Journal: Annals of Translational Medicine

Article Title: Identifying potential therapeutic targets of Tang-Yi-Ping for the treatment of impaired glucose tolerance: a tandem mass tag-labeled quantitative proteomic analysis

doi: 10.21037/atm-21-4257

Figure Lengend Snippet: Specific information on 16 protein targets in the treatment of IGT with TYP

Article Snippet: For example, the expression levels of Rbp4 (boster, #PB0368, China) and Flot2 (boster, #PB0663, China) in the 3 groups were calculated with GAPDH (boster, #BM1623, China) as an internal reference.

Techniques:

Journal: Annals of Translational Medicine

Article Title: Identifying potential therapeutic targets of Tang-Yi-Ping for the treatment of impaired glucose tolerance: a tandem mass tag-labeled quantitative proteomic analysis

doi: 10.21037/atm-21-4257

Figure Lengend Snippet: Relative expression levels of Rbp4 and Flot2 proteins in pancreatic samples of the 3 groups. Rbp4: *, P<0.05, vs. Control; #, P<0.05, vs. IGT. Flot: *, P<0.05, vs. Control; #, P<0.05, vs. IGT. IGT, impaired glucose tolerance.

Article Snippet: For example, the expression levels of Rbp4 (boster, #PB0368, China) and Flot2 (boster, #PB0663, China) in the 3 groups were calculated with GAPDH (boster, #BM1623, China) as an internal reference.

Techniques: Expressing, Control

Journal: PLoS ONE

Article Title: Differences in the Expression and Distribution of Flotillin-2 in Chick, Mice and Human Muscle Cells

doi: 10.1371/journal.pone.0103990

Figure Lengend Snippet: Chick myogenic cells were grown 24(control, Ct ). Cell culture extracts were analyzed in Western blot using an antibody against flotillin-2 ( A ). Lower Western blot shows α-tubulin reactivity of the same samples, and was used to normalize sample loading ( A ). Quantification of protein bands revealed a 40% increase in the levels of flotillin-2 expression after cholesterol depletion ( B ). RT-PCR analysis (for details, see ) of the expression of flotillin-2 in control and in MbCD-treated cells is shown in C . Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used for normalization. Analysis of the expression of flotillin-2 shows a more than 2-fold increase in the levels of mRNA expression in MbCD-treated cells compared with control cells. *p<0.05; t test for unpaired samples, n = 3.

Article Snippet: Primer sequences are listed below: NM_001030719.1 Gallus gallus flotillin 2 (FLOT2), mRNA product length = 74 Forward primer 1 GGCCTACGAGCTTCAAAGTG 20 Reverse primer 1 GTTGCACCACCTCGATTTCT 20 NM_204305.1 Gallus gallus glyceraldehyde-3-phosphate dehydrogenase (GAPDH), mRNA product length = 112 Forward primer 1 GACGTGCAGCAGGAACACTA 20 Reverse primer 1 CTTGGACTTTGCCAGAGAGG 20

Techniques: Control, Cell Culture, Western Blot, Expressing, Reverse Transcription Polymerase Chain Reaction