flot2 Search Results


85
Thermo Fisher snp flot2 c 8716662 10
Snp Flot2 C 8716662 10, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/flot2/pmc04677510-62-7--1?v=Thermo+Fisher
Average 85 stars, based on 1 article reviews
snp flot2 c 8716662 10 - by Bioz Stars, 2026-07
85/100 stars
  Buy from Supplier

94
Genecopoeia flot2
Flot2, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/flot2/pm37091585-61-10-12?v=Genecopoeia
Average 94 stars, based on 1 article reviews
flot2 - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

94
OriGene flot2
A) HCC1954 cells were fixed, permeabilized, blocked, and probed with PLA probes against HER2 and <t>FLOT2</t> combined, or either probe alone (negative controls) and DAPI (blue). Green signal indicates interaction between HER2 and FLOT2. Scale bar is 10 µm. B) SKBR3 cells were transfected with siNeg or siFLOT2 for seven days prior to cell lysing and immunoprecipitation with anti-FLOT2, followed by immunoblotting for HER2 or FLOT2. Whole cell lysate was immunoblotted for HER2, FLOT2 or HSC70 (loading control). C) HeLa control or FLOT2 KO cells were lysed and immunoprecipitated with anti-HER2, followed by immunoblotting for HER2 and FLOT2. Whole cell lysate was immunoblotted for HER2, FLOT2 and HSC70 (loading control). D) HEK293T cells were transfected with empty vector, HER2, FLAG-tagged FLOT2 or HER2 and FLAG-tagged FLOT2 for three days, then lysed and immunoprecipitated with anti-FLAG and immunoblotted for HER2 and FLAG. Whole cell lysate was immunoblotted for HER2, FLOT2 and HSC70 (loading control). E) SKBR3 cells were transfected with siNeg or siFLOT2 for five days prior to cell counting or three days prior to lysing and immunoblot to probe for pHER2 (Y1196), HER2, pMAPK (T202/Y204), ERK2, pAKT (S473), AKT, pS6 (S235/236), S6, FLOT2, and HSC70 (loading control). Graphed data represent the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. F) Same as in E, with HCC202 cells transfected for seven days prior to cell counting or three days prior to lysing, and lysates were instead probed for pHER2 (Y1221/1222). G) Same as in E, with HCC1954 cells transfected for seven days prior to cell counting and three days prior to lysing.
Flot2, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/flot2/bio_rxiv__64898__2026__05__15__725439-67-14-19?v=OriGene
Average 94 stars, based on 1 article reviews
flot2 - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

93
Proteintech anti flotillin 1
A) HCC1954 cells were fixed, permeabilized, blocked, and probed with PLA probes against HER2 and <t>FLOT2</t> combined, or either probe alone (negative controls) and DAPI (blue). Green signal indicates interaction between HER2 and FLOT2. Scale bar is 10 µm. B) SKBR3 cells were transfected with siNeg or siFLOT2 for seven days prior to cell lysing and immunoprecipitation with anti-FLOT2, followed by immunoblotting for HER2 or FLOT2. Whole cell lysate was immunoblotted for HER2, FLOT2 or HSC70 (loading control). C) HeLa control or FLOT2 KO cells were lysed and immunoprecipitated with anti-HER2, followed by immunoblotting for HER2 and FLOT2. Whole cell lysate was immunoblotted for HER2, FLOT2 and HSC70 (loading control). D) HEK293T cells were transfected with empty vector, HER2, FLAG-tagged FLOT2 or HER2 and FLAG-tagged FLOT2 for three days, then lysed and immunoprecipitated with anti-FLAG and immunoblotted for HER2 and FLAG. Whole cell lysate was immunoblotted for HER2, FLOT2 and HSC70 (loading control). E) SKBR3 cells were transfected with siNeg or siFLOT2 for five days prior to cell counting or three days prior to lysing and immunoblot to probe for pHER2 (Y1196), HER2, pMAPK (T202/Y204), ERK2, pAKT (S473), AKT, pS6 (S235/236), S6, FLOT2, and HSC70 (loading control). Graphed data represent the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. F) Same as in E, with HCC202 cells transfected for seven days prior to cell counting or three days prior to lysing, and lysates were instead probed for pHER2 (Y1221/1222). G) Same as in E, with HCC1954 cells transfected for seven days prior to cell counting and three days prior to lysing.
Anti Flotillin 1, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/flot2/pmc12979022-182-49-50?v=Proteintech
Average 93 stars, based on 1 article reviews
anti flotillin 1 - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
ProSci Incorporated anti chk2
A) HCC1954 cells were fixed, permeabilized, blocked, and probed with PLA probes against HER2 and <t>FLOT2</t> combined, or either probe alone (negative controls) and DAPI (blue). Green signal indicates interaction between HER2 and FLOT2. Scale bar is 10 µm. B) SKBR3 cells were transfected with siNeg or siFLOT2 for seven days prior to cell lysing and immunoprecipitation with anti-FLOT2, followed by immunoblotting for HER2 or FLOT2. Whole cell lysate was immunoblotted for HER2, FLOT2 or HSC70 (loading control). C) HeLa control or FLOT2 KO cells were lysed and immunoprecipitated with anti-HER2, followed by immunoblotting for HER2 and FLOT2. Whole cell lysate was immunoblotted for HER2, FLOT2 and HSC70 (loading control). D) HEK293T cells were transfected with empty vector, HER2, FLAG-tagged FLOT2 or HER2 and FLAG-tagged FLOT2 for three days, then lysed and immunoprecipitated with anti-FLAG and immunoblotted for HER2 and FLAG. Whole cell lysate was immunoblotted for HER2, FLOT2 and HSC70 (loading control). E) SKBR3 cells were transfected with siNeg or siFLOT2 for five days prior to cell counting or three days prior to lysing and immunoblot to probe for pHER2 (Y1196), HER2, pMAPK (T202/Y204), ERK2, pAKT (S473), AKT, pS6 (S235/236), S6, FLOT2, and HSC70 (loading control). Graphed data represent the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. F) Same as in E, with HCC202 cells transfected for seven days prior to cell counting or three days prior to lysing, and lysates were instead probed for pHER2 (Y1221/1222). G) Same as in E, with HCC1954 cells transfected for seven days prior to cell counting and three days prior to lysing.
Anti Chk2, supplied by ProSci Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/flot2/10__1128_slash_jvi__80__5__2445___2452__2006-47-49-51?v=ProSci+Incorporated
Average 90 stars, based on 1 article reviews
anti chk2 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

93
Thermo Fisher gene exp flot2 mm01241315 g1
A) HCC1954 cells were fixed, permeabilized, blocked, and probed with PLA probes against HER2 and <t>FLOT2</t> combined, or either probe alone (negative controls) and DAPI (blue). Green signal indicates interaction between HER2 and FLOT2. Scale bar is 10 µm. B) SKBR3 cells were transfected with siNeg or siFLOT2 for seven days prior to cell lysing and immunoprecipitation with anti-FLOT2, followed by immunoblotting for HER2 or FLOT2. Whole cell lysate was immunoblotted for HER2, FLOT2 or HSC70 (loading control). C) HeLa control or FLOT2 KO cells were lysed and immunoprecipitated with anti-HER2, followed by immunoblotting for HER2 and FLOT2. Whole cell lysate was immunoblotted for HER2, FLOT2 and HSC70 (loading control). D) HEK293T cells were transfected with empty vector, HER2, FLAG-tagged FLOT2 or HER2 and FLAG-tagged FLOT2 for three days, then lysed and immunoprecipitated with anti-FLAG and immunoblotted for HER2 and FLAG. Whole cell lysate was immunoblotted for HER2, FLOT2 and HSC70 (loading control). E) SKBR3 cells were transfected with siNeg or siFLOT2 for five days prior to cell counting or three days prior to lysing and immunoblot to probe for pHER2 (Y1196), HER2, pMAPK (T202/Y204), ERK2, pAKT (S473), AKT, pS6 (S235/236), S6, FLOT2, and HSC70 (loading control). Graphed data represent the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. F) Same as in E, with HCC202 cells transfected for seven days prior to cell counting or three days prior to lysing, and lysates were instead probed for pHER2 (Y1221/1222). G) Same as in E, with HCC1954 cells transfected for seven days prior to cell counting and three days prior to lysing.
Gene Exp Flot2 Mm01241315 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/flot2/pm39499901-207-38--1?v=Thermo+Fisher
Average 93 stars, based on 1 article reviews
gene exp flot2 mm01241315 g1 - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
Boster Bio flot2
Specific information on 16 protein targets in the treatment of IGT with TYP
Flot2, supplied by Boster Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/flot2/pmc08576661-131-11-12?v=Boster+Bio
Average 90 stars, based on 1 article reviews
flot2 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

88
Atlas Antibodies rabbit anti flotillin 2
Specific information on 16 protein targets in the treatment of IGT with TYP
Rabbit Anti Flotillin 2, supplied by Atlas Antibodies, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/flot2/pmc05868265-308-101-105?v=Atlas+Antibodies
Average 88 stars, based on 1 article reviews
rabbit anti flotillin 2 - by Bioz Stars, 2026-07
88/100 stars
  Buy from Supplier

92
Sino Biological flot2 n myc
Specific information on 16 protein targets in the treatment of IGT with TYP
Flot2 N Myc, supplied by Sino Biological, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/flot2/bio_rxiv__2023__09__28__560017-199-13-14?v=Sino+Biological
Average 92 stars, based on 1 article reviews
flot2 n myc - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

90
Becton Dickinson mouse anti-flot2
FLOT1 and <t>FLOT2</t> are expressed in human placental homogenates. (A) Equal amounts of protein from fractions generated during the preparation of small cationic colloidal silica-coated ST microvillous fractions (Robinson et al., 2009b) were resolved by gel electrophoresis, transferred to nitrocellulose membranes, and probed with antibodies directed against either FLOT1 or FLOT2. These fractions were: crude tissue homogenate (CTH), filtered crude tissue homogenate (FCTH), crude placental supernatant (CPS), crude placental pellet (CPP), Histodenz fractions (0–50%, 50–55%), and the pelleted plasma membrane (65% PPM). Note that neither FLOT1 nor FLOT2 was enriched in the PPM fraction. (B) Immunoblotting was used to confirm the expression of both flotillins in three additional term human placenta extracts prepared following lysis in buffer containing n-octyl β-D-glucopyranoside (see “Materials and methods”).
Mouse Anti Flot2, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/flot2/pmc03574205-128-23-26?v=Becton+Dickinson
Average 90 stars, based on 1 article reviews
mouse anti-flot2 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Gallus BioPharmaceuticals flotillin 2 (flot2) mrna
Chick myogenic cells were grown 24(control, Ct ). Cell culture extracts were analyzed in Western blot using an antibody <t>against</t> <t>flotillin-2</t> ( A ). Lower Western blot shows α-tubulin reactivity of the same samples, and was used to normalize sample loading ( A ). Quantification of protein bands revealed a 40% increase in the levels of flotillin-2 expression after cholesterol depletion ( B ). RT-PCR analysis (for details, see ) of the expression of flotillin-2 in control and in MbCD-treated cells is shown in C . Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used for normalization. Analysis of the expression of flotillin-2 shows a more than 2-fold increase in the levels of <t>mRNA</t> expression in MbCD-treated cells compared with control cells. *p<0.05; t test for unpaired samples, n = 3.
Flotillin 2 (Flot2) Mrna, supplied by Gallus BioPharmaceuticals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/flot2/pmc04126691-103-11-27?v=Gallus+BioPharmaceuticals
Average 90 stars, based on 1 article reviews
flotillin 2 (flot2) mrna - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
EUROIMMUN biochips cells co-expressing flot1 flot2 proteins
HEK293 cells co-transfected with mammalian-expression vectors encoding human FLOT1 and <t>FLOT2,</t> using Lipofectamine 2000; double-stained with serum (B, E), and with commercial antibody against FLOT1 (A,D). MS patient’s IgG bind to co-transfected cells (B), and colocalize with FLOT1 ab (C); in contrast with the healthy control (E), that doesn’t show any reactivity against FLOT-1/2 antibodies.
Biochips Cells Co Expressing Flot1 Flot2 Proteins, supplied by EUROIMMUN, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/flot2/med_rxiv__2022__09__14__22278529-28-19-21?v=EUROIMMUN
Average 90 stars, based on 1 article reviews
biochips cells co-expressing flot1 flot2 proteins - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results


A) HCC1954 cells were fixed, permeabilized, blocked, and probed with PLA probes against HER2 and FLOT2 combined, or either probe alone (negative controls) and DAPI (blue). Green signal indicates interaction between HER2 and FLOT2. Scale bar is 10 µm. B) SKBR3 cells were transfected with siNeg or siFLOT2 for seven days prior to cell lysing and immunoprecipitation with anti-FLOT2, followed by immunoblotting for HER2 or FLOT2. Whole cell lysate was immunoblotted for HER2, FLOT2 or HSC70 (loading control). C) HeLa control or FLOT2 KO cells were lysed and immunoprecipitated with anti-HER2, followed by immunoblotting for HER2 and FLOT2. Whole cell lysate was immunoblotted for HER2, FLOT2 and HSC70 (loading control). D) HEK293T cells were transfected with empty vector, HER2, FLAG-tagged FLOT2 or HER2 and FLAG-tagged FLOT2 for three days, then lysed and immunoprecipitated with anti-FLAG and immunoblotted for HER2 and FLAG. Whole cell lysate was immunoblotted for HER2, FLOT2 and HSC70 (loading control). E) SKBR3 cells were transfected with siNeg or siFLOT2 for five days prior to cell counting or three days prior to lysing and immunoblot to probe for pHER2 (Y1196), HER2, pMAPK (T202/Y204), ERK2, pAKT (S473), AKT, pS6 (S235/236), S6, FLOT2, and HSC70 (loading control). Graphed data represent the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. F) Same as in E, with HCC202 cells transfected for seven days prior to cell counting or three days prior to lysing, and lysates were instead probed for pHER2 (Y1221/1222). G) Same as in E, with HCC1954 cells transfected for seven days prior to cell counting and three days prior to lysing.

Journal: bioRxiv

Article Title: Loss of Flotillin-2 enhances trastuzumab emtansine internalization and cytotoxicity by relieving negative regulation of HER2 internalization in HER2-amplified cancers

doi: 10.64898/2026.05.15.725439

Figure Lengend Snippet: A) HCC1954 cells were fixed, permeabilized, blocked, and probed with PLA probes against HER2 and FLOT2 combined, or either probe alone (negative controls) and DAPI (blue). Green signal indicates interaction between HER2 and FLOT2. Scale bar is 10 µm. B) SKBR3 cells were transfected with siNeg or siFLOT2 for seven days prior to cell lysing and immunoprecipitation with anti-FLOT2, followed by immunoblotting for HER2 or FLOT2. Whole cell lysate was immunoblotted for HER2, FLOT2 or HSC70 (loading control). C) HeLa control or FLOT2 KO cells were lysed and immunoprecipitated with anti-HER2, followed by immunoblotting for HER2 and FLOT2. Whole cell lysate was immunoblotted for HER2, FLOT2 and HSC70 (loading control). D) HEK293T cells were transfected with empty vector, HER2, FLAG-tagged FLOT2 or HER2 and FLAG-tagged FLOT2 for three days, then lysed and immunoprecipitated with anti-FLAG and immunoblotted for HER2 and FLAG. Whole cell lysate was immunoblotted for HER2, FLOT2 and HSC70 (loading control). E) SKBR3 cells were transfected with siNeg or siFLOT2 for five days prior to cell counting or three days prior to lysing and immunoblot to probe for pHER2 (Y1196), HER2, pMAPK (T202/Y204), ERK2, pAKT (S473), AKT, pS6 (S235/236), S6, FLOT2, and HSC70 (loading control). Graphed data represent the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. F) Same as in E, with HCC202 cells transfected for seven days prior to cell counting or three days prior to lysing, and lysates were instead probed for pHER2 (Y1221/1222). G) Same as in E, with HCC1954 cells transfected for seven days prior to cell counting and three days prior to lysing.

Article Snippet: HA-tag Ubiquitin plasmid was kindly provided by Dirk Bohmann. pCMV6 (PS10001) vector control and FLOT2 (RC220884) were purchased from OriGene.

Techniques: Transfection, Immunoprecipitation, Western Blot, Control, Plasmid Preparation, Cell Counting

A) SKBR3 shFLOT2 cells were treated +/- 500 ng/mL doxycycline for 72 hours, replated, then treated with pHrodo-T-DM1 (1 µg/mL; red) in serum-free RPMI for 7 hours. Cells were stained with CellTracker Blue CMAC dye (1 µM; Blue) in serum-free RPMI for 30 minutes prior to confocal imaging. GFP (green) expression is induced by doxycycline, indicating induction of the shFLOT2 promoter. Intensity of pHrodo signal per cell was quantified and divided by the area of each cell (right). Data represents the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. Scale bar is 40 µm. B) Same as in A, with SKBR3 shControl cells. GFP (green) expression is induced by doxycycline, indicating induction of the shControl promoter. Scale bar is 20 µm. C) SKBR3 cells were transfected with siNeg or siFLOT2 for 48 hours and then treated with DMSO or 1 ng/mL T-DM1 for 24 hours in 1% FBS RPMI. Cells were lysed and immunoblotted for HER2, pAKT (S473), AKT, pS6 (S235/236), S6, FLOT2 and HSC70 (loading control). Band density was normalized to loading control, and then normalized to siNeg DMSO for each individual protein. Data represents the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. D) Same as in C, with HCC202 cells using 10 µg/mL T-DM1.

Journal: bioRxiv

Article Title: Loss of Flotillin-2 enhances trastuzumab emtansine internalization and cytotoxicity by relieving negative regulation of HER2 internalization in HER2-amplified cancers

doi: 10.64898/2026.05.15.725439

Figure Lengend Snippet: A) SKBR3 shFLOT2 cells were treated +/- 500 ng/mL doxycycline for 72 hours, replated, then treated with pHrodo-T-DM1 (1 µg/mL; red) in serum-free RPMI for 7 hours. Cells were stained with CellTracker Blue CMAC dye (1 µM; Blue) in serum-free RPMI for 30 minutes prior to confocal imaging. GFP (green) expression is induced by doxycycline, indicating induction of the shFLOT2 promoter. Intensity of pHrodo signal per cell was quantified and divided by the area of each cell (right). Data represents the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. Scale bar is 40 µm. B) Same as in A, with SKBR3 shControl cells. GFP (green) expression is induced by doxycycline, indicating induction of the shControl promoter. Scale bar is 20 µm. C) SKBR3 cells were transfected with siNeg or siFLOT2 for 48 hours and then treated with DMSO or 1 ng/mL T-DM1 for 24 hours in 1% FBS RPMI. Cells were lysed and immunoblotted for HER2, pAKT (S473), AKT, pS6 (S235/236), S6, FLOT2 and HSC70 (loading control). Band density was normalized to loading control, and then normalized to siNeg DMSO for each individual protein. Data represents the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. D) Same as in C, with HCC202 cells using 10 µg/mL T-DM1.

Article Snippet: HA-tag Ubiquitin plasmid was kindly provided by Dirk Bohmann. pCMV6 (PS10001) vector control and FLOT2 (RC220884) were purchased from OriGene.

Techniques: Staining, Imaging, Expressing, Transfection, Control

A) SKBR3 shFLOT2 or shControl were pretreated with DMSO control (black) or 500 ng/mL doxycycline (gray) for 48 hours in 1% FBS RPMI, then treated with indicated T-DM1 concentration with continued doxycycline in 1% FBS RPMI for three days prior to cell counting. The table below the graphs indicates the calculated IC50 comparing DMSO + T-DM1 to doxycycline + T-DM1. Data represents the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. B) Same as in A, with HCC202 shFLOT2 or shControl. C) Same as in A, with HCC1954 shFLOT2 or shControl. D) ARK1 (top) or ARK2 (bottom) cells were transfected with siNeg (black) or siFLOT2 (gray) for 48 hours prior to being treated with indicated T-DM1 concentration in 10% FBS RPMI for three days prior to cell viability reading (CellTiter-Glo 2.0). Data represents the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. E) SKBR3, HCC202, HCC1954, BT474, HCC1419, HCC2218, UACC893, ARK1, and ARK2 cells were treated with 0-1000 ng/mL T-DM1 in 1% FBS RPMI for three days prior to cell counting. Average FLOT2 expression by immunoblot (relative to HSC70 loading control) and the calculated IC50 for each cell line was plotted. Protein expression and IC50 were calculated from at least three independent experiments. Line represents linear regression. F) Same as E, with average HER2 expression (relative to HSC70 loading control). G) Overall survival of patients in Caris dataset from T-DXd to last contact with high FLOT2 (orange; 16.22 months) vs low FLOT2 (blue; 18.26 months), p=0.041. H) Overall survival of patients in Caris dataset from T-DM1 to last contact with high FLOT2 (orange; 37.967 months) vs low FLOT2 (blue; 41.29 months), p=0.131.

Journal: bioRxiv

Article Title: Loss of Flotillin-2 enhances trastuzumab emtansine internalization and cytotoxicity by relieving negative regulation of HER2 internalization in HER2-amplified cancers

doi: 10.64898/2026.05.15.725439

Figure Lengend Snippet: A) SKBR3 shFLOT2 or shControl were pretreated with DMSO control (black) or 500 ng/mL doxycycline (gray) for 48 hours in 1% FBS RPMI, then treated with indicated T-DM1 concentration with continued doxycycline in 1% FBS RPMI for three days prior to cell counting. The table below the graphs indicates the calculated IC50 comparing DMSO + T-DM1 to doxycycline + T-DM1. Data represents the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. B) Same as in A, with HCC202 shFLOT2 or shControl. C) Same as in A, with HCC1954 shFLOT2 or shControl. D) ARK1 (top) or ARK2 (bottom) cells were transfected with siNeg (black) or siFLOT2 (gray) for 48 hours prior to being treated with indicated T-DM1 concentration in 10% FBS RPMI for three days prior to cell viability reading (CellTiter-Glo 2.0). Data represents the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. E) SKBR3, HCC202, HCC1954, BT474, HCC1419, HCC2218, UACC893, ARK1, and ARK2 cells were treated with 0-1000 ng/mL T-DM1 in 1% FBS RPMI for three days prior to cell counting. Average FLOT2 expression by immunoblot (relative to HSC70 loading control) and the calculated IC50 for each cell line was plotted. Protein expression and IC50 were calculated from at least three independent experiments. Line represents linear regression. F) Same as E, with average HER2 expression (relative to HSC70 loading control). G) Overall survival of patients in Caris dataset from T-DXd to last contact with high FLOT2 (orange; 16.22 months) vs low FLOT2 (blue; 18.26 months), p=0.041. H) Overall survival of patients in Caris dataset from T-DM1 to last contact with high FLOT2 (orange; 37.967 months) vs low FLOT2 (blue; 41.29 months), p=0.131.

Article Snippet: HA-tag Ubiquitin plasmid was kindly provided by Dirk Bohmann. pCMV6 (PS10001) vector control and FLOT2 (RC220884) were purchased from OriGene.

Techniques: Control, Concentration Assay, Cell Counting, Transfection, Expressing, Western Blot

A) SKBR3 shFLOT2 cells were treated +/- 500 ng/mL doxycycline for a total of four days, and transfected with HA-tagged Ubiquitin for a total of three days. Cells were then treated with 10 ng/mL T-DM1 in 1% FBS RPMI for 2 hours, lysed, immunoprecipitated with anti-HA antibody, and immunoblotted for HER2 and HA. Whole cell lysate was immunoblotted for HER2, HA, FLOT2 and HSC70 (loading control). B) SKBR3 (left) or HCC1954 (right) were treated with TAK-243 (1 nM for SKBR3, 100 nM for HCC1954) and T-DM1 (10 ng/mL for SKBR3, 100 ng/mL for HCC1954) in 1% FBS RPMI for three days. Dead cell percentage was calculated using PI stain with the BioTek Cytation. Data represents the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. C) SKBR3 cells were treated with DMSO (control), 1 nM or 10 nM TAK-243 for 24 hours in 1% FBS RPMI, and then treated with pHrodo-T-DM1 (1 µg/mL; red) for 7 hours in serum-free RPMI. Cells were stained with CellTracker Blue CMAC dye (1 µM; Blue) for 30 minutes in serum-free RPMI prior to confocal imaging. Intensity of pHrodo signal per cell was quantified and divided by the area of each cell (right). Data represents the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. Scale bar is 40 µm. D) SKBR3 shFLOT2 were pretreated +/- 500 ng/mL doxycycline in complete RPMI for 48 hours, and then continued doxycycline +/- TAK-243 (1 nM) for 24 hours in 1% FBS RPMI. Cells were then treated with pHrodo-T-DM1 in serum-free RPMI (1 µg/mL; red) for 7 hours. Cells were stained with CellTracker Blue CMAC dye (1 µM; Blue) in serum-free RPMI for 30 minutes prior to confocal imaging. GFP (green) expression is induced by doxycycline, indicating induction of the shFLOT2 promoter. Intensity of pHrodo signal per cell was quantified and divided by the area of each cell (right). Data represents the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. Scale bar is 20 µm.

Journal: bioRxiv

Article Title: Loss of Flotillin-2 enhances trastuzumab emtansine internalization and cytotoxicity by relieving negative regulation of HER2 internalization in HER2-amplified cancers

doi: 10.64898/2026.05.15.725439

Figure Lengend Snippet: A) SKBR3 shFLOT2 cells were treated +/- 500 ng/mL doxycycline for a total of four days, and transfected with HA-tagged Ubiquitin for a total of three days. Cells were then treated with 10 ng/mL T-DM1 in 1% FBS RPMI for 2 hours, lysed, immunoprecipitated with anti-HA antibody, and immunoblotted for HER2 and HA. Whole cell lysate was immunoblotted for HER2, HA, FLOT2 and HSC70 (loading control). B) SKBR3 (left) or HCC1954 (right) were treated with TAK-243 (1 nM for SKBR3, 100 nM for HCC1954) and T-DM1 (10 ng/mL for SKBR3, 100 ng/mL for HCC1954) in 1% FBS RPMI for three days. Dead cell percentage was calculated using PI stain with the BioTek Cytation. Data represents the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. C) SKBR3 cells were treated with DMSO (control), 1 nM or 10 nM TAK-243 for 24 hours in 1% FBS RPMI, and then treated with pHrodo-T-DM1 (1 µg/mL; red) for 7 hours in serum-free RPMI. Cells were stained with CellTracker Blue CMAC dye (1 µM; Blue) for 30 minutes in serum-free RPMI prior to confocal imaging. Intensity of pHrodo signal per cell was quantified and divided by the area of each cell (right). Data represents the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. Scale bar is 40 µm. D) SKBR3 shFLOT2 were pretreated +/- 500 ng/mL doxycycline in complete RPMI for 48 hours, and then continued doxycycline +/- TAK-243 (1 nM) for 24 hours in 1% FBS RPMI. Cells were then treated with pHrodo-T-DM1 in serum-free RPMI (1 µg/mL; red) for 7 hours. Cells were stained with CellTracker Blue CMAC dye (1 µM; Blue) in serum-free RPMI for 30 minutes prior to confocal imaging. GFP (green) expression is induced by doxycycline, indicating induction of the shFLOT2 promoter. Intensity of pHrodo signal per cell was quantified and divided by the area of each cell (right). Data represents the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. Scale bar is 20 µm.

Article Snippet: HA-tag Ubiquitin plasmid was kindly provided by Dirk Bohmann. pCMV6 (PS10001) vector control and FLOT2 (RC220884) were purchased from OriGene.

Techniques: Transfection, Ubiquitin Proteomics, Immunoprecipitation, Control, Staining, Imaging, Expressing

A) SKBR3 shFLOT2 cells were transfected with siRNA for Cbl (siCbl) or neg control (siNeg)and +/- 500 ng/mL doxycycline for 4 days total and transfected with HA-tagged ubiquitin for 3 days total. Cells were then treated with 10 ng/mL for 2 hours in 1% FBS RPMI, lysed, immunoprecipitated with anti-HA antibody, and immunoblotted for HER2, HA, and ubiquitin. Whole cell lysate was immunoblotted for HA, Cbl, FLOT2 and HSC70 (loading control). Immunoprecipitation band intensity was quantified and HER2 and ubiquitin and graphed as HER2/ubiquitin (right). siNeg with T-DM1 and doxycycline was normalized to siNeg with DMSO, and siCbl with T-DM1 and doxycycline was normalized to siCbl with DMSO. Data represents the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. B) SKBR3 shFLOT2 cells were transfected with siNeg or siCbl +/- 500 ng/mL doxycycline for 48 hours and re-plated on chambered coverglass, then treated with pHrodo-T-DM1 (1 µg/mL; red) in serum-free RPMI for 7 hours. Cells were stained with CellTracker Blue CMAC dye (1 µM; Blue) in serum-free RPMI for 30 minutes prior to confocal imaging. GFP (green) expression is induced by doxycycline, indicating induction of the shFLOT2 promoter. Intensity of pHrodo signal per cell was quantified and divided by the area of each cell (right). Data represents the average ±SEM of at least three independent experiments, and statistical analysis was performed by one-way ANOVA. Scale bar is 20 µm. C) HCC202, HCC1954 and SKBR3 lysates were immunoblotted for Cbl, Cbl-b and HSC70 (loading control). D) The same SKBR3 shFLOT2 cells that were transfected with siNeg or siCbl and treated +/-doxycycline for 48 hours in B were then re-plated and treated +/- 500 ng/mL doxycycline +/- 100 ng/mL T-DM1 for an additional 72 hours and dead cell percentage was calculated using PI stain with the BioTek Cytation. Cells were lysed and immunoblotted (bottom) for Cbl, FLOT2 and HSC70 (loading control) to confirm knockdown. Data represents the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. Dead cell percentage was normalized to the baseline percentage recorded at time of TDM1 treatment. E) Same as in D, with HCC1954 shFLOT2 cells. SiCbl was co-transfected with si-Cbl-b and cells were treated with 1000 ng/mL T-DM1, and lysates were also immunoblotted for cbl-b.

Journal: bioRxiv

Article Title: Loss of Flotillin-2 enhances trastuzumab emtansine internalization and cytotoxicity by relieving negative regulation of HER2 internalization in HER2-amplified cancers

doi: 10.64898/2026.05.15.725439

Figure Lengend Snippet: A) SKBR3 shFLOT2 cells were transfected with siRNA for Cbl (siCbl) or neg control (siNeg)and +/- 500 ng/mL doxycycline for 4 days total and transfected with HA-tagged ubiquitin for 3 days total. Cells were then treated with 10 ng/mL for 2 hours in 1% FBS RPMI, lysed, immunoprecipitated with anti-HA antibody, and immunoblotted for HER2, HA, and ubiquitin. Whole cell lysate was immunoblotted for HA, Cbl, FLOT2 and HSC70 (loading control). Immunoprecipitation band intensity was quantified and HER2 and ubiquitin and graphed as HER2/ubiquitin (right). siNeg with T-DM1 and doxycycline was normalized to siNeg with DMSO, and siCbl with T-DM1 and doxycycline was normalized to siCbl with DMSO. Data represents the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. B) SKBR3 shFLOT2 cells were transfected with siNeg or siCbl +/- 500 ng/mL doxycycline for 48 hours and re-plated on chambered coverglass, then treated with pHrodo-T-DM1 (1 µg/mL; red) in serum-free RPMI for 7 hours. Cells were stained with CellTracker Blue CMAC dye (1 µM; Blue) in serum-free RPMI for 30 minutes prior to confocal imaging. GFP (green) expression is induced by doxycycline, indicating induction of the shFLOT2 promoter. Intensity of pHrodo signal per cell was quantified and divided by the area of each cell (right). Data represents the average ±SEM of at least three independent experiments, and statistical analysis was performed by one-way ANOVA. Scale bar is 20 µm. C) HCC202, HCC1954 and SKBR3 lysates were immunoblotted for Cbl, Cbl-b and HSC70 (loading control). D) The same SKBR3 shFLOT2 cells that were transfected with siNeg or siCbl and treated +/-doxycycline for 48 hours in B were then re-plated and treated +/- 500 ng/mL doxycycline +/- 100 ng/mL T-DM1 for an additional 72 hours and dead cell percentage was calculated using PI stain with the BioTek Cytation. Cells were lysed and immunoblotted (bottom) for Cbl, FLOT2 and HSC70 (loading control) to confirm knockdown. Data represents the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. Dead cell percentage was normalized to the baseline percentage recorded at time of TDM1 treatment. E) Same as in D, with HCC1954 shFLOT2 cells. SiCbl was co-transfected with si-Cbl-b and cells were treated with 1000 ng/mL T-DM1, and lysates were also immunoblotted for cbl-b.

Article Snippet: HA-tag Ubiquitin plasmid was kindly provided by Dirk Bohmann. pCMV6 (PS10001) vector control and FLOT2 (RC220884) were purchased from OriGene.

Techniques: Transfection, Control, Ubiquitin Proteomics, Immunoprecipitation, Staining, Imaging, Expressing, Knockdown

A) SKBR3 cells were lysed, lysates treated with DMSO or 250 µM zoledronic acid (ZA) for an hour, and then heated at the indicated temperatures for 3 minutes each. Lysates were then centrifuged, and supernatant was immunoblotted for FLOT2, PHB1, and PHB2 (left). Quantification of bands and calculation of melting temperatures are depicted on the right. Quantification of bands represent the average ±SEM of three independent experiments. B) SKBR3 cells were treated with 0, 1 or 10 µM zoledronic acid for 24 or 48 hours, lysed, immunoprecipitated by anti-HER2, and immunoblotted for HER2, FLOT2, PHB1 or PHB2. Whole cell lysate was immunoblotted for HER2, FLOT2, PHB1, PHB2 and HSC70 (loading control). Quantification of immunoprecipitation bands from three independent experiments for FLOT2 relative to HER2 are depicted on the right, with the average ±SEM. Statistical analysis was performed by Student’s t-test compared to 0 µM zoledronic acid. C) SKBR3 cells were treated with DMSO (control) or 1 µM Zoledronic acid (ZA) for 72 hours then treated with pHrodo-T-DM1 (1 µg/mL; red) in serum-free RPMI for 7 hours. Cells were stained with CellTracker Blue CMAC dye (1 µM; Blue) in serum-free RPMI for 30 minutes prior to confocal imaging. Intensity of pHrodo signal per cell was quantified and divided by the area of each cell (right). Data represents the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. Scale bar is 20 µm. D) SKBR3 cells were treated with the indicated combinations of DMSO (control), 1 ng/mL T-DM1 and 1 µM zoledronic acid (ZA) for 48 hours in 1% FBS RPMI. Dead cell percentage was calculated using PI stain with the BioTek Cytation. Data represents the average ±SEM of three independent experiments, and statistical analysis was performed by Student’s t-test. E) Same as D, with ARK1 cells in 10% FBS RPMI. F) Same as E, with ARK2 cells and 10 µM zoledronic acid (ZA). G) Same as D, with HCC1954 cells with 24 hour treatment.

Journal: bioRxiv

Article Title: Loss of Flotillin-2 enhances trastuzumab emtansine internalization and cytotoxicity by relieving negative regulation of HER2 internalization in HER2-amplified cancers

doi: 10.64898/2026.05.15.725439

Figure Lengend Snippet: A) SKBR3 cells were lysed, lysates treated with DMSO or 250 µM zoledronic acid (ZA) for an hour, and then heated at the indicated temperatures for 3 minutes each. Lysates were then centrifuged, and supernatant was immunoblotted for FLOT2, PHB1, and PHB2 (left). Quantification of bands and calculation of melting temperatures are depicted on the right. Quantification of bands represent the average ±SEM of three independent experiments. B) SKBR3 cells were treated with 0, 1 or 10 µM zoledronic acid for 24 or 48 hours, lysed, immunoprecipitated by anti-HER2, and immunoblotted for HER2, FLOT2, PHB1 or PHB2. Whole cell lysate was immunoblotted for HER2, FLOT2, PHB1, PHB2 and HSC70 (loading control). Quantification of immunoprecipitation bands from three independent experiments for FLOT2 relative to HER2 are depicted on the right, with the average ±SEM. Statistical analysis was performed by Student’s t-test compared to 0 µM zoledronic acid. C) SKBR3 cells were treated with DMSO (control) or 1 µM Zoledronic acid (ZA) for 72 hours then treated with pHrodo-T-DM1 (1 µg/mL; red) in serum-free RPMI for 7 hours. Cells were stained with CellTracker Blue CMAC dye (1 µM; Blue) in serum-free RPMI for 30 minutes prior to confocal imaging. Intensity of pHrodo signal per cell was quantified and divided by the area of each cell (right). Data represents the average ±SEM of at least three independent experiments, and statistical analysis was performed by Student’s t-test. Scale bar is 20 µm. D) SKBR3 cells were treated with the indicated combinations of DMSO (control), 1 ng/mL T-DM1 and 1 µM zoledronic acid (ZA) for 48 hours in 1% FBS RPMI. Dead cell percentage was calculated using PI stain with the BioTek Cytation. Data represents the average ±SEM of three independent experiments, and statistical analysis was performed by Student’s t-test. E) Same as D, with ARK1 cells in 10% FBS RPMI. F) Same as E, with ARK2 cells and 10 µM zoledronic acid (ZA). G) Same as D, with HCC1954 cells with 24 hour treatment.

Article Snippet: HA-tag Ubiquitin plasmid was kindly provided by Dirk Bohmann. pCMV6 (PS10001) vector control and FLOT2 (RC220884) were purchased from OriGene.

Techniques: Immunoprecipitation, Control, Staining, Imaging

Specific information on 16 protein targets in the treatment of IGT with TYP

Journal: Annals of Translational Medicine

Article Title: Identifying potential therapeutic targets of Tang-Yi-Ping for the treatment of impaired glucose tolerance: a tandem mass tag-labeled quantitative proteomic analysis

doi: 10.21037/atm-21-4257

Figure Lengend Snippet: Specific information on 16 protein targets in the treatment of IGT with TYP

Article Snippet: For example, the expression levels of Rbp4 (boster, #PB0368, China) and Flot2 (boster, #PB0663, China) in the 3 groups were calculated with GAPDH (boster, #BM1623, China) as an internal reference.

Techniques:

Relative expression levels of Rbp4 and Flot2 proteins in pancreatic samples of the 3 groups. Rbp4: *, P<0.05, vs. Control; #, P<0.05, vs. IGT. Flot: *, P<0.05, vs. Control; #, P<0.05, vs. IGT. IGT, impaired glucose tolerance.

Journal: Annals of Translational Medicine

Article Title: Identifying potential therapeutic targets of Tang-Yi-Ping for the treatment of impaired glucose tolerance: a tandem mass tag-labeled quantitative proteomic analysis

doi: 10.21037/atm-21-4257

Figure Lengend Snippet: Relative expression levels of Rbp4 and Flot2 proteins in pancreatic samples of the 3 groups. Rbp4: *, P<0.05, vs. Control; #, P<0.05, vs. IGT. Flot: *, P<0.05, vs. Control; #, P<0.05, vs. IGT. IGT, impaired glucose tolerance.

Article Snippet: For example, the expression levels of Rbp4 (boster, #PB0368, China) and Flot2 (boster, #PB0663, China) in the 3 groups were calculated with GAPDH (boster, #BM1623, China) as an internal reference.

Techniques: Expressing, Control

FLOT1 and FLOT2 are expressed in human placental homogenates. (A) Equal amounts of protein from fractions generated during the preparation of small cationic colloidal silica-coated ST microvillous fractions (Robinson et al., 2009b) were resolved by gel electrophoresis, transferred to nitrocellulose membranes, and probed with antibodies directed against either FLOT1 or FLOT2. These fractions were: crude tissue homogenate (CTH), filtered crude tissue homogenate (FCTH), crude placental supernatant (CPS), crude placental pellet (CPP), Histodenz fractions (0–50%, 50–55%), and the pelleted plasma membrane (65% PPM). Note that neither FLOT1 nor FLOT2 was enriched in the PPM fraction. (B) Immunoblotting was used to confirm the expression of both flotillins in three additional term human placenta extracts prepared following lysis in buffer containing n-octyl β-D-glucopyranoside (see “Materials and methods”).

Journal: Histochemistry and cell biology

Article Title: Expression of flotillins in the human placenta: potential implications for placental transcytosis

doi: 10.1007/s00418-012-1040-2

Figure Lengend Snippet: FLOT1 and FLOT2 are expressed in human placental homogenates. (A) Equal amounts of protein from fractions generated during the preparation of small cationic colloidal silica-coated ST microvillous fractions (Robinson et al., 2009b) were resolved by gel electrophoresis, transferred to nitrocellulose membranes, and probed with antibodies directed against either FLOT1 or FLOT2. These fractions were: crude tissue homogenate (CTH), filtered crude tissue homogenate (FCTH), crude placental supernatant (CPS), crude placental pellet (CPP), Histodenz fractions (0–50%, 50–55%), and the pelleted plasma membrane (65% PPM). Note that neither FLOT1 nor FLOT2 was enriched in the PPM fraction. (B) Immunoblotting was used to confirm the expression of both flotillins in three additional term human placenta extracts prepared following lysis in buffer containing n-octyl β-D-glucopyranoside (see “Materials and methods”).

Article Snippet: The following antibodies were used for immunoblotting and immunolabeling experiments, as indicated in the text and figure legends: mouse anti-FLOT1 (610820, BD Biosciences), mouse anti-FLOT2 (610383, BD Biosciences), rabbit anti-FLOT1 (HPA001393, Sigma-Aldrich), rabbit anti-FLOT2 (F1680, Sigma-Aldrich), rabbit anti-FLOT2 (F1805, Sigma-Aldrich), mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Chemicon International), mouse anti-dysferlin (DYSF; Ham1/7B6, Vector Laboratories), mouse monoclonal anti-E-cadherin (E-cad, 610181, BD Biosciences), and mouse anti-serine peptidase inhibitor, Kunitz type 1 (SPINT1, clone C76/18) ( Kataoka et al., 2000b ; Kataoka et al., 2000a ; Shimomura et al., 1999 ).

Techniques: Generated, Nucleic Acid Electrophoresis, Western Blot, Expressing, Lysis

Distribution of FLOT1 and FLOT2 proteins in term human placental villi. (A–D) Representative photomicrographs of conventional cryostat sections (5–6 μm) of placental villi labeled with anti-FLOT1 (HPA001393; red in A) and anti-FLOT2 (1608; red C) antibodies and imaged using laser scanning confocal microscopy. The intensities of these images were adjusted to provide maximal contrast. Panels B and D are corresponding non-confocal differential interference contrast (DIC) micrographs on which DAPI staining (blue) is superimposed. Prominent flotillin labeling (red) is observed in cytotrophoblasts (CTs) and/or basal regions of syncytiotrophoblast (ST), and in fetal capillary endothelial cells (*, lumen of fetal capillary). Arrowheads indicate surface of ST; double arrows indicate flotillin labeling in ST; white single arrows indicate labeling along the basal surface of the ST and/or in CTs; black arrows indicate labeling in endothelial cells. (E, F) Fluorescence intensity measurements for FLOT1 (E) and FLOT2 (F) labeling taken within fetal capillary endothelial cells (EC) of intermediate and terminal villi, and at three levels of the villous tree: terminal villi (TV), intermediate villi (IV), and stem villi (SV). In our analysis, we found that the intensity measurements for FLOT1 EC labeling in intermediate and terminal villi were equivalent, so the data were pooled. This was also the case for FLOT2 EC labeling. Note that the differences in the absolute intensity measurements between FLOT1 and FLOT2 may represent differences in antigen-antibody interactions, and should not be interpreted as differences in relative abundance between these two proteins. Data are mean ± SD from 3 separate term placental specimens; *, P < 0.05 vs. SV; **, P < 0.01 vs. SV (ANOVA with Bonferroni multiple comparisons). Scale bar = 20 μm

Journal: Histochemistry and cell biology

Article Title: Expression of flotillins in the human placenta: potential implications for placental transcytosis

doi: 10.1007/s00418-012-1040-2

Figure Lengend Snippet: Distribution of FLOT1 and FLOT2 proteins in term human placental villi. (A–D) Representative photomicrographs of conventional cryostat sections (5–6 μm) of placental villi labeled with anti-FLOT1 (HPA001393; red in A) and anti-FLOT2 (1608; red C) antibodies and imaged using laser scanning confocal microscopy. The intensities of these images were adjusted to provide maximal contrast. Panels B and D are corresponding non-confocal differential interference contrast (DIC) micrographs on which DAPI staining (blue) is superimposed. Prominent flotillin labeling (red) is observed in cytotrophoblasts (CTs) and/or basal regions of syncytiotrophoblast (ST), and in fetal capillary endothelial cells (*, lumen of fetal capillary). Arrowheads indicate surface of ST; double arrows indicate flotillin labeling in ST; white single arrows indicate labeling along the basal surface of the ST and/or in CTs; black arrows indicate labeling in endothelial cells. (E, F) Fluorescence intensity measurements for FLOT1 (E) and FLOT2 (F) labeling taken within fetal capillary endothelial cells (EC) of intermediate and terminal villi, and at three levels of the villous tree: terminal villi (TV), intermediate villi (IV), and stem villi (SV). In our analysis, we found that the intensity measurements for FLOT1 EC labeling in intermediate and terminal villi were equivalent, so the data were pooled. This was also the case for FLOT2 EC labeling. Note that the differences in the absolute intensity measurements between FLOT1 and FLOT2 may represent differences in antigen-antibody interactions, and should not be interpreted as differences in relative abundance between these two proteins. Data are mean ± SD from 3 separate term placental specimens; *, P < 0.05 vs. SV; **, P < 0.01 vs. SV (ANOVA with Bonferroni multiple comparisons). Scale bar = 20 μm

Article Snippet: The following antibodies were used for immunoblotting and immunolabeling experiments, as indicated in the text and figure legends: mouse anti-FLOT1 (610820, BD Biosciences), mouse anti-FLOT2 (610383, BD Biosciences), rabbit anti-FLOT1 (HPA001393, Sigma-Aldrich), rabbit anti-FLOT2 (F1680, Sigma-Aldrich), rabbit anti-FLOT2 (F1805, Sigma-Aldrich), mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Chemicon International), mouse anti-dysferlin (DYSF; Ham1/7B6, Vector Laboratories), mouse monoclonal anti-E-cadherin (E-cad, 610181, BD Biosciences), and mouse anti-serine peptidase inhibitor, Kunitz type 1 (SPINT1, clone C76/18) ( Kataoka et al., 2000b ; Kataoka et al., 2000a ; Shimomura et al., 1999 ).

Techniques: Labeling, Confocal Microscopy, Staining, Fluorescence

Flotillin expression is downregulated and changes distribution in BeWo cells following foskolin-induced fusion. (A) Representative immunoblots of BeWo cells treated with 20 μM forskolin from 0–72 h. Note that the immunoreactivity of FLOT1 and FLOT2 decreases with forskolin treatment, whereas that of dysferlin (DYSF) increases. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. Similar results were obtained in three separate experiments. (B, C) Mononuclear BeWo cells immunolabeled with antibodies against FLOT1 (HPA001393; red in B) and FLOT2 (1608; red in C), respectively. Double arrows indicate areas of flotillin labeling along cellular boundaries; wide arrows denote areas of periuclear staining in individual cells. (D, E) BeWo cells treated with forskolin (20 μM for 72 h) and co-immunolabeled using antibodies generated against E-cadherin (E-cad, green) and either FLOT1 (red in D) or FLOT2 (red in E), as above. Wide arrows indicate flotillin-like immunoreactivity in crescent-shaped structures in close proximity to clusters of nuclei; arrowhead in E denotes an area of Ecad labeling that has become irregular following cell-cell fusion. (F) Cryosection (5–6 μm) of term placental villus co-immunolabeled using antibodies generated against dysferlin (DYSF, green) and FLOT2 (1608; red) and imaged using confocal microscopy. Single arrows indicate DYSF labeling at the apical regions of the ST; double arrows indicate FLOT2 labeling. (G) BeWo cells treated with forskolin (20 μM for 72 h) and co-immunolabeled using anti-DYSF (green) and anti-FLOT2 (red) antibodies. Arrowheads denote co-labeling in crescent-shaped structures around clusters of nuclei; the asterisk indicates DYSF immunoreactivity in fused cells. Note that non-fused cells lack DYSF labeling. All scale bars = 20 μm

Journal: Histochemistry and cell biology

Article Title: Expression of flotillins in the human placenta: potential implications for placental transcytosis

doi: 10.1007/s00418-012-1040-2

Figure Lengend Snippet: Flotillin expression is downregulated and changes distribution in BeWo cells following foskolin-induced fusion. (A) Representative immunoblots of BeWo cells treated with 20 μM forskolin from 0–72 h. Note that the immunoreactivity of FLOT1 and FLOT2 decreases with forskolin treatment, whereas that of dysferlin (DYSF) increases. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. Similar results were obtained in three separate experiments. (B, C) Mononuclear BeWo cells immunolabeled with antibodies against FLOT1 (HPA001393; red in B) and FLOT2 (1608; red in C), respectively. Double arrows indicate areas of flotillin labeling along cellular boundaries; wide arrows denote areas of periuclear staining in individual cells. (D, E) BeWo cells treated with forskolin (20 μM for 72 h) and co-immunolabeled using antibodies generated against E-cadherin (E-cad, green) and either FLOT1 (red in D) or FLOT2 (red in E), as above. Wide arrows indicate flotillin-like immunoreactivity in crescent-shaped structures in close proximity to clusters of nuclei; arrowhead in E denotes an area of Ecad labeling that has become irregular following cell-cell fusion. (F) Cryosection (5–6 μm) of term placental villus co-immunolabeled using antibodies generated against dysferlin (DYSF, green) and FLOT2 (1608; red) and imaged using confocal microscopy. Single arrows indicate DYSF labeling at the apical regions of the ST; double arrows indicate FLOT2 labeling. (G) BeWo cells treated with forskolin (20 μM for 72 h) and co-immunolabeled using anti-DYSF (green) and anti-FLOT2 (red) antibodies. Arrowheads denote co-labeling in crescent-shaped structures around clusters of nuclei; the asterisk indicates DYSF immunoreactivity in fused cells. Note that non-fused cells lack DYSF labeling. All scale bars = 20 μm

Article Snippet: The following antibodies were used for immunoblotting and immunolabeling experiments, as indicated in the text and figure legends: mouse anti-FLOT1 (610820, BD Biosciences), mouse anti-FLOT2 (610383, BD Biosciences), rabbit anti-FLOT1 (HPA001393, Sigma-Aldrich), rabbit anti-FLOT2 (F1680, Sigma-Aldrich), rabbit anti-FLOT2 (F1805, Sigma-Aldrich), mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Chemicon International), mouse anti-dysferlin (DYSF; Ham1/7B6, Vector Laboratories), mouse monoclonal anti-E-cadherin (E-cad, 610181, BD Biosciences), and mouse anti-serine peptidase inhibitor, Kunitz type 1 (SPINT1, clone C76/18) ( Kataoka et al., 2000b ; Kataoka et al., 2000a ; Shimomura et al., 1999 ).

Techniques: Expressing, Western Blot, Immunolabeling, Labeling, Staining, Generated, Confocal Microscopy

Flotillins contribute to endocytosis in BeWo cells. (A) Flotillins co-localize with a fluorescent marker of fluid phase-pinocytosis in endocytosis assays. Mononuclear BeWo cells were incubated continuously in the presence of 1 mg/ml of lucifer yellow (LY-CH, green) for 15 min prior to fixation. Following permeabilization, the cells were immunolabeled with anti-FLOT2 antibodies (red) and imaged using confocal microscopy. In the representative micrograph taken from a single optical section, areas of co-localization between the LY-CH cargo and FLOT2 (yellow in the merged images, indicated by arrows) are observed. Similar results were obtained when the cells were labeled using antibodies generated against FLOT1 (not shown). Scale bar = 10 μm. (B) Immunoblots of BeWo cell lines stably transuced with shRNA targeting FLOT1, FLOT2, or both. Control cells were tranduced with Non-Target Control Transduction Particles (LV CTRL) as described in “Materials and methods”. (C) Flotillin knockdown decreases uptake of fluorescently-labeled cholera toxin B subunit (CTB-594). BeWo cells varying in flotillin expression levels were incubated with 20 μg/ml CTB-594 at 4°C for 30 min, then warmed to 37°C and endocytosis was allowed to proceed in media without labeled ligand for 15 min. On average, cells deficient in flotillin expression exhibited decreased CTB-549 based on average fluorescence intensity measurements. Data are mean ± SD from two separate experiments. Different letters indicate significant differences at P < 0.05 (ANOVA with Bonferroni multiple comparisons)

Journal: Histochemistry and cell biology

Article Title: Expression of flotillins in the human placenta: potential implications for placental transcytosis

doi: 10.1007/s00418-012-1040-2

Figure Lengend Snippet: Flotillins contribute to endocytosis in BeWo cells. (A) Flotillins co-localize with a fluorescent marker of fluid phase-pinocytosis in endocytosis assays. Mononuclear BeWo cells were incubated continuously in the presence of 1 mg/ml of lucifer yellow (LY-CH, green) for 15 min prior to fixation. Following permeabilization, the cells were immunolabeled with anti-FLOT2 antibodies (red) and imaged using confocal microscopy. In the representative micrograph taken from a single optical section, areas of co-localization between the LY-CH cargo and FLOT2 (yellow in the merged images, indicated by arrows) are observed. Similar results were obtained when the cells were labeled using antibodies generated against FLOT1 (not shown). Scale bar = 10 μm. (B) Immunoblots of BeWo cell lines stably transuced with shRNA targeting FLOT1, FLOT2, or both. Control cells were tranduced with Non-Target Control Transduction Particles (LV CTRL) as described in “Materials and methods”. (C) Flotillin knockdown decreases uptake of fluorescently-labeled cholera toxin B subunit (CTB-594). BeWo cells varying in flotillin expression levels were incubated with 20 μg/ml CTB-594 at 4°C for 30 min, then warmed to 37°C and endocytosis was allowed to proceed in media without labeled ligand for 15 min. On average, cells deficient in flotillin expression exhibited decreased CTB-549 based on average fluorescence intensity measurements. Data are mean ± SD from two separate experiments. Different letters indicate significant differences at P < 0.05 (ANOVA with Bonferroni multiple comparisons)

Article Snippet: The following antibodies were used for immunoblotting and immunolabeling experiments, as indicated in the text and figure legends: mouse anti-FLOT1 (610820, BD Biosciences), mouse anti-FLOT2 (610383, BD Biosciences), rabbit anti-FLOT1 (HPA001393, Sigma-Aldrich), rabbit anti-FLOT2 (F1680, Sigma-Aldrich), rabbit anti-FLOT2 (F1805, Sigma-Aldrich), mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Chemicon International), mouse anti-dysferlin (DYSF; Ham1/7B6, Vector Laboratories), mouse monoclonal anti-E-cadherin (E-cad, 610181, BD Biosciences), and mouse anti-serine peptidase inhibitor, Kunitz type 1 (SPINT1, clone C76/18) ( Kataoka et al., 2000b ; Kataoka et al., 2000a ; Shimomura et al., 1999 ).

Techniques: Marker, Incubation, Immunolabeling, Confocal Microscopy, Labeling, Generated, Western Blot, Stable Transfection, shRNA, Transduction, Expressing, Fluorescence

Chick myogenic cells were grown 24(control, Ct ). Cell culture extracts were analyzed in Western blot using an antibody against flotillin-2 ( A ). Lower Western blot shows α-tubulin reactivity of the same samples, and was used to normalize sample loading ( A ). Quantification of protein bands revealed a 40% increase in the levels of flotillin-2 expression after cholesterol depletion ( B ). RT-PCR analysis (for details, see ) of the expression of flotillin-2 in control and in MbCD-treated cells is shown in C . Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used for normalization. Analysis of the expression of flotillin-2 shows a more than 2-fold increase in the levels of mRNA expression in MbCD-treated cells compared with control cells. *p<0.05; t test for unpaired samples, n = 3.

Journal: PLoS ONE

Article Title: Differences in the Expression and Distribution of Flotillin-2 in Chick, Mice and Human Muscle Cells

doi: 10.1371/journal.pone.0103990

Figure Lengend Snippet: Chick myogenic cells were grown 24(control, Ct ). Cell culture extracts were analyzed in Western blot using an antibody against flotillin-2 ( A ). Lower Western blot shows α-tubulin reactivity of the same samples, and was used to normalize sample loading ( A ). Quantification of protein bands revealed a 40% increase in the levels of flotillin-2 expression after cholesterol depletion ( B ). RT-PCR analysis (for details, see ) of the expression of flotillin-2 in control and in MbCD-treated cells is shown in C . Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used for normalization. Analysis of the expression of flotillin-2 shows a more than 2-fold increase in the levels of mRNA expression in MbCD-treated cells compared with control cells. *p<0.05; t test for unpaired samples, n = 3.

Article Snippet: Primer sequences are listed below: NM_001030719.1 Gallus gallus flotillin 2 (FLOT2), mRNA product length = 74 Forward primer 1 GGCCTACGAGCTTCAAAGTG 20 Reverse primer 1 GTTGCACCACCTCGATTTCT 20 NM_204305.1 Gallus gallus glyceraldehyde-3-phosphate dehydrogenase (GAPDH), mRNA product length = 112 Forward primer 1 GACGTGCAGCAGGAACACTA 20 Reverse primer 1 CTTGGACTTTGCCAGAGAGG 20

Techniques: Control, Cell Culture, Western Blot, Expressing, Reverse Transcription Polymerase Chain Reaction

HEK293 cells co-transfected with mammalian-expression vectors encoding human FLOT1 and FLOT2, using Lipofectamine 2000; double-stained with serum (B, E), and with commercial antibody against FLOT1 (A,D). MS patient’s IgG bind to co-transfected cells (B), and colocalize with FLOT1 ab (C); in contrast with the healthy control (E), that doesn’t show any reactivity against FLOT-1/2 antibodies.

Journal: medRxiv

Article Title: Antibodies against the flotillin-1/2 complex in patients with multiple sclerosis

doi: 10.1101/2022.09.14.22278529

Figure Lengend Snippet: HEK293 cells co-transfected with mammalian-expression vectors encoding human FLOT1 and FLOT2, using Lipofectamine 2000; double-stained with serum (B, E), and with commercial antibody against FLOT1 (A,D). MS patient’s IgG bind to co-transfected cells (B), and colocalize with FLOT1 ab (C); in contrast with the healthy control (E), that doesn’t show any reactivity against FLOT-1/2 antibodies.

Article Snippet: First, all the samples were analysed for IgG reactivity on commercial slides containing biochips with cells co-expressing FLOT1 and FLOT2 proteins (Euroimmun, Lübeck, Germany).

Techniques: Transfection, Expressing, Staining