Journal: International Journal of Molecular Sciences

Article Title: Insights into FGFR4 (rs351855 and rs7708357) Gene Variants, Ki-67 and p53 in Pituitary Adenoma Pathophysiology

doi: 10.3390/ijms26157565

Figure Lengend Snippet: Serum FGFR4 levels in patients with PA and the reference group.

Article Snippet: The specific TaqMan ® SNV Genotyping Assays used for each SNV are detailed below: rs351855 C___3166614_10; Sequence [VIC/FAM]: CTTGGCTGTGCTCCTGCTGCTGGCC[A/G]GGCTGTATCGAGGGCAGGCGCTCCA rs7708357 C__11270571_20; Sequence [VIC/FAM]: TTGCATTGCTACCCAGATGCTGCTG[A/G]TCTGGGGAAGGAGTGGGGGTCACAC.

Techniques:

Journal: International Journal of Molecular Sciences

Article Title: Insights into FGFR4 (rs351855 and rs7708357) Gene Variants, Ki-67 and p53 in Pituitary Adenoma Pathophysiology

doi: 10.3390/ijms26157565

Figure Lengend Snippet: Association of FGFR4 rs351855 genotype with the p53 H-score in PA patients. Boxplots illustrate the distribution of p53 H-scores across GG, GA, and AA genotypes. The median, interquartile range (IQR), and whiskers representing minimum and maximum values are shown.

Article Snippet: The specific TaqMan ® SNV Genotyping Assays used for each SNV are detailed below: rs351855 C___3166614_10; Sequence [VIC/FAM]: CTTGGCTGTGCTCCTGCTGCTGGCC[A/G]GGCTGTATCGAGGGCAGGCGCTCCA rs7708357 C__11270571_20; Sequence [VIC/FAM]: TTGCATTGCTACCCAGATGCTGCTG[A/G]TCTGGGGAAGGAGTGGGGGTCACAC.

Techniques:

Journal: International Journal of Molecular Sciences

Article Title: Insights into FGFR4 (rs351855 and rs7708357) Gene Variants, Ki-67 and p53 in Pituitary Adenoma Pathophysiology

doi: 10.3390/ijms26157565

Figure Lengend Snippet: Associations of FGFR4 rs7708357 genotype with the p53 H-score in PA patients. Boxplots illustrate the distribution of p53 H-scores across GG, GA, and AA genotypes. The median, interquartile range (IQR), and whiskers representing minimum and maximum values are shown.

Article Snippet: The specific TaqMan ® SNV Genotyping Assays used for each SNV are detailed below: rs351855 C___3166614_10; Sequence [VIC/FAM]: CTTGGCTGTGCTCCTGCTGCTGGCC[A/G]GGCTGTATCGAGGGCAGGCGCTCCA rs7708357 C__11270571_20; Sequence [VIC/FAM]: TTGCATTGCTACCCAGATGCTGCTG[A/G]TCTGGGGAAGGAGTGGGGGTCACAC.

Techniques:

Journal: Molecular Cancer

Article Title: Klotho-beta overexpression as a novel target for suppressing proliferation and fibroblast growth factor receptor-4 signaling in hepatocellular carcinoma

doi: 10.1186/1476-4598-11-14

Figure Lengend Snippet: KLB mediates FGFR4 downstream signaling and phosphorylation of pro-survival proteins . 72 h post-transfection with siRNA, Huh7 cells were lysed, resolved with 7.5% SDS-PAGE and immunoblotted using the indicated antibodies. Results are indicative of two independent experiments.

Article Snippet: To establish stable FGFR4 knockdown clones, Huh7 cells were transfected with pRS vector control (TR20003, Origene Technologies, Rockville, MD) and FGFR4-specific HuSH 29mer shRNA constructs (TR320356, Origene) and selected with 2 μg/mL puromycin (Sigma) for at least 14 days as previously described [ ].

Techniques: Transfection, SDS Page

Journal: Molecular Cancer

Article Title: Klotho-beta overexpression as a novel target for suppressing proliferation and fibroblast growth factor receptor-4 signaling in hepatocellular carcinoma

doi: 10.1186/1476-4598-11-14

Figure Lengend Snippet: Silencing of KLB or FGFR4 increases expression of liver stemness genes . (A) 48 h post siRNA silencing of KLB or FGFR4 in Huh7 cells, AFP gene expression was determined by qRT-PCR. Data indicates fold change in gene expression normalized to scrambled siRNA. Error bars represent SD converted to fold changes. (B) After 72 h, AFP protein expression was also determined using polyclonal anti-AFP antibodies, normalized to β-actin as loading control. (C) CD133 and CD44 expression after KLB-silencing was subsequently determined as described for (A). (D) The effect of the silencing on CD133 protein expression was performed using anti-CD133 antibody. (E) CD133 and CD44 mRNA levels were measured in Huh7 stable clones expressing control shRNA and FGFR4 shRNA after normalizing to GAPDH.

Article Snippet: To establish stable FGFR4 knockdown clones, Huh7 cells were transfected with pRS vector control (TR20003, Origene Technologies, Rockville, MD) and FGFR4-specific HuSH 29mer shRNA constructs (TR320356, Origene) and selected with 2 μg/mL puromycin (Sigma) for at least 14 days as previously described [ ].

Techniques: Expressing, Quantitative RT-PCR, Clone Assay, shRNA

Journal: Molecular Cancer

Article Title: Klotho-beta overexpression as a novel target for suppressing proliferation and fibroblast growth factor receptor-4 signaling in hepatocellular carcinoma

doi: 10.1186/1476-4598-11-14

Figure Lengend Snippet: CD133 and CD44 expression are upregulated in PD173074-resistant cells . Resistant Huh7 cells were generated by culturing in sub-lethal concentrations of PD173074 (0.1 μM - 1.0 μM). After eight weeks, (A) CD133 and (B) CD44 mRNA expression were analyzed by qRT-PCR. Results are indicated with SD converted to fold changes as error bars. The differences were statistically significant ( P < 0.001 by one-way ANOVA, P < 0.05 by Tukey's multiple comparison test). (C) CD133 protein expression was determined by immunoblotting and normalized to β-actin. (D) Long term effect of PD173074 treatment on FGFR4 and KLB protein expression were determined by immunoblot assays. For (C) and (D), the respective relative protein levels were calculated relative to DMSO control after normalizing the protein band density to that of the loading control.

Article Snippet: To establish stable FGFR4 knockdown clones, Huh7 cells were transfected with pRS vector control (TR20003, Origene Technologies, Rockville, MD) and FGFR4-specific HuSH 29mer shRNA constructs (TR320356, Origene) and selected with 2 μg/mL puromycin (Sigma) for at least 14 days as previously described [ ].

Techniques: Expressing, Generated, Quantitative RT-PCR, Western Blot

Journal: PLoS ONE

Article Title: Targeting Wild-Type and Mutationally Activated FGFR4 in Rhabdomyosarcoma with the Inhibitor Ponatinib (AP24534)

doi: 10.1371/journal.pone.0076551

Figure Lengend Snippet: (A) The sensitivity of a panel of six fusion-positive RMS cell lines (RH4, RH28, JR, RH41, RH5, and RH30) and eight fusion-negative RMS cell lines (BIRCH, RH18, TTC-442, CT-10, CTR, TTC-516, RD, and RH36) to ponatinib is correlated to FGFR4 mRNA expression levels by Spearman ranking (p = 0.0261). (B) Comparing the variation in IC 50 values of fusion-positive (FP) and fusion-negative (FN) RMS cell lines shows a significant difference by F test (p = 0.0125). (C) A difference in IC 50 values can be seen between RMS cell lines expressing low (below a relative level of 6) and high (above a relative level of 6) levels of FGFR4 (p = 0.0344).

Article Snippet: For FGFR4 autophosphorylation immunoblots, 200–500 μg of protein lysate, as determined by BCA protein assay (Pierce), was first immunoprecipitated with a FGFR4 antibody (sc-124; Santa Cruz Biotechnology) and then incubated overnight with protein A/G agarose beads.

Techniques: Expressing

Journal: PLoS ONE

Article Title: Targeting Wild-Type and Mutationally Activated FGFR4 in Rhabdomyosarcoma with the Inhibitor Ponatinib (AP24534)

doi: 10.1371/journal.pone.0076551

Figure Lengend Snippet: RMS772 cell harboring activating FGFR4 mutations V550E or N535K are more sensitive to ponatinib (AP24534) after 24 hour treatment than RMS772 cells expressing wild-type (WT) FGFR4 or the empty vector (VCtrl) (*p = <0.0001, **p = <0.0001).

Article Snippet: For FGFR4 autophosphorylation immunoblots, 200–500 μg of protein lysate, as determined by BCA protein assay (Pierce), was first immunoprecipitated with a FGFR4 antibody (sc-124; Santa Cruz Biotechnology) and then incubated overnight with protein A/G agarose beads.

Techniques: Expressing, Plasmid Preparation

Journal: PLoS ONE

Article Title: Targeting Wild-Type and Mutationally Activated FGFR4 in Rhabdomyosarcoma with the Inhibitor Ponatinib (AP24534)

doi: 10.1371/journal.pone.0076551

Figure Lengend Snippet: (A) Cell cycle analysis of the two most sensitive cell lines to ponatinib, RH4 and RH5, and the two RMS772 cell lines expressing FGFR4 mutations (N535K and V550E) showed increased time in sub G 1 phase and decreased time in S phase across all four cell lines after 24 hours of treatment with 2.5 µM ponatinib. (B) Cell death induced by 2.5 µM ponatinib treatment is mediated via the caspase 3/7 pathway (*p = 0.0029, **p = 0.0027, ***p = 0.0017, ****p = 0.0001).

Article Snippet: For FGFR4 autophosphorylation immunoblots, 200–500 μg of protein lysate, as determined by BCA protein assay (Pierce), was first immunoprecipitated with a FGFR4 antibody (sc-124; Santa Cruz Biotechnology) and then incubated overnight with protein A/G agarose beads.

Techniques: Cell Cycle Assay, Expressing

Journal: PLoS ONE

Article Title: Targeting Wild-Type and Mutationally Activated FGFR4 in Rhabdomyosarcoma with the Inhibitor Ponatinib (AP24534)

doi: 10.1371/journal.pone.0076551

Figure Lengend Snippet: (A) A dose-dependent decrease in wild-type FGFR4 phosphorylation as shown by immunoprecipitation of FGFR4 and immunoblotting for phosphotyrosine. (B) A similar dose-dependent inhibition is seen for FGFR4 with the V550E and N535K mutation. (C-D) Western blot shows a dose-dependent decrease in STAT3 phosphorylation after treatment with ponatinib for three fusion-positive (RH4, RH5, and RH41) and one fusion-negative (CTR) RMS cell lines as well as the two RMS772 cell lines expressing the FGFR4 mutations N535K and V550E.

Article Snippet: For FGFR4 autophosphorylation immunoblots, 200–500 μg of protein lysate, as determined by BCA protein assay (Pierce), was first immunoprecipitated with a FGFR4 antibody (sc-124; Santa Cruz Biotechnology) and then incubated overnight with protein A/G agarose beads.

Techniques: Phospho-proteomics, Immunoprecipitation, Western Blot, Inhibition, Mutagenesis, Expressing

Journal: PLoS ONE

Article Title: Targeting Wild-Type and Mutationally Activated FGFR4 in Rhabdomyosarcoma with the Inhibitor Ponatinib (AP24534)

doi: 10.1371/journal.pone.0076551

Figure Lengend Snippet: Arrow indicates the start of treatment. (A) Treatment of tumors harboring the FGFR4 N535K mutation with ponatinib significantly inhibits tumor growth after 10 days of treatment (*p = 0.0165, **p = 0.0048). (B) Treatment of tumors containing the FGFR4 V550E mutation with ponatinib significantly inhibits tumor growth after 6 days of treatment (*p = 0.0185, **p = 0.0087, ***p = 0.0005). (C) Treatment of tumors expressing the wild-type FGFR4 with ponatinib does not affect tumor growth. (D) Treatment of tumors expressing the empty vector with ponatinib does not affect tumor growth.

Article Snippet: For FGFR4 autophosphorylation immunoblots, 200–500 μg of protein lysate, as determined by BCA protein assay (Pierce), was first immunoprecipitated with a FGFR4 antibody (sc-124; Santa Cruz Biotechnology) and then incubated overnight with protein A/G agarose beads.

Techniques: Mutagenesis, Expressing, Plasmid Preparation

Journal: Cell Death and Differentiation

Article Title: FGFR4 phosphorylates MST1 to confer breast cancer cells resistance to MST1/2-dependent apoptosis

doi: 10.1038/s41418-019-0321-x

Figure Lengend Snippet: FGFR4 suppresses MST1/2 activation and nuclear localization in cancer cell spheres. a shScr and shFGFR4 MDA-MB-453 cell spheres were cultured under non-adherent conditions (10% or 2% FBS), and subjected to immunoblotting. Arrowhead; cleaved N-terminal MST1/2 (in 2% FBS), brackets highlight the fragments of autoactivated MST1/2. b MDA-MB-453 cell spheres were treated with 100 n m BLU9931 for 15 min, and subjected to immunoblotting. c , d shScr and shFGFR4 MDA-MB-453 and ZR-75.1 spheres were analyzed for MST1 expression by c immunofluorescence, and d MST1 nuclear/cytoplasmic ratio was quantified ( n = 4–6 MDA-MB-453 spheres, ≥ 6 microscopic fields/sphere; n = 2–3 ZR-75.1 spheres, ≥ 8 microscopic fields/ sphere; mean ± SEM of two independent experiments. Scale bar 10 µm. e shScr and shFGFR4 MDA-MB-453 cells were transfected with indicated siRNAs before sphere formation, cultured under non-adherent conditions (1% FBS) for 48 h, and subjected to immunoblotting

Article Snippet: Rabbit polyclonal antibodies against FGFR4 (sc-124; Santa Cruz), phospho-FGFR4 (pY642; CSB-PA008250, Cusabio Technology, Houston, TX, USA) and phospho-FRS2-α (pY196; 3864), MST1 (3682), MST2 (3952), phospho-p44/42 MAPK (phospho-Erk1/2) (pT202/pY204; 9101), phospho-AKT (pS473; 9271), phospho-MST1/2 (pT183/pT180; 3681), phospho-YAP (pS127; 4911) all from Cell Signaling Technology, V5-tag (ab9116; Abcam), and horseradish peroxidase–conjugated secondary antibodies (P044701 and P044801, Dako, Santa Clara, CA, USA) for enhanced chemiluminescence detection of immunoblots.

Techniques: Activation Assay, Cell Culture, Western Blot, Expressing, Immunofluorescence, Transfection

Journal: Cell Death and Differentiation

Article Title: FGFR4 phosphorylates MST1 to confer breast cancer cells resistance to MST1/2-dependent apoptosis

doi: 10.1038/s41418-019-0321-x

Figure Lengend Snippet: MST1-Y433F phosphosite mutant restores MST1/2 activation in FGFR4 expressing cancer cells. a MDA-MB-231 cells co-transfected with FGFR4 (R) and wild-type or phosphosite mutant MST1-Y433F were subjected to immunoblotting as indicated. Ratio of pMOB1/MOB1 is indicated below the immunoblot panel. b T47D cells (co-)transfected with wild-type or MST1-Y433F alone or with FGFR4 (R) were treated with 1 µ m okadaic acid for 1 h before cell lysis, and subjected to immunoblotting. See corresponding T47D immunoblots without okadaic acid in Fig. S4C. c T47D cells with indicated siRNAs, and (co-)transfected with wild-type or MST1-Y433F alone or with FGFR4 (R) were treated with 1 µ m okadaic acid as above, and subjected to immunoblotting. a–c Brackets and arrowhead indicate the activated pMST1/2 fragments. N = 2 independent repeats

Article Snippet: Rabbit polyclonal antibodies against FGFR4 (sc-124; Santa Cruz), phospho-FGFR4 (pY642; CSB-PA008250, Cusabio Technology, Houston, TX, USA) and phospho-FRS2-α (pY196; 3864), MST1 (3682), MST2 (3952), phospho-p44/42 MAPK (phospho-Erk1/2) (pT202/pY204; 9101), phospho-AKT (pS473; 9271), phospho-MST1/2 (pT183/pT180; 3681), phospho-YAP (pS127; 4911) all from Cell Signaling Technology, V5-tag (ab9116; Abcam), and horseradish peroxidase–conjugated secondary antibodies (P044701 and P044801, Dako, Santa Clara, CA, USA) for enhanced chemiluminescence detection of immunoblots.

Techniques: Phospho-proteomics, Mutagenesis, Activation Assay, Expressing, Transfection, Western Blot, Lysis

Journal: Cell Death and Differentiation

Article Title: FGFR4 phosphorylates MST1 to confer breast cancer cells resistance to MST1/2-dependent apoptosis

doi: 10.1038/s41418-019-0321-x

Figure Lengend Snippet: FGFR4 substrate screen identifies tyrosine-phosphorylated Hippo pathway proteins including MST1/2. a Scheme of the substrate screen with recombinant FGFR4 kinase domain. b Top 10 FGFR4 substrates ranked by the Z-score include Hippo pathway -associated proteins (yellow). See Table S1 for the full substrate list. c , d MST1/2 are tyrosine phosphorylated by FGFR4 in COS-1 cells. Flag-tagged MST1/2 were immunoprecipitated after transfection of MST1 and MST2 alone or in combination with FGFR4 G388 (G), or R388 (R) kinase (wt), or kinase-dead (KD) variants, and detected by immunoblotting. e MST1 immunoprecipitates from COS-1 cells co-transfected with FGFR4 (R)-wt or FGFR4 (R)-KD (See Fig. S1A) were trypsin digested and subjected to phoshopeptide enrichment prior to LC-MS/MS analysis ( N = 3) that identified phosphorylated Y433 (red) on MST1 only with FGFR4 (R)-wt, and phosphorylated S410 (green) only with FGFR4 (R)-KD

Article Snippet: Rabbit polyclonal antibodies against FGFR4 (sc-124; Santa Cruz), phospho-FGFR4 (pY642; CSB-PA008250, Cusabio Technology, Houston, TX, USA) and phospho-FRS2-α (pY196; 3864), MST1 (3682), MST2 (3952), phospho-p44/42 MAPK (phospho-Erk1/2) (pT202/pY204; 9101), phospho-AKT (pS473; 9271), phospho-MST1/2 (pT183/pT180; 3681), phospho-YAP (pS127; 4911) all from Cell Signaling Technology, V5-tag (ab9116; Abcam), and horseradish peroxidase–conjugated secondary antibodies (P044701 and P044801, Dako, Santa Clara, CA, USA) for enhanced chemiluminescence detection of immunoblots.

Techniques: Recombinant, Immunoprecipitation, Transfection, Western Blot, Liquid Chromatography with Mass Spectroscopy

Journal: Cell Death and Differentiation

Article Title: FGFR4 phosphorylates MST1 to confer breast cancer cells resistance to MST1/2-dependent apoptosis

doi: 10.1038/s41418-019-0321-x

Figure Lengend Snippet: List of MST1 phoshopeptides identified by mass spectrometry

Article Snippet: Rabbit polyclonal antibodies against FGFR4 (sc-124; Santa Cruz), phospho-FGFR4 (pY642; CSB-PA008250, Cusabio Technology, Houston, TX, USA) and phospho-FRS2-α (pY196; 3864), MST1 (3682), MST2 (3952), phospho-p44/42 MAPK (phospho-Erk1/2) (pT202/pY204; 9101), phospho-AKT (pS473; 9271), phospho-MST1/2 (pT183/pT180; 3681), phospho-YAP (pS127; 4911) all from Cell Signaling Technology, V5-tag (ab9116; Abcam), and horseradish peroxidase–conjugated secondary antibodies (P044701 and P044801, Dako, Santa Clara, CA, USA) for enhanced chemiluminescence detection of immunoblots.

Techniques: Sequencing

Journal: Cell Death and Differentiation

Article Title: FGFR4 phosphorylates MST1 to confer breast cancer cells resistance to MST1/2-dependent apoptosis

doi: 10.1038/s41418-019-0321-x

Figure Lengend Snippet: FGFR4 is overexpressed in HER2 + , MST1/2 low breast cancer cells. a , b FGFR4 and HER2 expression in luminal MDA-MB-453, ZR-75.1, and BT474, MCF7, and T47D, and five triple-negative breast cancer cell lines by a immunoblotting and b immunofluorescence. Scale bar 20 μm. c MST1, MST2, and YAP/TAZ expression in these cell lines, detected by immunoblotting ( N = 3)

Article Snippet: Rabbit polyclonal antibodies against FGFR4 (sc-124; Santa Cruz), phospho-FGFR4 (pY642; CSB-PA008250, Cusabio Technology, Houston, TX, USA) and phospho-FRS2-α (pY196; 3864), MST1 (3682), MST2 (3952), phospho-p44/42 MAPK (phospho-Erk1/2) (pT202/pY204; 9101), phospho-AKT (pS473; 9271), phospho-MST1/2 (pT183/pT180; 3681), phospho-YAP (pS127; 4911) all from Cell Signaling Technology, V5-tag (ab9116; Abcam), and horseradish peroxidase–conjugated secondary antibodies (P044701 and P044801, Dako, Santa Clara, CA, USA) for enhanced chemiluminescence detection of immunoblots.

Techniques: Expressing, Western Blot, Immunofluorescence

Journal: Cell Death and Differentiation

Article Title: FGFR4 phosphorylates MST1 to confer breast cancer cells resistance to MST1/2-dependent apoptosis

doi: 10.1038/s41418-019-0321-x

Figure Lengend Snippet: FGFR4 suppresses MST1/2 activation and cleavage in HER2 + breast cancer cells. a , b MDA-MB-453 cells transfected with indicated siRNAs were subjected to immunoblotting for a T183/180 phosphorylated MST1/2, and b MST1 and MST2. Note cleaved ~ 37 kDa MST1/N in FGFR4 knockdown cells (arrowhead). Thin gray line indicates cropping to leave out irrelevant sample lane; see uncropped immunoblots in Fig. S8. c MDA-MB-453 cells transduced with indicated shRNAs were transfected with siScr or siFGFR4 siRNA to 3’UTR before transfection of mock or FGFR4 (R) or (G) overexpression plasmid for a rescue experiment. Lysates were subjected to immunoblotting as indicated. Brackets indicate the cleaved MST1 and MST2 fragments. See Fig. S2A for phopsho-FRS2α and short exposure of MST1. d MDA-MB-453 and ZR-75.1 cells were transduced with indicated si/shRNAs; upper, indicated immunoblots of lysates; lower, quantification of pMOB1/MOB1 ratio, N = 3, mean ± SEM; * P < 0.05. For MST1/2 knockdown e ZR-75.1 and f MDA-MB-453 were transduced with shRNAs followed by transfection with siRNAs as indicated, and g BT474 cells were transfected with indicated siRNAs, and subjected to immunoblotting for pT183/180 MST1/2, MST1, MST2, and pMOB1 as indicated (in e arrowhead points to a full-length, bracket to the cleaved MST2) a–g . N = 3 independent repeats for all; except N = 2 in f and g

Article Snippet: Rabbit polyclonal antibodies against FGFR4 (sc-124; Santa Cruz), phospho-FGFR4 (pY642; CSB-PA008250, Cusabio Technology, Houston, TX, USA) and phospho-FRS2-α (pY196; 3864), MST1 (3682), MST2 (3952), phospho-p44/42 MAPK (phospho-Erk1/2) (pT202/pY204; 9101), phospho-AKT (pS473; 9271), phospho-MST1/2 (pT183/pT180; 3681), phospho-YAP (pS127; 4911) all from Cell Signaling Technology, V5-tag (ab9116; Abcam), and horseradish peroxidase–conjugated secondary antibodies (P044701 and P044801, Dako, Santa Clara, CA, USA) for enhanced chemiluminescence detection of immunoblots.

Techniques: Activation Assay, Transfection, Western Blot, Knockdown, Transduction, Over Expression, Plasmid Preparation

Journal: Cell Death and Differentiation

Article Title: FGFR4 phosphorylates MST1 to confer breast cancer cells resistance to MST1/2-dependent apoptosis

doi: 10.1038/s41418-019-0321-x

Figure Lengend Snippet: FGFR4 counteracts MST1/2-mediated apoptosis. MDA-MB-453 cells transduced with shScr or shFGFR4 shRNAs were transfected with siRNA pools specific for FGFR4, MST1 or MST2, and analyzed for annexin V and propidium iodide (PI) binding by flow cytometry using two different gating strategies for data visualization. a Gating to populations P1 (smaller) and P2 (larger), and annexin V binding (FL1-A) histograms as a marker for early apoptotic cells. b Quantification (% of total, 100,000 events) of apoptosis based on double-positive (annexin V + PI) cells, including both early and late apoptotic stages. See Fig. S3B for representative contour plots and quadrant gating. Mean ± SD of triplicates shown, ** P < 0.01; (repeated three times; N = 3). FSC-A; forward scatter, and SSC-A; side scatter

Article Snippet: Rabbit polyclonal antibodies against FGFR4 (sc-124; Santa Cruz), phospho-FGFR4 (pY642; CSB-PA008250, Cusabio Technology, Houston, TX, USA) and phospho-FRS2-α (pY196; 3864), MST1 (3682), MST2 (3952), phospho-p44/42 MAPK (phospho-Erk1/2) (pT202/pY204; 9101), phospho-AKT (pS473; 9271), phospho-MST1/2 (pT183/pT180; 3681), phospho-YAP (pS127; 4911) all from Cell Signaling Technology, V5-tag (ab9116; Abcam), and horseradish peroxidase–conjugated secondary antibodies (P044701 and P044801, Dako, Santa Clara, CA, USA) for enhanced chemiluminescence detection of immunoblots.

Techniques: Transduction, Transfection, Binding Assay, Flow Cytometry, Marker

Journal: Cell Death and Differentiation

Article Title: FGFR4 phosphorylates MST1 to confer breast cancer cells resistance to MST1/2-dependent apoptosis

doi: 10.1038/s41418-019-0321-x

Figure Lengend Snippet: FGFR4 confers resistance to apoptotic modulators in comprehensive drug screen. a (Phospho)protein changes in TCGA RPPA data associated with FGFR4 upregulation in breast cancer, visualized using cBioPortal (RPPA score change in breast cancer tumors with and without alterations in FGFR4; (mean FGFR4 altered – mean FGFR4 unaltered) [ , ]. The most significantly up- and downregulated proteins are highlighted (pink dots); ERBB2, alternative name of HER2; PR, progesterone receptor. b–g Fibrin embedded single-cell suspensions of b–d MDA-MB-453 and e–g ZR-75.1 cells were treated with 100 n m BLU9931 and/or 30 ng/ml FGF1 over a 13–14-day culture, fixed, embedded into paraffin for sectioning, and subjected to immunohistochemistry for Ki67 and BAX expression. Positively stained vs. total number of cells per colony were counted ( N = 30, mean ± SD, ** P < 0.01). Scale bar 50 µm in b and e . b For comprehensive drug sensitivity testing ( N = 1), MDA-MB-453 cells were treated with 527 compounds in five-point dose either alone or in combination with specific FGFR4 inhibitor BLU9931. Dotplot showing the difference in DSS (drug sensitivity score) for cells in treatment combination with BLU9931 (100 n m ) versus single agent treatments. Negative values are compounds inducing larger decreases in viability as single agents; positive scores indicate compounds yielding larger decreases in viability in the presence of BLU9931. Colors demarcate compounds with similar class

Article Snippet: Rabbit polyclonal antibodies against FGFR4 (sc-124; Santa Cruz), phospho-FGFR4 (pY642; CSB-PA008250, Cusabio Technology, Houston, TX, USA) and phospho-FRS2-α (pY196; 3864), MST1 (3682), MST2 (3952), phospho-p44/42 MAPK (phospho-Erk1/2) (pT202/pY204; 9101), phospho-AKT (pS473; 9271), phospho-MST1/2 (pT183/pT180; 3681), phospho-YAP (pS127; 4911) all from Cell Signaling Technology, V5-tag (ab9116; Abcam), and horseradish peroxidase–conjugated secondary antibodies (P044701 and P044801, Dako, Santa Clara, CA, USA) for enhanced chemiluminescence detection of immunoblots.

Techniques: Immunohistochemistry, Expressing, Staining

Journal: Scientific reports

Article Title: Fibroblast Growth Factor Binding Protein 3 (FGFBP3) impacts carbohydrate and lipid metabolism.

doi: 10.1038/s41598-018-34238-5

Figure Lengend Snippet: Figure 5. BP3 binds to endocrine FGFs, enhances FGF19 and FGF21 signal transduction and promotes FGFR4/FGF19 complex formation. (A) Domains and computational structure prediction for BP1 and BP3. The FGF-binding domains in BP1 and BP3 in the C-terminal portion, the heparin-binding domain and the conserved cysteins of BP1 are shown. The white arrows in the 3D model indicate distinct folding of the FGF- binding domains. The PHYRE2 program (http://www.sbg.bio.ic.ac.uk/phyre/) was used68. (B) Binding of MBP-tagged BP1 or BP3 or MBP control to immobilized FGF19 measured by direct ELISA with an anti-MBP antibody. Mean ± SEM of one of three independent experiments done in duplicate (**P < 0.01; ***P < 0.0001). (C) SPR sensorgrams illustrating the binding of BP3 to immobilized FGF19. The concentrations of the BP3 analyte are indicated. RU, response units. (D) Binding of BP3 or MBP control to immobilized FGF15, or FGF23 measured by direct ELISA with an anti-MBP antibody. Mean ± SEM of one of three independent experiments done in duplicate. *P < 0.05 BP3 (black bars) vs. control (white bars). (E,F) Equilibrium binding of BP3 to immobilized FGF2 (E) or FGF19 (F) measured by direct ELISA with an anti-MBP antibody. Mean ± SEM of one of three independent experiments done in duplicate (**P < 0.01; ***P < 0.0001; Two-way ANOVA). (G) Competition of KLB and KLa proteins for binding of BP3 to immobilized FGF19 (left panel) or FGF21 (right panel). Mean ± SEM of one of three independent experiments run in duplicate (*P < 0.05; **P < 0.01 BP3 + KLB (red or blue dot) vs. BP3 + KLa (black diamond); Two-way ANOVA). (H) Schematic representation

Article Snippet: MaxiSorp microtiter plates were coated with 0.75 mg of human recombinant FGFR4 Fc Chimera (R&D Systems) and incubated overnight at 4 °C.

Techniques: Transduction, Binding Assay, Control, Direct ELISA