Journal: Molecular Biology of the Cell

Article Title: Inhibition of the FKBP family of peptidyl prolyl isomerases induces abortive translocation and degradation of the cellular prion protein

doi: 10.1091/mbc.E15-10-0729

Figure Lengend Snippet: FKBP10 depletion induces degradation of PrP C through proteasomal and lysosomal pathways. (A) Knockdowns (KDs) were performed over a period of 7 d in N2a cells using either FKBP10-specific siRNA or nontargeting control siRNA, and FKBP10 expression was assessed by immunoblot. Expression levels of PrP C , BiP, GAPDH, and CD90 were also monitored. For comparison, N2a cells were treated with 25 μg/ml FK506 overnight. (B) N2a cells were treated with FKBP10-specific siRNA or control siRNA for 3 d and subsequently treated with DMSO, 10 μM MG132 (MG), 25 μM chloroquine (Chl), or both (M+C) for 16 h. After deglycosylation with PNGase, FKBP10, PrP C and GAPDH levels were assessed by immunoblot. (C) Densitometric quantification of PrP C levels was carried out using ImageJ software (National Institutes of Health, Bethesda, MD). Values are expressed as a percentage of the level in control siRNA + vehicle–treated cells ( n = 4 for FKBP10 siRNA + M+ C; n = 5 for all other conditions, ±SEM). * p < 0.005. (D) Knockdowns were performed over a period of 6 d in N2a cells using either FKBP10-specific siRNA or nontargeting control siRNA. In addition, the cells were transiently transfected on day 5 with plasmids encoding hamster PrP C with either its WT signal sequence or that of Prl or Opn. After deglycosylation with PNGase, the expression levels of FKBP10, PrP C , and GAPDH were monitored by immunoblot.

Article Snippet: The primers and probes used were as follows: FKBP1A, Hs00356621_g1; FKBP1B, Hs00997682_m1; FKBP2, Hs00234404_m1; FKBP4, Hs00427038_g1; FKBP5, Hs01561006_m1; FKBP7, Hs00535040_m1; FKBP8, Hs01014664_m1; FKBP9, Hs01119941_m1; FKBP10, Hs00222557_m1; FKBP11, Hs01042990_g1; FKBP14, Hs00215735_m1; FKBP15, Hs00293374_m1; and β-actin, Hs01060665_g1.

Techniques: Control, Expressing, Western Blot, Comparison, Software, Transfection, Sequencing

Journal: Molecular Biology of the Cell

Article Title: Inhibition of the FKBP family of peptidyl prolyl isomerases induces abortive translocation and degradation of the cellular prion protein

doi: 10.1091/mbc.E15-10-0729

Figure Lengend Snippet: FKBP10 depletion effectively inhibits PrP Sc propagation. FKBP10 knockdown was performed transiently using siRNA in (A) ScN2a and (B) SMB cells. The efficiencies of the knockdowns were validated in PNGase-treated lysates by immunoblotting for FKBP10 with actin as loading control. To evaluate PrP and PrP Sc levels, cell lysates were split for the direct assessment of total PrP levels after PNGase treatment or for PK digestion and assessment of PK- resistant PrP Sc . Here # and ## indicate C2 and C1 PrP fragments, respectively. Total PrP and PrP Sc were quantified and expressed as a percentage of the level in control cells for (C) ScN2a and (D) SMB cell lines ( n = 4, ±SD).

Article Snippet: The primers and probes used were as follows: FKBP1A, Hs00356621_g1; FKBP1B, Hs00997682_m1; FKBP2, Hs00234404_m1; FKBP4, Hs00427038_g1; FKBP5, Hs01561006_m1; FKBP7, Hs00535040_m1; FKBP8, Hs01014664_m1; FKBP9, Hs01119941_m1; FKBP10, Hs00222557_m1; FKBP11, Hs01042990_g1; FKBP14, Hs00215735_m1; FKBP15, Hs00293374_m1; and β-actin, Hs01060665_g1.

Techniques: Knockdown, Western Blot, Control

Journal: Discover Oncology

Article Title: FKBP10 as a prognostic biomarker and therapeutic target in hepatocellular carcinoma

doi: 10.1007/s12672-026-04604-1

Figure Lengend Snippet: FKBP10 expression profiles and prognostic significance in HCC. A Pan-cancer analysis of FKBP10 mRNA expression across tumor and normal tissues using the TIMER database. B FKBP10 mRNA expression in HCC and normal liver tissues from TCGA, analyzed via the UALCAN portal. C FKBP10 expression across liver cancer subtypes. D , E FKBP10 expression in tumors with different histological grades and nodal metastasis status, respectively. F FKBP10 protein expression levels in HCC versus normal liver tissues from the CPTAC dataset. G Immunohistochemical staining of FKBP10 protein in HCC and normal tissues from the HPA database. H , I Validation of FKBP10 mRNA ( H ) and protein ( I ) expression in paired tumor and adjacent normal tissues from clinical HCC samples. J Kaplan-Meier survival curves showing the overall survival difference between high and low FKBP10 expression groups in TCGA-HCC, analyzed via UALCAN. K Kaplan-Meier curves showing overall survival (OS) and disease-free survival (DFS) in high vs. low FKBP10 expression groups from a clinical HCC cohort

Article Snippet: Tissue sections were incubated overnight at 4 °C with fluorophore-conjugated primary antibodies against EpCAM (Proteintech, 21050-1-AP), α-SMA (Proteintech, 14395-1-AP), and FKBP10 (Proteintech, 12172-1-AP) in a humidified chamber.

Techniques: Expressing, Immunohistochemical staining, Staining, Biomarker Discovery

Journal: Discover Oncology

Article Title: FKBP10 as a prognostic biomarker and therapeutic target in hepatocellular carcinoma

doi: 10.1007/s12672-026-04604-1

Figure Lengend Snippet: Functional enrichment analyses of FKBP10 and associated genes in HCC. A Protein–protein interaction (PPI) network of FKBP10 and its top 10 interacting proteins constructed using STRING. B KEGG and GO enrichment analyses of the top 50 FKBP10-interacting proteins. C Volcano plot showing differentially expressed genes (DEGs) between FKBP10-high and FKBP10-low groups in TCGA-LIHC ( P < 0.01, |log₂FC| > 1); top upregulated DEGs are labeled. D KEGG pathway enrichment analysis of the DEGs between FKBP10-high and FKBP10-low groups. E GO enrichment analysis of the DEGs, including biological process (BP), cellular component (CC), and molecular function (MF) categories. F GSEA showing pathways positively enriched in the FKBP10-high expression group

Article Snippet: Tissue sections were incubated overnight at 4 °C with fluorophore-conjugated primary antibodies against EpCAM (Proteintech, 21050-1-AP), α-SMA (Proteintech, 14395-1-AP), and FKBP10 (Proteintech, 12172-1-AP) in a humidified chamber.

Techniques: Functional Assay, Construct, Labeling, Expressing

Journal: Discover Oncology

Article Title: FKBP10 as a prognostic biomarker and therapeutic target in hepatocellular carcinoma

doi: 10.1007/s12672-026-04604-1

Figure Lengend Snippet: Single-cell transcriptomic analysis of FKBP10 expression in HCC fibroblasts. A UMAP clustering of 44 cell clusters based on scRNA-seq datasets GSE189903 and GSE212046 . B Cell type annotation based on canonical marker genes. C UMAP plot displaying FKBP10 expression across cell types. D Bubble plot of representative marker genes for cell-type identification. E Subclustering of fibroblasts for further analysis. F Classification of fibroblasts into FKBP10⁺ and FKBP10⁻ subgroups. G Violin plot comparing FKBP10 expression in fibroblasts from HCC versus normal tissues. H Proportional distribution of fibroblast subclusters in tumor versus normal samples, revealing heterogeneity. I FKBP10 expression distribution in fibroblast subpopulations, enriched in tumor-derived fibroblasts. J , K KEGG ( J ) and GO ( K ) enrichment analyses of DEGs between FKBP10⁺ and FKBP10⁻ fibroblasts

Article Snippet: Tissue sections were incubated overnight at 4 °C with fluorophore-conjugated primary antibodies against EpCAM (Proteintech, 21050-1-AP), α-SMA (Proteintech, 14395-1-AP), and FKBP10 (Proteintech, 12172-1-AP) in a humidified chamber.

Techniques: Single Cell, Expressing, Marker, Derivative Assay

Journal: Discover Oncology

Article Title: FKBP10 as a prognostic biomarker and therapeutic target in hepatocellular carcinoma

doi: 10.1007/s12672-026-04604-1

Figure Lengend Snippet: Cell–cell communication analysis of FKBP10⁺ CAFs in the HCC tumor microenvironment. A Number and strength of intercellular interactions among major cell types in HCC. B Communication network showing FKBP10⁺ fibroblasts as key signaling hubs. C Global overview of signaling pathways mediating cell-cell communication. D , E FKBP10⁺ fibroblasts demonstrate dominant interactions via collagen and laminin pathways, particularly with endothelial cells. F Representative immunofluorescence images of human HCC sections stained for FKBP10, α-SMA (CAFs), and EpCAM (HCC), with nuclei counterstained by DAPI. Merged images show prominent co-localization of FKBP10 with α-SMA–positive CAFs

Article Snippet: Tissue sections were incubated overnight at 4 °C with fluorophore-conjugated primary antibodies against EpCAM (Proteintech, 21050-1-AP), α-SMA (Proteintech, 14395-1-AP), and FKBP10 (Proteintech, 12172-1-AP) in a humidified chamber.

Techniques: Protein-Protein interactions, Immunofluorescence, Staining

Journal: Discover Oncology

Article Title: FKBP10 as a prognostic biomarker and therapeutic target in hepatocellular carcinoma

doi: 10.1007/s12672-026-04604-1

Figure Lengend Snippet: Drug sensitivity and immune landscape associated with FKBP10 expression. A – E Correlation analysis between FKBP10 expression and drug activity z-scores (e.g., Apitolisib, PF-04691502, AZD5363, AZD-8055, Bleomycin) using CellMiner; comparison of predicted drug sensitivity between FKBP10-high and -low expression groups. F Immune cell infiltration profiles inferred via CIBERSORT for FKBP10-high vs. -low groups in TCGA-LIHC. G Differential expression of immune checkpoint genes between FKBP10-high and FKBP10-low groups

Article Snippet: Tissue sections were incubated overnight at 4 °C with fluorophore-conjugated primary antibodies against EpCAM (Proteintech, 21050-1-AP), α-SMA (Proteintech, 14395-1-AP), and FKBP10 (Proteintech, 12172-1-AP) in a humidified chamber.

Techniques: Expressing, Activity Assay, Comparison, Quantitative Proteomics

Journal: Discover Oncology

Article Title: FKBP10 as a prognostic biomarker and therapeutic target in hepatocellular carcinoma

doi: 10.1007/s12672-026-04604-1

Figure Lengend Snippet: Additional drug response analysis based on FKBP10 expression. Scatter plots showing correlations between FKBP10 expression and drug activity z-scores; violin plots compare drug sensitivity between FKBP10-high and FKBP10-low expression groups. Data derived from the CellMiner database

Article Snippet: Tissue sections were incubated overnight at 4 °C with fluorophore-conjugated primary antibodies against EpCAM (Proteintech, 21050-1-AP), α-SMA (Proteintech, 14395-1-AP), and FKBP10 (Proteintech, 12172-1-AP) in a humidified chamber.

Techniques: Expressing, Activity Assay, Derivative Assay

Journal: American Journal of Respiratory and Critical Care Medicine

Article Title: FK506-Binding Protein 10, a Potential Novel Drug Target for Idiopathic Pulmonary Fibrosis

doi: 10.1164/rccm.201412-2233oc

Figure Lengend Snippet: Figure 1: FKBP10 is upregulated in the mouse model of bleomycin-induced lung fibrosis. (A) Representative

Article Snippet: WB, Western Blot; IF, immunofluorescent staining Target Antibody Provider Application α-SMA (ACTA2) mouse monoclonal anti-ACTA2 antibody Sigma Aldrich, Louis, MO, USA WB, IF β-actin (ACTB) HRP-conjugated anti-ACTB antibody Sigma Aldrich, Louis, MO, USA WB BiP rabbit monoclonal anti-BiP antibody Cell Signaling, Danvers, MA, USA WB Calreticulin rabbit polyclonal anti-calreticulin antibody Cell Signaling, Danvers, MA, USA WB CD68 APC anti-human CD68 Antibody BioLegend, San Diego, CA, USA IF Collagen type I rabbit polyclonal anti-Collagen I antibody Rockland, Gilbertsville, PA, USA WB, IF Collagen type V rabbit polyclonal anti-Collagen V antibody Santa Cruz, Dallas, TX, USA WB Desmin (B7) mouse monoclonal anti-desmin antibody Santa Cruz, Dallas, TX, USA IF Fibronectin rabbit polyclonal anti-Fibronectin antibody Santa Cruz, Dallas, TX, USA WB FKBP10 rabbit polyclonal anti-FKBP10 antibody ATLAS, Stockholm, Sweden WB1, IF FKBP10 rabbit polyclonal anti-FKBP10 antibody Acris Antibodies, San Diego, CA, USA WB2 Lamin A/C rabbit polyclonal anti-Lamin A/C antibody Cell Signaling, Danvers, MA, USA WB PDIA3 mouse monoclonal anti-Erp57 antibody Abcam, Cambridge, UK WB, IF P-SMAD3 rabbit monoclonal anti-Smad 3 (phospho Ser423/Ser425) antibody Abcam, Cambridge, UK WB SMAD3 rabbit polyclonal anti-total SMAD3 antibody Abcam, Cambridge, UK WB mouse T1α (podoplanin) goat polyclonal anti-mouse podoplanin antibody R&D, Minneapolis, MN, USA IF human T1α (podoplanin) Sheep polyclonal anti-human podoplanin antibody R&D, Minneapolis, MN, USA IF TTF1 mouse monoclonal anti-TTF antibody Santa Cruz IF 1 used for WB analysis of human samples 2 used only for WB analysis of mouse samples Copyright © 2015 by the American Thoracic Society 9

Techniques:

Journal: American Journal of Respiratory and Critical Care Medicine

Article Title: FK506-Binding Protein 10, a Potential Novel Drug Target for Idiopathic Pulmonary Fibrosis

doi: 10.1164/rccm.201412-2233oc

Figure Lengend Snippet: Figure 2: FKBP10 is upregulated in IPF. (A) Heatmap of FKBP10 gene expression, extracted from microarray

Article Snippet: WB, Western Blot; IF, immunofluorescent staining Target Antibody Provider Application α-SMA (ACTA2) mouse monoclonal anti-ACTA2 antibody Sigma Aldrich, Louis, MO, USA WB, IF β-actin (ACTB) HRP-conjugated anti-ACTB antibody Sigma Aldrich, Louis, MO, USA WB BiP rabbit monoclonal anti-BiP antibody Cell Signaling, Danvers, MA, USA WB Calreticulin rabbit polyclonal anti-calreticulin antibody Cell Signaling, Danvers, MA, USA WB CD68 APC anti-human CD68 Antibody BioLegend, San Diego, CA, USA IF Collagen type I rabbit polyclonal anti-Collagen I antibody Rockland, Gilbertsville, PA, USA WB, IF Collagen type V rabbit polyclonal anti-Collagen V antibody Santa Cruz, Dallas, TX, USA WB Desmin (B7) mouse monoclonal anti-desmin antibody Santa Cruz, Dallas, TX, USA IF Fibronectin rabbit polyclonal anti-Fibronectin antibody Santa Cruz, Dallas, TX, USA WB FKBP10 rabbit polyclonal anti-FKBP10 antibody ATLAS, Stockholm, Sweden WB1, IF FKBP10 rabbit polyclonal anti-FKBP10 antibody Acris Antibodies, San Diego, CA, USA WB2 Lamin A/C rabbit polyclonal anti-Lamin A/C antibody Cell Signaling, Danvers, MA, USA WB PDIA3 mouse monoclonal anti-Erp57 antibody Abcam, Cambridge, UK WB, IF P-SMAD3 rabbit monoclonal anti-Smad 3 (phospho Ser423/Ser425) antibody Abcam, Cambridge, UK WB SMAD3 rabbit polyclonal anti-total SMAD3 antibody Abcam, Cambridge, UK WB mouse T1α (podoplanin) goat polyclonal anti-mouse podoplanin antibody R&D, Minneapolis, MN, USA IF human T1α (podoplanin) Sheep polyclonal anti-human podoplanin antibody R&D, Minneapolis, MN, USA IF TTF1 mouse monoclonal anti-TTF antibody Santa Cruz IF 1 used for WB analysis of human samples 2 used only for WB analysis of mouse samples Copyright © 2015 by the American Thoracic Society 9

Techniques: Gene Expression, Microarray

Journal: American Journal of Respiratory and Critical Care Medicine

Article Title: FK506-Binding Protein 10, a Potential Novel Drug Target for Idiopathic Pulmonary Fibrosis

doi: 10.1164/rccm.201412-2233oc

Figure Lengend Snippet: Figure 3: FKBP10 is expressed in interstitial fibroblasts including myofibroblasts in the mouse model of bleomycin-induced lung fibrosis. Immunofluorescent stainings of paraffin sections from control (PBS, left- hand panels) and bleomycin-treated (Bleo, right-hand panels) mice at day 14 after bleomycin instillation. Representative Fkbp10 immunostaining is shown in red, α-Sma, T1α, or TTF1 in green, and DAPI in blue, as

Article Snippet: WB, Western Blot; IF, immunofluorescent staining Target Antibody Provider Application α-SMA (ACTA2) mouse monoclonal anti-ACTA2 antibody Sigma Aldrich, Louis, MO, USA WB, IF β-actin (ACTB) HRP-conjugated anti-ACTB antibody Sigma Aldrich, Louis, MO, USA WB BiP rabbit monoclonal anti-BiP antibody Cell Signaling, Danvers, MA, USA WB Calreticulin rabbit polyclonal anti-calreticulin antibody Cell Signaling, Danvers, MA, USA WB CD68 APC anti-human CD68 Antibody BioLegend, San Diego, CA, USA IF Collagen type I rabbit polyclonal anti-Collagen I antibody Rockland, Gilbertsville, PA, USA WB, IF Collagen type V rabbit polyclonal anti-Collagen V antibody Santa Cruz, Dallas, TX, USA WB Desmin (B7) mouse monoclonal anti-desmin antibody Santa Cruz, Dallas, TX, USA IF Fibronectin rabbit polyclonal anti-Fibronectin antibody Santa Cruz, Dallas, TX, USA WB FKBP10 rabbit polyclonal anti-FKBP10 antibody ATLAS, Stockholm, Sweden WB1, IF FKBP10 rabbit polyclonal anti-FKBP10 antibody Acris Antibodies, San Diego, CA, USA WB2 Lamin A/C rabbit polyclonal anti-Lamin A/C antibody Cell Signaling, Danvers, MA, USA WB PDIA3 mouse monoclonal anti-Erp57 antibody Abcam, Cambridge, UK WB, IF P-SMAD3 rabbit monoclonal anti-Smad 3 (phospho Ser423/Ser425) antibody Abcam, Cambridge, UK WB SMAD3 rabbit polyclonal anti-total SMAD3 antibody Abcam, Cambridge, UK WB mouse T1α (podoplanin) goat polyclonal anti-mouse podoplanin antibody R&D, Minneapolis, MN, USA IF human T1α (podoplanin) Sheep polyclonal anti-human podoplanin antibody R&D, Minneapolis, MN, USA IF TTF1 mouse monoclonal anti-TTF antibody Santa Cruz IF 1 used for WB analysis of human samples 2 used only for WB analysis of mouse samples Copyright © 2015 by the American Thoracic Society 9

Techniques: Control, Immunostaining

Journal: American Journal of Respiratory and Critical Care Medicine

Article Title: FK506-Binding Protein 10, a Potential Novel Drug Target for Idiopathic Pulmonary Fibrosis

doi: 10.1164/rccm.201412-2233oc

Figure Lengend Snippet: Figure 4: FKBP10 is expressed in interstitial fibroblasts, including myofibroblasts, and interstitial CD68+ macrophages in human IPF. Representative immunofluorescent stainings of paraffin sections from donor

Article Snippet: WB, Western Blot; IF, immunofluorescent staining Target Antibody Provider Application α-SMA (ACTA2) mouse monoclonal anti-ACTA2 antibody Sigma Aldrich, Louis, MO, USA WB, IF β-actin (ACTB) HRP-conjugated anti-ACTB antibody Sigma Aldrich, Louis, MO, USA WB BiP rabbit monoclonal anti-BiP antibody Cell Signaling, Danvers, MA, USA WB Calreticulin rabbit polyclonal anti-calreticulin antibody Cell Signaling, Danvers, MA, USA WB CD68 APC anti-human CD68 Antibody BioLegend, San Diego, CA, USA IF Collagen type I rabbit polyclonal anti-Collagen I antibody Rockland, Gilbertsville, PA, USA WB, IF Collagen type V rabbit polyclonal anti-Collagen V antibody Santa Cruz, Dallas, TX, USA WB Desmin (B7) mouse monoclonal anti-desmin antibody Santa Cruz, Dallas, TX, USA IF Fibronectin rabbit polyclonal anti-Fibronectin antibody Santa Cruz, Dallas, TX, USA WB FKBP10 rabbit polyclonal anti-FKBP10 antibody ATLAS, Stockholm, Sweden WB1, IF FKBP10 rabbit polyclonal anti-FKBP10 antibody Acris Antibodies, San Diego, CA, USA WB2 Lamin A/C rabbit polyclonal anti-Lamin A/C antibody Cell Signaling, Danvers, MA, USA WB PDIA3 mouse monoclonal anti-Erp57 antibody Abcam, Cambridge, UK WB, IF P-SMAD3 rabbit monoclonal anti-Smad 3 (phospho Ser423/Ser425) antibody Abcam, Cambridge, UK WB SMAD3 rabbit polyclonal anti-total SMAD3 antibody Abcam, Cambridge, UK WB mouse T1α (podoplanin) goat polyclonal anti-mouse podoplanin antibody R&D, Minneapolis, MN, USA IF human T1α (podoplanin) Sheep polyclonal anti-human podoplanin antibody R&D, Minneapolis, MN, USA IF TTF1 mouse monoclonal anti-TTF antibody Santa Cruz IF 1 used for WB analysis of human samples 2 used only for WB analysis of mouse samples Copyright © 2015 by the American Thoracic Society 9

Techniques:

Journal: American Journal of Respiratory and Critical Care Medicine

Article Title: FK506-Binding Protein 10, a Potential Novel Drug Target for Idiopathic Pulmonary Fibrosis

doi: 10.1164/rccm.201412-2233oc

Figure Lengend Snippet: Figure 5: FKBP10 is mainly an ER-resident protein and does not localize to the Golgi apparatus. (A) Immunostaining of FKBP10 and the ER-marker protein disulfide isomerase A3 (PDIA3) is shown in red and green, respectively. DAPI staining is shown in blue. The white square was chosen as region of interest (ROI)

Article Snippet: WB, Western Blot; IF, immunofluorescent staining Target Antibody Provider Application α-SMA (ACTA2) mouse monoclonal anti-ACTA2 antibody Sigma Aldrich, Louis, MO, USA WB, IF β-actin (ACTB) HRP-conjugated anti-ACTB antibody Sigma Aldrich, Louis, MO, USA WB BiP rabbit monoclonal anti-BiP antibody Cell Signaling, Danvers, MA, USA WB Calreticulin rabbit polyclonal anti-calreticulin antibody Cell Signaling, Danvers, MA, USA WB CD68 APC anti-human CD68 Antibody BioLegend, San Diego, CA, USA IF Collagen type I rabbit polyclonal anti-Collagen I antibody Rockland, Gilbertsville, PA, USA WB, IF Collagen type V rabbit polyclonal anti-Collagen V antibody Santa Cruz, Dallas, TX, USA WB Desmin (B7) mouse monoclonal anti-desmin antibody Santa Cruz, Dallas, TX, USA IF Fibronectin rabbit polyclonal anti-Fibronectin antibody Santa Cruz, Dallas, TX, USA WB FKBP10 rabbit polyclonal anti-FKBP10 antibody ATLAS, Stockholm, Sweden WB1, IF FKBP10 rabbit polyclonal anti-FKBP10 antibody Acris Antibodies, San Diego, CA, USA WB2 Lamin A/C rabbit polyclonal anti-Lamin A/C antibody Cell Signaling, Danvers, MA, USA WB PDIA3 mouse monoclonal anti-Erp57 antibody Abcam, Cambridge, UK WB, IF P-SMAD3 rabbit monoclonal anti-Smad 3 (phospho Ser423/Ser425) antibody Abcam, Cambridge, UK WB SMAD3 rabbit polyclonal anti-total SMAD3 antibody Abcam, Cambridge, UK WB mouse T1α (podoplanin) goat polyclonal anti-mouse podoplanin antibody R&D, Minneapolis, MN, USA IF human T1α (podoplanin) Sheep polyclonal anti-human podoplanin antibody R&D, Minneapolis, MN, USA IF TTF1 mouse monoclonal anti-TTF antibody Santa Cruz IF 1 used for WB analysis of human samples 2 used only for WB analysis of mouse samples Copyright © 2015 by the American Thoracic Society 9

Techniques: Immunostaining, Marker, Staining

Journal: American Journal of Respiratory and Critical Care Medicine

Article Title: FK506-Binding Protein 10, a Potential Novel Drug Target for Idiopathic Pulmonary Fibrosis

doi: 10.1164/rccm.201412-2233oc

Figure Lengend Snippet: Figure 6: FKBP10 is upregulated by TGF-β1 in phLF and knockdown of FKBP10 attenuates synthesis of collagen I, collagen V and α-SMA. (A) Western Blot analysis of phLF treated with increasing concentrations of TGF-β1 (0.1, 0.2, 1.0, 2.0, and 5.0 ng/ml) shows upregulation of FKBP10 at 48 h in the presence of 1.0

Article Snippet: WB, Western Blot; IF, immunofluorescent staining Target Antibody Provider Application α-SMA (ACTA2) mouse monoclonal anti-ACTA2 antibody Sigma Aldrich, Louis, MO, USA WB, IF β-actin (ACTB) HRP-conjugated anti-ACTB antibody Sigma Aldrich, Louis, MO, USA WB BiP rabbit monoclonal anti-BiP antibody Cell Signaling, Danvers, MA, USA WB Calreticulin rabbit polyclonal anti-calreticulin antibody Cell Signaling, Danvers, MA, USA WB CD68 APC anti-human CD68 Antibody BioLegend, San Diego, CA, USA IF Collagen type I rabbit polyclonal anti-Collagen I antibody Rockland, Gilbertsville, PA, USA WB, IF Collagen type V rabbit polyclonal anti-Collagen V antibody Santa Cruz, Dallas, TX, USA WB Desmin (B7) mouse monoclonal anti-desmin antibody Santa Cruz, Dallas, TX, USA IF Fibronectin rabbit polyclonal anti-Fibronectin antibody Santa Cruz, Dallas, TX, USA WB FKBP10 rabbit polyclonal anti-FKBP10 antibody ATLAS, Stockholm, Sweden WB1, IF FKBP10 rabbit polyclonal anti-FKBP10 antibody Acris Antibodies, San Diego, CA, USA WB2 Lamin A/C rabbit polyclonal anti-Lamin A/C antibody Cell Signaling, Danvers, MA, USA WB PDIA3 mouse monoclonal anti-Erp57 antibody Abcam, Cambridge, UK WB, IF P-SMAD3 rabbit monoclonal anti-Smad 3 (phospho Ser423/Ser425) antibody Abcam, Cambridge, UK WB SMAD3 rabbit polyclonal anti-total SMAD3 antibody Abcam, Cambridge, UK WB mouse T1α (podoplanin) goat polyclonal anti-mouse podoplanin antibody R&D, Minneapolis, MN, USA IF human T1α (podoplanin) Sheep polyclonal anti-human podoplanin antibody R&D, Minneapolis, MN, USA IF TTF1 mouse monoclonal anti-TTF antibody Santa Cruz IF 1 used for WB analysis of human samples 2 used only for WB analysis of mouse samples Copyright © 2015 by the American Thoracic Society 9

Techniques: Knockdown, Western Blot

Journal: American Journal of Respiratory and Critical Care Medicine

Article Title: FK506-Binding Protein 10, a Potential Novel Drug Target for Idiopathic Pulmonary Fibrosis

doi: 10.1164/rccm.201412-2233oc

Figure Lengend Snippet: Figure 7: TGF-β1 induces FKBP10 expression and knockdown of FKBP10 in phLF significantly decreases

Article Snippet: WB, Western Blot; IF, immunofluorescent staining Target Antibody Provider Application α-SMA (ACTA2) mouse monoclonal anti-ACTA2 antibody Sigma Aldrich, Louis, MO, USA WB, IF β-actin (ACTB) HRP-conjugated anti-ACTB antibody Sigma Aldrich, Louis, MO, USA WB BiP rabbit monoclonal anti-BiP antibody Cell Signaling, Danvers, MA, USA WB Calreticulin rabbit polyclonal anti-calreticulin antibody Cell Signaling, Danvers, MA, USA WB CD68 APC anti-human CD68 Antibody BioLegend, San Diego, CA, USA IF Collagen type I rabbit polyclonal anti-Collagen I antibody Rockland, Gilbertsville, PA, USA WB, IF Collagen type V rabbit polyclonal anti-Collagen V antibody Santa Cruz, Dallas, TX, USA WB Desmin (B7) mouse monoclonal anti-desmin antibody Santa Cruz, Dallas, TX, USA IF Fibronectin rabbit polyclonal anti-Fibronectin antibody Santa Cruz, Dallas, TX, USA WB FKBP10 rabbit polyclonal anti-FKBP10 antibody ATLAS, Stockholm, Sweden WB1, IF FKBP10 rabbit polyclonal anti-FKBP10 antibody Acris Antibodies, San Diego, CA, USA WB2 Lamin A/C rabbit polyclonal anti-Lamin A/C antibody Cell Signaling, Danvers, MA, USA WB PDIA3 mouse monoclonal anti-Erp57 antibody Abcam, Cambridge, UK WB, IF P-SMAD3 rabbit monoclonal anti-Smad 3 (phospho Ser423/Ser425) antibody Abcam, Cambridge, UK WB SMAD3 rabbit polyclonal anti-total SMAD3 antibody Abcam, Cambridge, UK WB mouse T1α (podoplanin) goat polyclonal anti-mouse podoplanin antibody R&D, Minneapolis, MN, USA IF human T1α (podoplanin) Sheep polyclonal anti-human podoplanin antibody R&D, Minneapolis, MN, USA IF TTF1 mouse monoclonal anti-TTF antibody Santa Cruz IF 1 used for WB analysis of human samples 2 used only for WB analysis of mouse samples Copyright © 2015 by the American Thoracic Society 9

Techniques: Expressing, Knockdown

Journal: American Journal of Respiratory and Critical Care Medicine

Article Title: FK506-Binding Protein 10, a Potential Novel Drug Target for Idiopathic Pulmonary Fibrosis

doi: 10.1164/rccm.201412-2233oc

Figure Lengend Snippet: Figure 8: Knockdown of FKBP10 attenuates collagen secretion. (A) Western Blot analysis of secreted collagen I. Collagen I was precipitated from cell culture supernatant after FKBP10 knockdown in combination

Article Snippet: WB, Western Blot; IF, immunofluorescent staining Target Antibody Provider Application α-SMA (ACTA2) mouse monoclonal anti-ACTA2 antibody Sigma Aldrich, Louis, MO, USA WB, IF β-actin (ACTB) HRP-conjugated anti-ACTB antibody Sigma Aldrich, Louis, MO, USA WB BiP rabbit monoclonal anti-BiP antibody Cell Signaling, Danvers, MA, USA WB Calreticulin rabbit polyclonal anti-calreticulin antibody Cell Signaling, Danvers, MA, USA WB CD68 APC anti-human CD68 Antibody BioLegend, San Diego, CA, USA IF Collagen type I rabbit polyclonal anti-Collagen I antibody Rockland, Gilbertsville, PA, USA WB, IF Collagen type V rabbit polyclonal anti-Collagen V antibody Santa Cruz, Dallas, TX, USA WB Desmin (B7) mouse monoclonal anti-desmin antibody Santa Cruz, Dallas, TX, USA IF Fibronectin rabbit polyclonal anti-Fibronectin antibody Santa Cruz, Dallas, TX, USA WB FKBP10 rabbit polyclonal anti-FKBP10 antibody ATLAS, Stockholm, Sweden WB1, IF FKBP10 rabbit polyclonal anti-FKBP10 antibody Acris Antibodies, San Diego, CA, USA WB2 Lamin A/C rabbit polyclonal anti-Lamin A/C antibody Cell Signaling, Danvers, MA, USA WB PDIA3 mouse monoclonal anti-Erp57 antibody Abcam, Cambridge, UK WB, IF P-SMAD3 rabbit monoclonal anti-Smad 3 (phospho Ser423/Ser425) antibody Abcam, Cambridge, UK WB SMAD3 rabbit polyclonal anti-total SMAD3 antibody Abcam, Cambridge, UK WB mouse T1α (podoplanin) goat polyclonal anti-mouse podoplanin antibody R&D, Minneapolis, MN, USA IF human T1α (podoplanin) Sheep polyclonal anti-human podoplanin antibody R&D, Minneapolis, MN, USA IF TTF1 mouse monoclonal anti-TTF antibody Santa Cruz IF 1 used for WB analysis of human samples 2 used only for WB analysis of mouse samples Copyright © 2015 by the American Thoracic Society 9

Techniques: Knockdown, Western Blot, Cell Culture

Journal: American Journal of Respiratory and Critical Care Medicine

Article Title: FK506-Binding Protein 10, a Potential Novel Drug Target for Idiopathic Pulmonary Fibrosis

doi: 10.1164/rccm.201412-2233oc

Figure Lengend Snippet: Figure 9: In IPF fibroblasts, FKBP10 knockdown inhibits collagen secretion with similar efficiency as nintedanib, while pirfenidone shows no effect. (A-C) Normalized levels of secreted collagen in response to (A) FKBP10 knockdown, (B) nintedanib and (C) pirfenidone treatment at varying concentrations. In contrast to pirfenidone, nintedanib shows a dose-dependent effect. In comparison, FKBP10 knockdown performs with

Article Snippet: WB, Western Blot; IF, immunofluorescent staining Target Antibody Provider Application α-SMA (ACTA2) mouse monoclonal anti-ACTA2 antibody Sigma Aldrich, Louis, MO, USA WB, IF β-actin (ACTB) HRP-conjugated anti-ACTB antibody Sigma Aldrich, Louis, MO, USA WB BiP rabbit monoclonal anti-BiP antibody Cell Signaling, Danvers, MA, USA WB Calreticulin rabbit polyclonal anti-calreticulin antibody Cell Signaling, Danvers, MA, USA WB CD68 APC anti-human CD68 Antibody BioLegend, San Diego, CA, USA IF Collagen type I rabbit polyclonal anti-Collagen I antibody Rockland, Gilbertsville, PA, USA WB, IF Collagen type V rabbit polyclonal anti-Collagen V antibody Santa Cruz, Dallas, TX, USA WB Desmin (B7) mouse monoclonal anti-desmin antibody Santa Cruz, Dallas, TX, USA IF Fibronectin rabbit polyclonal anti-Fibronectin antibody Santa Cruz, Dallas, TX, USA WB FKBP10 rabbit polyclonal anti-FKBP10 antibody ATLAS, Stockholm, Sweden WB1, IF FKBP10 rabbit polyclonal anti-FKBP10 antibody Acris Antibodies, San Diego, CA, USA WB2 Lamin A/C rabbit polyclonal anti-Lamin A/C antibody Cell Signaling, Danvers, MA, USA WB PDIA3 mouse monoclonal anti-Erp57 antibody Abcam, Cambridge, UK WB, IF P-SMAD3 rabbit monoclonal anti-Smad 3 (phospho Ser423/Ser425) antibody Abcam, Cambridge, UK WB SMAD3 rabbit polyclonal anti-total SMAD3 antibody Abcam, Cambridge, UK WB mouse T1α (podoplanin) goat polyclonal anti-mouse podoplanin antibody R&D, Minneapolis, MN, USA IF human T1α (podoplanin) Sheep polyclonal anti-human podoplanin antibody R&D, Minneapolis, MN, USA IF TTF1 mouse monoclonal anti-TTF antibody Santa Cruz IF 1 used for WB analysis of human samples 2 used only for WB analysis of mouse samples Copyright © 2015 by the American Thoracic Society 9

Techniques: Knockdown, Comparison

Journal: Cell stress & chaperones

Article Title: Endoplasmic reticulum stress or mutation of an EF-hand Ca(2+)-binding domain directs the FKBP65 rotamase to an ERAD-based proteolysis.

doi: 10.1007/s12192-011-0270-x

Figure Lengend Snippet: Fig. 3 ER stress diminishes FKBP65 co-localization with the ER. tsBN7 fibroblasts were transfected with pER-RFP (Invitrogen) to label the endo- plasmic reticulum with RFP. Immunologic detection of FKBP65 or calreticulin involved a primary antibody detected with an Alexa 488-conjugated secondary antibody (Molecular Probes; Eugene, OR, USA). A 12-h TS treatment was used to induce ER stress in these tsBN7 fibroblasts. FKBP65, but not calreticulin, displayed dimin- ished signal intensity and ER localization following TS treat- ment

Article Snippet: Site-directed mutagenesis A full-length, FKBP10 cDNA clone (in pCMV6-AC), encoding the Mus musculus FKBP65 protein, was purchased from Origene Technologies (Rockville, MD, USA).

Techniques: Transfection

Journal: Cell stress & chaperones

Article Title: Endoplasmic reticulum stress or mutation of an EF-hand Ca(2+)-binding domain directs the FKBP65 rotamase to an ERAD-based proteolysis.

doi: 10.1007/s12192-011-0270-x

Figure Lengend Snippet: Fig. 4 ER stress induces a decrease of FKBP65 localization to membrane fractions and evidence of a cytosolic cleavage product. Subcellular fractionation was performed using cell lysates from tsBN7 cells exposed to TS for 0, 6, or 12 h. Fractions generated were cytosolic, membrane (ER, mitochondria), and nuclear fractions. The integrity of each fraction was determined by examining markers for each cellular compartment (cytosol, calpain; ER, calreticulin; nucleus, lamin). Following ER stress, FKBP65 within the ER diminishes in intensity, while a 30-kDa FKBP65 antibody-reactive protein increases in intensity

Article Snippet: Site-directed mutagenesis A full-length, FKBP10 cDNA clone (in pCMV6-AC), encoding the Mus musculus FKBP65 protein, was purchased from Origene Technologies (Rockville, MD, USA).

Techniques: Membrane, Fractionation, Generated

Journal: Cell stress & chaperones

Article Title: Endoplasmic reticulum stress or mutation of an EF-hand Ca(2+)-binding domain directs the FKBP65 rotamase to an ERAD-based proteolysis.

doi: 10.1007/s12192-011-0270-x

Figure Lengend Snippet: Fig. 7 Proteolysis of EF-hand mutant FKBP65 is mediated by the proteasome. a Cultured tsBN7 cells expressing rFKBP65-GFP display an ER stress-induced proteolysis of the recombinant protein, similar to the native FKBP65 protein. Inhibition of the proteasome inhibited this proteolysis (MG132, 5 μM). b Proteasome inhibition (12-h exposure) is sufficient to restore normal cellular accumulation of rFKBP65-GFP proteins carrying mutations in the EF-hand Ca2+-binding domains. To generate the final figures (a, b), some lanes were reordered, though all bands shown in each panel are from a photograph of a single auto- radiographic film

Article Snippet: Site-directed mutagenesis A full-length, FKBP10 cDNA clone (in pCMV6-AC), encoding the Mus musculus FKBP65 protein, was purchased from Origene Technologies (Rockville, MD, USA).

Techniques: Mutagenesis, Cell Culture, Expressing, Recombinant, Inhibition, Binding Assay

Journal: Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research

Article Title: A Chaperone Complex Formed by HSP47, FKBP65, and BiP Modulates Telopeptide Lysyl Hydroxylation of Type I Procollagen.

doi: 10.1002/jbmr.3095

Figure Lengend Snippet: Fig. 1. LH2, FKBP65, HSP47, and BiP interact. (A–C) Protein levels of LH2 were altered in cells with mutations in FKBP10 and SERPINH1. BiP levels were decreased in HSP47 defective cells. (D, E) Rescue experiment using FKBP10-/- cells transfected with FKBP10 tagged vector. LH2 levels were rescued by expression of wild-type FKBP65 protein. (F) Co-immunoprecipitation of endogenous LH2, FKBP65, HSP47, and BiP in human osteoblasts (OB) with specific antibodies. LH2 immunoprecipitated HSP47 and BiP. (G) Co-immunoprecipitation of tagged FKBP65 and LH2 in OB cells. LH2 and FKBP65 immunoprecipitated each other, including both LH2 isoforms, respectively.

Article Snippet: Rescue experimentswereperformedbyelectroporationof cells with a vector containing the FKBP10 coding sequence taggedwith DDK-flag (OriGene, Rockville, MD, USA).

Techniques: Transfection, Plasmid Preparation, Expressing, Immunoprecipitation

Journal: Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research

Article Title: A Chaperone Complex Formed by HSP47, FKBP65, and BiP Modulates Telopeptide Lysyl Hydroxylation of Type I Procollagen.

doi: 10.1002/jbmr.3095

Figure Lengend Snippet: Fig. 2. In situ interaction of FKBP65 and LH2 by proximity ligation assay. (A) FKBP65 and LH2 interacted in WT cells (red). (B) FKBP10 mutant cells did not show interaction between LH2 and FKBP65. (C, D) Interaction was increased in HSP47 defective cells.

Article Snippet: Rescue experimentswereperformedbyelectroporationof cells with a vector containing the FKBP10 coding sequence taggedwith DDK-flag (OriGene, Rockville, MD, USA).

Techniques: In Situ, Proximity Ligation Assay, Mutagenesis

Journal: Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research

Article Title: A Chaperone Complex Formed by HSP47, FKBP65, and BiP Modulates Telopeptide Lysyl Hydroxylation of Type I Procollagen.

doi: 10.1002/jbmr.3095

Figure Lengend Snippet: Fig. 3. Cellular localization of LH2 and BiP. Intracellular immunolocalization of LH2 and BiP in human fibroblasts. (A–F) LH2 is shown in red and FKBP65 in green. (G–I) BiP is shown in green and HSP47 in red. Control cells (A, D, and G); FKBP10-/- cells (B, E, and H); and HSP47M237T/M237T cells (C, F, and I). LH2 colocalized with FKBP65 in the ER (D–F), including within abnormal vesicles in mutant cells (arrows). BiP colocalized partially with HSP47 in the ER but not in either the Golgi or abnormal vesicles (arrow). Nuclei were stained with DAPI (in blue). Green arrows identify the Golgi compartment.

Article Snippet: Rescue experimentswereperformedbyelectroporationof cells with a vector containing the FKBP10 coding sequence taggedwith DDK-flag (OriGene, Rockville, MD, USA).

Techniques: Control, Mutagenesis, Staining

Journal: Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research

Article Title: A Chaperone Complex Formed by HSP47, FKBP65, and BiP Modulates Telopeptide Lysyl Hydroxylation of Type I Procollagen.

doi: 10.1002/jbmr.3095

Figure Lengend Snippet: Fig. 4. Lysyl hydroxylation of type I collagen C-telopeptides. Percentage of hydroxylation of lysine 1208 in secreted type I collagen by fibroblasts treated with ascorbic acid. The control represents the average of three different fibroblast cell lines from unaffected persons. Control siRNA represents same control fibroblasts transfected with non-target siRNA. FKBP10-/- and HSP47M237T/M237T are patient fibroblasts. PLOD2 and HSPA5 siRNA are knockdown fibroblasts by use of validated iRNA sequences. FKBP10-/- and PLOD2 knockdown cells showed a significant decrease in hydroxylation. HSP47M237T/M237T and HSPA5 knockdown cells showed a significant increase in hydroxylation.

Article Snippet: Rescue experimentswereperformedbyelectroporationof cells with a vector containing the FKBP10 coding sequence taggedwith DDK-flag (OriGene, Rockville, MD, USA).

Techniques: Control, Transfection, Knockdown

Journal: PLoS Genetics

Article Title: Absence of the ER Cation Channel TMEM38B /TRIC-B Disrupts Intracellular Calcium Homeostasis and Dysregulates Collagen Synthesis in Recessive Osteogenesis Imperfecta

doi: 10.1371/journal.pgen.1006156

Figure Lengend Snippet: (A) Quantitative RT-PCR of fibroblast transcripts encoding collagen, modifying enzymes and chaperones. Proband cells (P1, P2, and P3) demonstrate decreased expression of COL1A1 and FKBP10 (FKBP65), and increased expression of PLOD1 (LH1) and HSPA5 (BiP/GRP78) versus control fibroblasts (C). (B) Decreased expression of PLOD2 (LH2), FKBP10 (FKBP65) and PPIB (CyPB) in P2 osteoblasts versus control osteoblasts (C). (C) Immunoblots for quantitation of steady-state protein levels of collagen modifying enzymes and chaperones in proband and control cells. Proband fibroblasts show increases in PDI, LH1, LH2 and BiP protein levels. CyPB and FKBP65, both collagen-interacting isomerases, are consistently decreased in proband fibroblasts and osteoblasts. *, p < 0.05; **, p < 0.01; ***, p < 0.001.

Article Snippet: Gene transcript levels were quantitated by real-time RT-PCR following reverse-transcription using a High Capacity cDNA Archive Kit and Taqman Assays on Demand (Life Technologies, TMEM38A , Hs00225325_m1; TMEM38B , Hs00216531_m1; COL1A1 , Hs00164004_m1; FKBP10 , Hs01000263_m1; PLOD1 , Hs00609368_m1; PLOD2 , Hs01118190_m1; PLOD3 , Hs01126617_m1; P4HB/PDI , Hs00168586_m1; HSPA5 , Hs99999174_m1; PPIB , Hs00168719_m1; ATP2A/SERCA2 , Hs00544877_m1; ITPR1 , Hs00181881_m1; RYR1 , Hs00166991_m1; GAPDH , Hs99999905_m1; ACTB , Hs99999903_m1; B2M , Hs99999907_m1).

Techniques: Quantitative RT-PCR, Expressing, Control, Western Blot, Quantitation Assay

Journal: The Kaohsiung Journal of Medical Sciences

Article Title: FKBP10 functioned as a cancer‐promoting factor mediates cell proliferation, invasion, and migration via regulating PI3K signaling pathway in stomach adenocarcinoma

doi: 10.1002/kjm2.12174

Figure Lengend Snippet: Overexpression of FKBP10 induced the unfavorable prognosis of STAD. A, Data from TCGA database containing 32 normal cases and 375 tumor cases, P = 6.67E‐09. B and C, Datasets of Cui gastric and DErrico gastric cohorts from Oncomine. The horizontal line represents the medians. D, Data from GEPIA database. Red column is STAD samples (n = 408), and gray column stands for normal group (n = 36). E, High expression of FKBP10 is connected with a poor overall survival in STAD patients. Kaplan‐Meier curves of overall survival were plotted based on GEPIA, P = .013. F, Relative expression of FKBP10 in four cell lines, ** P < .01. STAD, stomach adenocarcinoma

Article Snippet: Two small interfering RNAs (siRNAs) targeting FKBP10 (si‐FKBP10) and a negative control (si‐con) were purchased form Genepharma (Shanghai, China) with the sequences as follows: si‐FKBP10#1:5′‐CCACACCTACAATACCTATAT‐3′; si‐FKBP10#2:5′‐CCACTACAATGGCTCCTTGAT‐3′; si‐con: 5’‐TTCTCCGAACGTGTCACGT‐3′.

Techniques: Over Expression, Expressing

Journal: The Kaohsiung Journal of Medical Sciences

Article Title: FKBP10 functioned as a cancer‐promoting factor mediates cell proliferation, invasion, and migration via regulating PI3K signaling pathway in stomach adenocarcinoma

doi: 10.1002/kjm2.12174

Figure Lengend Snippet: Knockdown of FKBP10 inhibited the proliferation and colony formation of AGS cells. A, The mRNA expression level of FKBP10 were examined using RT‐qPCR, ** P < .01. B and C, The protein expression level of FKBP10 in AGS cells was investigated using western blot, ** P < .01. D, Down‐regulation of FKBP10 inhibited the AGS cell viability as determined by a MTT assay. E and F, FKBP10 knockdown suppressed colony formation of AGS cells examined by colony formation assay, ** P < .01

Article Snippet: Two small interfering RNAs (siRNAs) targeting FKBP10 (si‐FKBP10) and a negative control (si‐con) were purchased form Genepharma (Shanghai, China) with the sequences as follows: si‐FKBP10#1:5′‐CCACACCTACAATACCTATAT‐3′; si‐FKBP10#2:5′‐CCACTACAATGGCTCCTTGAT‐3′; si‐con: 5’‐TTCTCCGAACGTGTCACGT‐3′.

Techniques: Knockdown, Expressing, Quantitative RT-PCR, Western Blot, MTT Assay, Colony Assay

Journal: The Kaohsiung Journal of Medical Sciences

Article Title: FKBP10 functioned as a cancer‐promoting factor mediates cell proliferation, invasion, and migration via regulating PI3K signaling pathway in stomach adenocarcinoma

doi: 10.1002/kjm2.12174

Figure Lengend Snippet: FKBP10 knockdown blocked the migration and invasion ability of AGS cells. A and B, Transwell assay was implemented to investigate the migratory and invasive prosperities of AGS cells with or without si‐FKBP10, ** P < .01

Article Snippet: Two small interfering RNAs (siRNAs) targeting FKBP10 (si‐FKBP10) and a negative control (si‐con) were purchased form Genepharma (Shanghai, China) with the sequences as follows: si‐FKBP10#1:5′‐CCACACCTACAATACCTATAT‐3′; si‐FKBP10#2:5′‐CCACTACAATGGCTCCTTGAT‐3′; si‐con: 5’‐TTCTCCGAACGTGTCACGT‐3′.

Techniques: Knockdown, Migration, Transwell Assay

Journal: The Kaohsiung Journal of Medical Sciences

Article Title: FKBP10 functioned as a cancer‐promoting factor mediates cell proliferation, invasion, and migration via regulating PI3K signaling pathway in stomach adenocarcinoma

doi: 10.1002/kjm2.12174

Figure Lengend Snippet: Western blotting was used to determine the expression levels of PI3K, p‐PI3K, AKT, and p‐AKT in AGS cells after FKBP10 knockdown. GAPDH was utilized to be as internal reference, ** P < .01

Article Snippet: Two small interfering RNAs (siRNAs) targeting FKBP10 (si‐FKBP10) and a negative control (si‐con) were purchased form Genepharma (Shanghai, China) with the sequences as follows: si‐FKBP10#1:5′‐CCACACCTACAATACCTATAT‐3′; si‐FKBP10#2:5′‐CCACTACAATGGCTCCTTGAT‐3′; si‐con: 5’‐TTCTCCGAACGTGTCACGT‐3′.

Techniques: Western Blot, Expressing, Knockdown

Journal: Human Genetics

Article Title: Collagen transport and related pathways in Osteogenesis Imperfecta

doi: 10.1007/s00439-021-02302-2

Figure Lengend Snippet: Sillence Classification expanded to OI type V and atypical OI associated with phenotypes and inheritance pattern of OI causative genes up to date (Van Dijk and Sillence 2014 )

Article Snippet: FKBP10 mutations do not reciprocate this effect on HSP47 (Duran et al. ).

Techniques:

Journal: Human Genetics

Article Title: Collagen transport and related pathways in Osteogenesis Imperfecta

doi: 10.1007/s00439-021-02302-2

Figure Lengend Snippet: KDEL motif-containing proteins implicated in collagen biosynthesis

Article Snippet: FKBP10 mutations do not reciprocate this effect on HSP47 (Duran et al. ).

Techniques: