Journal: Annals of Translational Medicine

Article Title: Identifying potential therapeutic targets of Tang-Yi-Ping for the treatment of impaired glucose tolerance: a tandem mass tag-labeled quantitative proteomic analysis

doi: 10.21037/atm-21-4257

Figure Lengend Snippet: Specific information on 16 protein targets in the treatment of IGT with TYP

Article Snippet: For example, the expression levels of Rbp4 (boster, #PB0368, China) and Flot2 (boster, #PB0663, China) in the 3 groups were calculated with GAPDH (boster, #BM1623, China) as an internal reference.

Techniques:

Journal: Annals of Translational Medicine

Article Title: Identifying potential therapeutic targets of Tang-Yi-Ping for the treatment of impaired glucose tolerance: a tandem mass tag-labeled quantitative proteomic analysis

doi: 10.21037/atm-21-4257

Figure Lengend Snippet: Relative expression levels of Rbp4 and Flot2 proteins in pancreatic samples of the 3 groups. Rbp4: *, P<0.05, vs. Control; #, P<0.05, vs. IGT. Flot: *, P<0.05, vs. Control; #, P<0.05, vs. IGT. IGT, impaired glucose tolerance.

Article Snippet: For example, the expression levels of Rbp4 (boster, #PB0368, China) and Flot2 (boster, #PB0663, China) in the 3 groups were calculated with GAPDH (boster, #BM1623, China) as an internal reference.

Techniques: Expressing, Control

Journal: Histochemistry and cell biology

Article Title: Expression of flotillins in the human placenta: potential implications for placental transcytosis

doi: 10.1007/s00418-012-1040-2

Figure Lengend Snippet: FLOT1 and FLOT2 are expressed in human placental homogenates. (A) Equal amounts of protein from fractions generated during the preparation of small cationic colloidal silica-coated ST microvillous fractions (Robinson et al., 2009b) were resolved by gel electrophoresis, transferred to nitrocellulose membranes, and probed with antibodies directed against either FLOT1 or FLOT2. These fractions were: crude tissue homogenate (CTH), filtered crude tissue homogenate (FCTH), crude placental supernatant (CPS), crude placental pellet (CPP), Histodenz fractions (0–50%, 50–55%), and the pelleted plasma membrane (65% PPM). Note that neither FLOT1 nor FLOT2 was enriched in the PPM fraction. (B) Immunoblotting was used to confirm the expression of both flotillins in three additional term human placenta extracts prepared following lysis in buffer containing n-octyl β-D-glucopyranoside (see “Materials and methods”).

Article Snippet: The following antibodies were used for immunoblotting and immunolabeling experiments, as indicated in the text and figure legends: mouse anti-FLOT1 (610820, BD Biosciences), mouse anti-FLOT2 (610383, BD Biosciences), rabbit anti-FLOT1 (HPA001393, Sigma-Aldrich), rabbit anti-FLOT2 (F1680, Sigma-Aldrich), rabbit anti-FLOT2 (F1805, Sigma-Aldrich), mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Chemicon International), mouse anti-dysferlin (DYSF; Ham1/7B6, Vector Laboratories), mouse monoclonal anti-E-cadherin (E-cad, 610181, BD Biosciences), and mouse anti-serine peptidase inhibitor, Kunitz type 1 (SPINT1, clone C76/18) ( Kataoka et al., 2000b ; Kataoka et al., 2000a ; Shimomura et al., 1999 ).

Techniques: Generated, Nucleic Acid Electrophoresis, Western Blot, Expressing, Lysis

Journal: Histochemistry and cell biology

Article Title: Expression of flotillins in the human placenta: potential implications for placental transcytosis

doi: 10.1007/s00418-012-1040-2

Figure Lengend Snippet: Distribution of FLOT1 and FLOT2 proteins in term human placental villi. (A–D) Representative photomicrographs of conventional cryostat sections (5–6 μm) of placental villi labeled with anti-FLOT1 (HPA001393; red in A) and anti-FLOT2 (1608; red C) antibodies and imaged using laser scanning confocal microscopy. The intensities of these images were adjusted to provide maximal contrast. Panels B and D are corresponding non-confocal differential interference contrast (DIC) micrographs on which DAPI staining (blue) is superimposed. Prominent flotillin labeling (red) is observed in cytotrophoblasts (CTs) and/or basal regions of syncytiotrophoblast (ST), and in fetal capillary endothelial cells (*, lumen of fetal capillary). Arrowheads indicate surface of ST; double arrows indicate flotillin labeling in ST; white single arrows indicate labeling along the basal surface of the ST and/or in CTs; black arrows indicate labeling in endothelial cells. (E, F) Fluorescence intensity measurements for FLOT1 (E) and FLOT2 (F) labeling taken within fetal capillary endothelial cells (EC) of intermediate and terminal villi, and at three levels of the villous tree: terminal villi (TV), intermediate villi (IV), and stem villi (SV). In our analysis, we found that the intensity measurements for FLOT1 EC labeling in intermediate and terminal villi were equivalent, so the data were pooled. This was also the case for FLOT2 EC labeling. Note that the differences in the absolute intensity measurements between FLOT1 and FLOT2 may represent differences in antigen-antibody interactions, and should not be interpreted as differences in relative abundance between these two proteins. Data are mean ± SD from 3 separate term placental specimens; *, P < 0.05 vs. SV; **, P < 0.01 vs. SV (ANOVA with Bonferroni multiple comparisons). Scale bar = 20 μm

Article Snippet: The following antibodies were used for immunoblotting and immunolabeling experiments, as indicated in the text and figure legends: mouse anti-FLOT1 (610820, BD Biosciences), mouse anti-FLOT2 (610383, BD Biosciences), rabbit anti-FLOT1 (HPA001393, Sigma-Aldrich), rabbit anti-FLOT2 (F1680, Sigma-Aldrich), rabbit anti-FLOT2 (F1805, Sigma-Aldrich), mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Chemicon International), mouse anti-dysferlin (DYSF; Ham1/7B6, Vector Laboratories), mouse monoclonal anti-E-cadherin (E-cad, 610181, BD Biosciences), and mouse anti-serine peptidase inhibitor, Kunitz type 1 (SPINT1, clone C76/18) ( Kataoka et al., 2000b ; Kataoka et al., 2000a ; Shimomura et al., 1999 ).

Techniques: Labeling, Confocal Microscopy, Staining, Fluorescence

Journal: Histochemistry and cell biology

Article Title: Expression of flotillins in the human placenta: potential implications for placental transcytosis

doi: 10.1007/s00418-012-1040-2

Figure Lengend Snippet: Flotillin expression is downregulated and changes distribution in BeWo cells following foskolin-induced fusion. (A) Representative immunoblots of BeWo cells treated with 20 μM forskolin from 0–72 h. Note that the immunoreactivity of FLOT1 and FLOT2 decreases with forskolin treatment, whereas that of dysferlin (DYSF) increases. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. Similar results were obtained in three separate experiments. (B, C) Mononuclear BeWo cells immunolabeled with antibodies against FLOT1 (HPA001393; red in B) and FLOT2 (1608; red in C), respectively. Double arrows indicate areas of flotillin labeling along cellular boundaries; wide arrows denote areas of periuclear staining in individual cells. (D, E) BeWo cells treated with forskolin (20 μM for 72 h) and co-immunolabeled using antibodies generated against E-cadherin (E-cad, green) and either FLOT1 (red in D) or FLOT2 (red in E), as above. Wide arrows indicate flotillin-like immunoreactivity in crescent-shaped structures in close proximity to clusters of nuclei; arrowhead in E denotes an area of Ecad labeling that has become irregular following cell-cell fusion. (F) Cryosection (5–6 μm) of term placental villus co-immunolabeled using antibodies generated against dysferlin (DYSF, green) and FLOT2 (1608; red) and imaged using confocal microscopy. Single arrows indicate DYSF labeling at the apical regions of the ST; double arrows indicate FLOT2 labeling. (G) BeWo cells treated with forskolin (20 μM for 72 h) and co-immunolabeled using anti-DYSF (green) and anti-FLOT2 (red) antibodies. Arrowheads denote co-labeling in crescent-shaped structures around clusters of nuclei; the asterisk indicates DYSF immunoreactivity in fused cells. Note that non-fused cells lack DYSF labeling. All scale bars = 20 μm

Article Snippet: The following antibodies were used for immunoblotting and immunolabeling experiments, as indicated in the text and figure legends: mouse anti-FLOT1 (610820, BD Biosciences), mouse anti-FLOT2 (610383, BD Biosciences), rabbit anti-FLOT1 (HPA001393, Sigma-Aldrich), rabbit anti-FLOT2 (F1680, Sigma-Aldrich), rabbit anti-FLOT2 (F1805, Sigma-Aldrich), mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Chemicon International), mouse anti-dysferlin (DYSF; Ham1/7B6, Vector Laboratories), mouse monoclonal anti-E-cadherin (E-cad, 610181, BD Biosciences), and mouse anti-serine peptidase inhibitor, Kunitz type 1 (SPINT1, clone C76/18) ( Kataoka et al., 2000b ; Kataoka et al., 2000a ; Shimomura et al., 1999 ).

Techniques: Expressing, Western Blot, Immunolabeling, Labeling, Staining, Generated, Confocal Microscopy

Journal: Histochemistry and cell biology

Article Title: Expression of flotillins in the human placenta: potential implications for placental transcytosis

doi: 10.1007/s00418-012-1040-2

Figure Lengend Snippet: Flotillins contribute to endocytosis in BeWo cells. (A) Flotillins co-localize with a fluorescent marker of fluid phase-pinocytosis in endocytosis assays. Mononuclear BeWo cells were incubated continuously in the presence of 1 mg/ml of lucifer yellow (LY-CH, green) for 15 min prior to fixation. Following permeabilization, the cells were immunolabeled with anti-FLOT2 antibodies (red) and imaged using confocal microscopy. In the representative micrograph taken from a single optical section, areas of co-localization between the LY-CH cargo and FLOT2 (yellow in the merged images, indicated by arrows) are observed. Similar results were obtained when the cells were labeled using antibodies generated against FLOT1 (not shown). Scale bar = 10 μm. (B) Immunoblots of BeWo cell lines stably transuced with shRNA targeting FLOT1, FLOT2, or both. Control cells were tranduced with Non-Target Control Transduction Particles (LV CTRL) as described in “Materials and methods”. (C) Flotillin knockdown decreases uptake of fluorescently-labeled cholera toxin B subunit (CTB-594). BeWo cells varying in flotillin expression levels were incubated with 20 μg/ml CTB-594 at 4°C for 30 min, then warmed to 37°C and endocytosis was allowed to proceed in media without labeled ligand for 15 min. On average, cells deficient in flotillin expression exhibited decreased CTB-549 based on average fluorescence intensity measurements. Data are mean ± SD from two separate experiments. Different letters indicate significant differences at P < 0.05 (ANOVA with Bonferroni multiple comparisons)

Article Snippet: The following antibodies were used for immunoblotting and immunolabeling experiments, as indicated in the text and figure legends: mouse anti-FLOT1 (610820, BD Biosciences), mouse anti-FLOT2 (610383, BD Biosciences), rabbit anti-FLOT1 (HPA001393, Sigma-Aldrich), rabbit anti-FLOT2 (F1680, Sigma-Aldrich), rabbit anti-FLOT2 (F1805, Sigma-Aldrich), mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Chemicon International), mouse anti-dysferlin (DYSF; Ham1/7B6, Vector Laboratories), mouse monoclonal anti-E-cadherin (E-cad, 610181, BD Biosciences), and mouse anti-serine peptidase inhibitor, Kunitz type 1 (SPINT1, clone C76/18) ( Kataoka et al., 2000b ; Kataoka et al., 2000a ; Shimomura et al., 1999 ).

Techniques: Marker, Incubation, Immunolabeling, Confocal Microscopy, Labeling, Generated, Western Blot, Stable Transfection, shRNA, Transduction, Expressing, Fluorescence

Journal: PLoS ONE

Article Title: Differences in the Expression and Distribution of Flotillin-2 in Chick, Mice and Human Muscle Cells

doi: 10.1371/journal.pone.0103990

Figure Lengend Snippet: Chick myogenic cells were grown 24(control, Ct ). Cell culture extracts were analyzed in Western blot using an antibody against flotillin-2 ( A ). Lower Western blot shows α-tubulin reactivity of the same samples, and was used to normalize sample loading ( A ). Quantification of protein bands revealed a 40% increase in the levels of flotillin-2 expression after cholesterol depletion ( B ). RT-PCR analysis (for details, see ) of the expression of flotillin-2 in control and in MbCD-treated cells is shown in C . Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used for normalization. Analysis of the expression of flotillin-2 shows a more than 2-fold increase in the levels of mRNA expression in MbCD-treated cells compared with control cells. *p<0.05; t test for unpaired samples, n = 3.

Article Snippet: Primer sequences are listed below: NM_001030719.1 Gallus gallus flotillin 2 (FLOT2), mRNA product length = 74 Forward primer 1 GGCCTACGAGCTTCAAAGTG 20 Reverse primer 1 GTTGCACCACCTCGATTTCT 20 NM_204305.1 Gallus gallus glyceraldehyde-3-phosphate dehydrogenase (GAPDH), mRNA product length = 112 Forward primer 1 GACGTGCAGCAGGAACACTA 20 Reverse primer 1 CTTGGACTTTGCCAGAGAGG 20

Techniques: Control, Cell Culture, Western Blot, Expressing, Reverse Transcription Polymerase Chain Reaction