H7, A/Netherlands/219/2003 H7N7). b ELISA Binding EC 50 values (reciprocal dilution) for individual mouse serum samples to influenza B HA proteins from the Yamagata (Yam B/Florida/4/2006) and Victoria (Vic B/Brisbane/60/2008) lineages. c Neutralization IC 50 values (reciprocal dilution) for individual mouse serum samples against influenza B viruses from the Yamagata (Yam virus B/Florida/4/2006) and Victoria (Vic virus B/Malaysia/2506/2004) lineages. ( n = 5 animals per group, mean ± SD)

Article Snippet: Six- to eight-week-old BALB/c mice (Harlan Laboratories) received FluA DMAb, FluB DMAb, or an irrelevant control DMAb (DVSF-3, previously described) via IM-EP 4–5 days prior to infection.

Techniques: Functional Assay, Plasmid Preparation, Enzyme-linked Immunosorbent Assay, Binding Assay, Neutralization

Journal: NPJ Vaccines

Article Title: DMAb inoculation of synthetic cross reactive antibodies protects against lethal influenza A and B infections

doi: 10.1038/s41541-017-0020-x

Figure Lengend Snippet: FluA DMAb protects mice from diverse lethal influenza A challenges. BALB/c mice were treated with FluA DMAb plasmid DNA ( closed symbols ) 4–5 days prior to intranasal infection with A/California/7/2009 H1N1 ( a–c ) or re-assorted rA/HongKong/8/68 × PR8 H3N1 ( d–f ). 1 day prior to infection, separate mice received 0.03–1 mg/kg FluA protein monoclonal antibody i.p. ( open symbols ). Mice treated with 300 μg irrelevant DMAb (DVSF-3) or 1 mg/kg non-specific protein monoclonal antibody (R347) served as controls. a , d Human IgG in mouse sera at the time of influenza infection. Dotted line indicates LOD. ( a n = 10 animals, d n = 5 animals per group, mean ± SD). b , e Kaplan–Meier survival curves of BALB/c mice challenged with influenza A ( n = 10 animals per group, * p ≤ 0.0001 FluA DMAb versus Control DMAb). c , f Weight of BALB/c mice following influenza A challenge. Dotted line indicates 25% maximum weight loss. ( n = 10 animals per group, mean ± SEM)

Article Snippet: Six- to eight-week-old BALB/c mice (Harlan Laboratories) received FluA DMAb, FluB DMAb, or an irrelevant control DMAb (DVSF-3, previously described) via IM-EP 4–5 days prior to infection.

Techniques: Plasmid Preparation, Infection

Journal: NPJ Vaccines

Article Title: DMAb inoculation of synthetic cross reactive antibodies protects against lethal influenza A and B infections

doi: 10.1038/s41541-017-0020-x

Figure Lengend Snippet: Co-administration of FluA and FluB DMAb protects mice from lethal influenza A/B challenge and homologous re-challenge. BALB/c mice received both FluA and FluB DMAb. Separate mice were treated with both FluA plus FluB protein monoclonal antibody. Mice received initial infection with either influenza A/California/7/2009 or B/Florida/4/2006. a Total human IgG levels in mice sera at the time of infection ( n = 8 animals per group, mean ± SD). b Influenza A-specific and B-specific human IgG in mouse serum at the time of infection quantified by HA binding ELISA ( n = 8 animals per group, mean ± SD). c , d Kaplan–Meier survival curves following initial infection with A/California/07/2009 ( c ) or B/Florida/4/2006 ( d ) ( n = 10 animals per group, * p ≤ 0.0001 Flu DMAb versus control DMAb). e , f 28 days following initial infection, surviving mice received homologous influenza re-infection. Kaplan–Meier survival curves following re-infection, compared to mice receiving neither DMAb/IgG treatment nor initial infection (naïve). (Number of animals in each group are shown)

Article Snippet: Six- to eight-week-old BALB/c mice (Harlan Laboratories) received FluA DMAb, FluB DMAb, or an irrelevant control DMAb (DVSF-3, previously described) via IM-EP 4–5 days prior to infection.

Techniques: Infection, Binding Assay, Enzyme-linked Immunosorbent Assay