ezh2 Search Results


93
TargetMol ezh2 inhibitors
Ezh2 Inhibitors, supplied by TargetMol, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ezh2 inhibitors/product/TargetMol
Average 93 stars, based on 1 article reviews
ezh2 inhibitors - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

92
Miltenyi Biotec ezh2
A UMAP plot showing 24 clusters of the integrated scRNA-seq dataset from two control spleen samples (WT) and two PTCL-NOS Smarcb1− tumor samples. B Relative abundance of different cell types in murine WT spleens (left), PTCL spleens (middle), and human tumors (right; NB: in order to ensure comparability, the stromal cells were removed before quantification). The pie charts in the lower part show the ratio between B-cells and myeloid cells. C Multiplex immunofluorescence (IF) images of FFPE sections of murine PTCL-NOS Smarcb1− and control spleen samples (WT: upper panels; tumor: lower panels). For better visualization, the white boxed areas ( a to f ) are enlarged (2.5x; scale bar = 100 µm). DAPI (gray) provides a nuclear counterstain, <t>Ezh2</t> (yellow) defines malignant cells (Ezh2 hi ), B220 (blue) is used as a pan B-cell marker (B220 + ), and Ly6g (pink) as a marker for neutrophils (Ly6g + ). D Quantitative analysis of IF images from ( C ). Four representative regions of interest (ROIs; size: 1500 × 1500 µm) were selected and analyzed for mouse WT and Tumor samples. A Wilcoxon-Mann-Whitney test was calculated to determine if there are differences between WT and Tumor samples for all comparisons (* p = 0.0286). Boxplot settings: middle, median; lower hinge, 25% quantile; upper hinge, 75% quantile; upper/lower whisker, largest/smallest observation less/greater than or equal to upper/lower hinge ±1.5 * IQR. E The heatmap shows the overlap between cluster-specific DEG lists and the cancer hallmark metaprograms. F Signature plots of the programs Cycling, MYC, EMT and Stress in cells from WT (left) and tumor (right) samples. G A split violin plot (left/gray half: WT; right/black half: tumor) illustrates the increase in T-cell exhaustion features (Exhaust.) with a simultaneous decrease in NK cytotoxicity (Cytotox.) markers (e.g., Ncr1/NKp46) as well as infiltration of immunosuppressive myeloid cells in tumor versus WT samples. Source data of B and D are provided as a Source Data file. B Created with BioRender.com released under a Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International license.
Ezh2, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ezh2/product/Miltenyi Biotec
Average 92 stars, based on 1 article reviews
ezh2 - by Bioz Stars, 2026-05
92/100 stars
  Buy from Supplier

95
Cell Signaling Technology Inc anti ezh2
A UMAP plot showing 24 clusters of the integrated scRNA-seq dataset from two control spleen samples (WT) and two PTCL-NOS Smarcb1− tumor samples. B Relative abundance of different cell types in murine WT spleens (left), PTCL spleens (middle), and human tumors (right; NB: in order to ensure comparability, the stromal cells were removed before quantification). The pie charts in the lower part show the ratio between B-cells and myeloid cells. C Multiplex immunofluorescence (IF) images of FFPE sections of murine PTCL-NOS Smarcb1− and control spleen samples (WT: upper panels; tumor: lower panels). For better visualization, the white boxed areas ( a to f ) are enlarged (2.5x; scale bar = 100 µm). DAPI (gray) provides a nuclear counterstain, <t>Ezh2</t> (yellow) defines malignant cells (Ezh2 hi ), B220 (blue) is used as a pan B-cell marker (B220 + ), and Ly6g (pink) as a marker for neutrophils (Ly6g + ). D Quantitative analysis of IF images from ( C ). Four representative regions of interest (ROIs; size: 1500 × 1500 µm) were selected and analyzed for mouse WT and Tumor samples. A Wilcoxon-Mann-Whitney test was calculated to determine if there are differences between WT and Tumor samples for all comparisons (* p = 0.0286). Boxplot settings: middle, median; lower hinge, 25% quantile; upper hinge, 75% quantile; upper/lower whisker, largest/smallest observation less/greater than or equal to upper/lower hinge ±1.5 * IQR. E The heatmap shows the overlap between cluster-specific DEG lists and the cancer hallmark metaprograms. F Signature plots of the programs Cycling, MYC, EMT and Stress in cells from WT (left) and tumor (right) samples. G A split violin plot (left/gray half: WT; right/black half: tumor) illustrates the increase in T-cell exhaustion features (Exhaust.) with a simultaneous decrease in NK cytotoxicity (Cytotox.) markers (e.g., Ncr1/NKp46) as well as infiltration of immunosuppressive myeloid cells in tumor versus WT samples. Source data of B and D are provided as a Source Data file. B Created with BioRender.com released under a Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International license.
Anti Ezh2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti ezh2/product/Cell Signaling Technology Inc
Average 95 stars, based on 1 article reviews
anti ezh2 - by Bioz Stars, 2026-05
95/100 stars
  Buy from Supplier

96
Cell Signaling Technology Inc ezh2
Expression of <t>EZH2</t> and podocyte injury were enhanced in db/db mice. ( A - B ) Representative images and quantitative analysis of immunohistochemistry staining of EZH2 in the glomeruli of human renal samples (40×). Scale bar = 50 μm. * P < 0.05 vs. control group ( n = 10). ( C ) Correlation analysis between estimated glomerular filtration rate (eGFR) and the expression of EZH2 in DN patients. ( D - E ) Urinary albumin/creatine ratios (uACRs) and blood glucose levels measured in each group. P values vs. db/m group ( n = 6). ( F ) Representative images of periodic acid-Schiff (PAS) staining revealing glomerular alterations in each group (40×). Scale bar = 20 μm. ( G ) Micrographs of podocyte foot processes (green arrows), podocyte foot process effacement and fusion (red arrows) and glomerular basement membrane (GBM, blue arrows) observed by transmission electron microscopy (TEM) in each group. Scale bar = 500 nm. ( H ) Quantification of the number of foot processes in different groups of mice. P values vs. db/m group ( n = 6). ( I - K ) Illustrative confocal microscopic images and quantifications of podocin (green) and B7-1 (red) in each group. Scale bar = 20 μm. P values vs. db/m group ( n = 6). (L-M) Western blotting and quantitative analysis of EZH2, nephrin, podocin, and B7-1 levels in isolated glomeruli in each group. Histone 3 (H3) and β-actin served as loading controls. P values vs. db/m group ( n = 6). CON, control; DN, diabetic nephropathy
Ezh2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ezh2/product/Cell Signaling Technology Inc
Average 96 stars, based on 1 article reviews
ezh2 - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

93
Cyagen Biosciences mouse ezh2 locus
Figure 3. SETD2 Loss Aggravates PCa Progression through <t>EZH2</t> Upregulation (A) Volcano plots showing the differentially expressed genes between the indicated organoids generated from 3-month-old mice. The represented genes are listed. (B) Heatmap summarizing the qRT-PCR results in organoids generated from 3-month-old mice. The expression was normalized to the mean level of each gene in Pten+/ cells. (C) IHC for the indicated proteins in 6-month-old mice prostates. Scale bar, 50 mm. (D) IB analysis of C4-2 cells in control and SETD2 KD cells with CHX treatment as indicated, and the graph represents the quantification of EZH2 protein levels relative to b-actin level from three independent experiments. Gray dot line indicates the half-life of EZH2 levels in control cells. Data are presented as mean ± SEM and analyzed by two-way ANOVA followed by multiple comparison. **p < 0.01. (E) Heatmap of H3K27me3 signal from 2 kb of transcription start site (TSS) to +2 kb of the transcription end site (TES) of 13,412 genes harboring H3K27me3 peaks in the indicated organoids generated from 3-month-old mice. (F) RNA sequencing and ChIP-seq tracks for H3K27me3 at Cdkn2a and Sox7 gene locus. (G) Heatmap of IHC score (by Pearson’s) between SETD2 and EZH2 in PCa specimens.
Mouse Ezh2 Locus, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse ezh2 locus/product/Cyagen Biosciences
Average 93 stars, based on 1 article reviews
mouse ezh2 locus - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

96
Proteintech ezh2
Identification and validation of miR-101-3p downstream targets. ( a ) Bioinformatics analysis of potential miR-101-3p target genes. ( b , c ) <t>EZH2</t> and MCL1 expression in GC cells transfected with NC mimics or miR-101-3p mimics was analyzed by qRT-PCR (b) and Western blot ( c ). ( d , e ) EZH2 and MCL1 expression in GC cells treated with N-Exo: ( d ) mRNA quantification via qRT-PCR and ( e ) protein analysis by Western blot. ( f ) Western blot analysis of EZH2 and MCL1 protein expression in GC cells treated with NC/101-IN-N-Exo. ( g ) Validation of EZH2 and MCL1 as direct targets of miR-101-3p by dual-luciferase reporter assay. ** n = 3; * P < 0.05, ** P < 0.01, *** P < 0.001
Ezh2, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ezh2/product/Proteintech
Average 96 stars, based on 1 article reviews
ezh2 - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

92
Taconic Biosciences ezh2
FIGURE 1 Combined FGFR and <t>EZH2</t> inhibition reveals strong synergy in BAP1-deficient mesothelioma. A, 3D synergy plots visualizing the synergy
Ezh2, supplied by Taconic Biosciences, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ezh2/product/Taconic Biosciences
Average 92 stars, based on 1 article reviews
ezh2 - by Bioz Stars, 2026-05
92/100 stars
  Buy from Supplier

93
Addgene inc pcdna3 3myc
FIGURE 1 Combined FGFR and <t>EZH2</t> inhibition reveals strong synergy in BAP1-deficient mesothelioma. A, 3D synergy plots visualizing the synergy
Pcdna3 3myc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcdna3 3myc/product/Addgene inc
Average 93 stars, based on 1 article reviews
pcdna3 3myc - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

93
Addgene inc mscv ires ezh2 gfp
FIGURE 1 Combined FGFR and <t>EZH2</t> inhibition reveals strong synergy in BAP1-deficient mesothelioma. A, 3D synergy plots visualizing the synergy
Mscv Ires Ezh2 Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mscv ires ezh2 gfp/product/Addgene inc
Average 93 stars, based on 1 article reviews
mscv ires ezh2 gfp - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

92
Novus Biologicals anti ezh2
FIGURE 1 Combined FGFR and <t>EZH2</t> inhibition reveals strong synergy in BAP1-deficient mesothelioma. A, 3D synergy plots visualizing the synergy
Anti Ezh2, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti ezh2/product/Novus Biologicals
Average 92 stars, based on 1 article reviews
anti ezh2 - by Bioz Stars, 2026-05
92/100 stars
  Buy from Supplier

93
Cell Signaling Technology Inc ubiquitin carboxyl terminal hydrolase d3zn39 usp8
Biochemical validation of <t>USP8,</t> a protein shown to be down-regulated by quantitative proteomics. PSD fractions (15 μg protein) from morphine or saline treated animals were subjected to Western blot analysis using antibodies to USP8 (A) as described under “Experimental Procedures.” The total level of ubiquitinated proteins (B) was assessed using anti-ubiquitin antibodies. Representative blot is shown in the figure. Data represent Mean ± S.E. of 4 independent animals. *p < 0.05; **p < 0.01; t test.
Ubiquitin Carboxyl Terminal Hydrolase D3zn39 Usp8, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ubiquitin carboxyl terminal hydrolase d3zn39 usp8/product/Cell Signaling Technology Inc
Average 93 stars, based on 1 article reviews
ubiquitin carboxyl terminal hydrolase d3zn39 usp8 - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

93
Addgene inc ezh2
a RASSF10 expression across human normal tissues (log2, data GTEX— n = 2921—RPKM—ensgtexv4). b Kidney cancer cell lines were analyzed by combined bisulfite restriction analysis (+ Taq I digested; −mock digest) for RASSF10 promoter hypermethylation and 9 out of 15 (60%) were methylated (m). HeLa was used as positive control. HEK293 cell line is partially methylated (pm). c Pharmacological inhibition of DNA-methyl-transferases by 5-Aza-2′deoxycytidine (Aza) significantly reestablished RASSF10 expression in kidney cancer cell lines MZ1257 and MZ1973 ( t -test). RASSF10 was normalized to ß-ACTIN . d In kidney cancer patient samples RASSF10 methylation (cg05817758 in beta value) blocks RASSF10 expression (log2; norm. rsem + 1) shown for renal clear cell and e renal papillary carcinoma. Analyzed using . f RASSF10 inhibition by CRISPR-Cas9 genomic targeting of RASSF10. HEK293 (RASSF10-TetOn) cells were transfected with CRISPR-Cas9 guide RNAs in px549 vector targeting RASSF10 (three guide combinations) for 48 h and RASSF10 was induced by doxycycline for 24 h. g RASSF10 is epigenetically regulated by <t>EZH2</t> and p300. HEK293 (RASSF10-TetOn) cells were transfected with RASSF10 guide RNAs in px549 (deadCas) targeting RASSF10 and recruiting EZH2(deadCas) or p300(deadCas) for 72 h and RASSF10 was induced by doxycycline for 24 h. Protein lysates were separated by SDS-Page and western blotted with indicated antibodies.
Ezh2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ezh2/product/Addgene inc
Average 93 stars, based on 1 article reviews
ezh2 - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

Image Search Results


A UMAP plot showing 24 clusters of the integrated scRNA-seq dataset from two control spleen samples (WT) and two PTCL-NOS Smarcb1− tumor samples. B Relative abundance of different cell types in murine WT spleens (left), PTCL spleens (middle), and human tumors (right; NB: in order to ensure comparability, the stromal cells were removed before quantification). The pie charts in the lower part show the ratio between B-cells and myeloid cells. C Multiplex immunofluorescence (IF) images of FFPE sections of murine PTCL-NOS Smarcb1− and control spleen samples (WT: upper panels; tumor: lower panels). For better visualization, the white boxed areas ( a to f ) are enlarged (2.5x; scale bar = 100 µm). DAPI (gray) provides a nuclear counterstain, Ezh2 (yellow) defines malignant cells (Ezh2 hi ), B220 (blue) is used as a pan B-cell marker (B220 + ), and Ly6g (pink) as a marker for neutrophils (Ly6g + ). D Quantitative analysis of IF images from ( C ). Four representative regions of interest (ROIs; size: 1500 × 1500 µm) were selected and analyzed for mouse WT and Tumor samples. A Wilcoxon-Mann-Whitney test was calculated to determine if there are differences between WT and Tumor samples for all comparisons (* p = 0.0286). Boxplot settings: middle, median; lower hinge, 25% quantile; upper hinge, 75% quantile; upper/lower whisker, largest/smallest observation less/greater than or equal to upper/lower hinge ±1.5 * IQR. E The heatmap shows the overlap between cluster-specific DEG lists and the cancer hallmark metaprograms. F Signature plots of the programs Cycling, MYC, EMT and Stress in cells from WT (left) and tumor (right) samples. G A split violin plot (left/gray half: WT; right/black half: tumor) illustrates the increase in T-cell exhaustion features (Exhaust.) with a simultaneous decrease in NK cytotoxicity (Cytotox.) markers (e.g., Ncr1/NKp46) as well as infiltration of immunosuppressive myeloid cells in tumor versus WT samples. Source data of B and D are provided as a Source Data file. B Created with BioRender.com released under a Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International license.

Journal: Nature Communications

Article Title: Lack of SMARCB1 expression characterizes a subset of human and murine peripheral T-cell lymphomas

doi: 10.1038/s41467-024-52826-0

Figure Lengend Snippet: A UMAP plot showing 24 clusters of the integrated scRNA-seq dataset from two control spleen samples (WT) and two PTCL-NOS Smarcb1− tumor samples. B Relative abundance of different cell types in murine WT spleens (left), PTCL spleens (middle), and human tumors (right; NB: in order to ensure comparability, the stromal cells were removed before quantification). The pie charts in the lower part show the ratio between B-cells and myeloid cells. C Multiplex immunofluorescence (IF) images of FFPE sections of murine PTCL-NOS Smarcb1− and control spleen samples (WT: upper panels; tumor: lower panels). For better visualization, the white boxed areas ( a to f ) are enlarged (2.5x; scale bar = 100 µm). DAPI (gray) provides a nuclear counterstain, Ezh2 (yellow) defines malignant cells (Ezh2 hi ), B220 (blue) is used as a pan B-cell marker (B220 + ), and Ly6g (pink) as a marker for neutrophils (Ly6g + ). D Quantitative analysis of IF images from ( C ). Four representative regions of interest (ROIs; size: 1500 × 1500 µm) were selected and analyzed for mouse WT and Tumor samples. A Wilcoxon-Mann-Whitney test was calculated to determine if there are differences between WT and Tumor samples for all comparisons (* p = 0.0286). Boxplot settings: middle, median; lower hinge, 25% quantile; upper hinge, 75% quantile; upper/lower whisker, largest/smallest observation less/greater than or equal to upper/lower hinge ±1.5 * IQR. E The heatmap shows the overlap between cluster-specific DEG lists and the cancer hallmark metaprograms. F Signature plots of the programs Cycling, MYC, EMT and Stress in cells from WT (left) and tumor (right) samples. G A split violin plot (left/gray half: WT; right/black half: tumor) illustrates the increase in T-cell exhaustion features (Exhaust.) with a simultaneous decrease in NK cytotoxicity (Cytotox.) markers (e.g., Ncr1/NKp46) as well as infiltration of immunosuppressive myeloid cells in tumor versus WT samples. Source data of B and D are provided as a Source Data file. B Created with BioRender.com released under a Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International license.

Article Snippet: For multiplexed immunofluorescence analysis, slices of PTCL-NOS Smarcb1− and corresponding murine control spleens were stained in the MACSima imaging system using antibodies against B220 (RA3-6B2, Miltenyi Biotec, APC, 1:50), Ly6G (1A8, Miltenyi Biotec, PE, 1:50) and EZH2 (REA907, Miltenyi Biotec, APC, 1:50).

Techniques: Control, Multiplex Assay, Immunofluorescence, Marker, MANN-WHITNEY, Whisker Assay

Expression of EZH2 and podocyte injury were enhanced in db/db mice. ( A - B ) Representative images and quantitative analysis of immunohistochemistry staining of EZH2 in the glomeruli of human renal samples (40×). Scale bar = 50 μm. * P < 0.05 vs. control group ( n = 10). ( C ) Correlation analysis between estimated glomerular filtration rate (eGFR) and the expression of EZH2 in DN patients. ( D - E ) Urinary albumin/creatine ratios (uACRs) and blood glucose levels measured in each group. P values vs. db/m group ( n = 6). ( F ) Representative images of periodic acid-Schiff (PAS) staining revealing glomerular alterations in each group (40×). Scale bar = 20 μm. ( G ) Micrographs of podocyte foot processes (green arrows), podocyte foot process effacement and fusion (red arrows) and glomerular basement membrane (GBM, blue arrows) observed by transmission electron microscopy (TEM) in each group. Scale bar = 500 nm. ( H ) Quantification of the number of foot processes in different groups of mice. P values vs. db/m group ( n = 6). ( I - K ) Illustrative confocal microscopic images and quantifications of podocin (green) and B7-1 (red) in each group. Scale bar = 20 μm. P values vs. db/m group ( n = 6). (L-M) Western blotting and quantitative analysis of EZH2, nephrin, podocin, and B7-1 levels in isolated glomeruli in each group. Histone 3 (H3) and β-actin served as loading controls. P values vs. db/m group ( n = 6). CON, control; DN, diabetic nephropathy

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Histone methyltransferase EZH2 drives podocyte injury and senescence in diabetic nephropathy through STAT3 activation

doi: 10.1007/s00018-026-06136-x

Figure Lengend Snippet: Expression of EZH2 and podocyte injury were enhanced in db/db mice. ( A - B ) Representative images and quantitative analysis of immunohistochemistry staining of EZH2 in the glomeruli of human renal samples (40×). Scale bar = 50 μm. * P < 0.05 vs. control group ( n = 10). ( C ) Correlation analysis between estimated glomerular filtration rate (eGFR) and the expression of EZH2 in DN patients. ( D - E ) Urinary albumin/creatine ratios (uACRs) and blood glucose levels measured in each group. P values vs. db/m group ( n = 6). ( F ) Representative images of periodic acid-Schiff (PAS) staining revealing glomerular alterations in each group (40×). Scale bar = 20 μm. ( G ) Micrographs of podocyte foot processes (green arrows), podocyte foot process effacement and fusion (red arrows) and glomerular basement membrane (GBM, blue arrows) observed by transmission electron microscopy (TEM) in each group. Scale bar = 500 nm. ( H ) Quantification of the number of foot processes in different groups of mice. P values vs. db/m group ( n = 6). ( I - K ) Illustrative confocal microscopic images and quantifications of podocin (green) and B7-1 (red) in each group. Scale bar = 20 μm. P values vs. db/m group ( n = 6). (L-M) Western blotting and quantitative analysis of EZH2, nephrin, podocin, and B7-1 levels in isolated glomeruli in each group. Histone 3 (H3) and β-actin served as loading controls. P values vs. db/m group ( n = 6). CON, control; DN, diabetic nephropathy

Article Snippet: The following antibodies were used for immunofluorescence staining: EZH2 (1:100, 5246 S, CST, USA), pSTAT3 (1:50, 4113 S, CST, USA), podocin (1:200, ab50339, Abcam, UK), WT-1 (1:200, ab89901, Abcam, UK), Flag (1:200, 80010-1-RR, Proteintech, Wuhan, China) and B7-1 (1:200, sc-376012, Santa Cruz Biotechnology, USA).

Techniques: Expressing, Immunohistochemistry, Staining, Control, Filtration, Membrane, Transmission Assay, Electron Microscopy, Western Blot, Isolation

Up-regulated EZH2 levels and aggravated podocyte injury in high glucose-cultured MPCs. ( A - B ) Western blotting and quantitative analysis of EZH2, synaptopodin, podocin, and B7-1 levels in mouse podocyte cells (MPCs). H3 and β-actin served as loading controls. ns: P > 0.05 vs. NG group. P values vs. NG group ( n = 3). ( C - D ) Illustrative confocal microscopic images and quantification showed EZH2 (green) in the MPCs counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (blue). Scale bar = 20 μm. ns: P > 0.05 vs. NG group. P values vs. NG group ( n = 3). NG, normal glucose; HM, high mannitol; HG, high glucose

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Histone methyltransferase EZH2 drives podocyte injury and senescence in diabetic nephropathy through STAT3 activation

doi: 10.1007/s00018-026-06136-x

Figure Lengend Snippet: Up-regulated EZH2 levels and aggravated podocyte injury in high glucose-cultured MPCs. ( A - B ) Western blotting and quantitative analysis of EZH2, synaptopodin, podocin, and B7-1 levels in mouse podocyte cells (MPCs). H3 and β-actin served as loading controls. ns: P > 0.05 vs. NG group. P values vs. NG group ( n = 3). ( C - D ) Illustrative confocal microscopic images and quantification showed EZH2 (green) in the MPCs counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (blue). Scale bar = 20 μm. ns: P > 0.05 vs. NG group. P values vs. NG group ( n = 3). NG, normal glucose; HM, high mannitol; HG, high glucose

Article Snippet: The following antibodies were used for immunofluorescence staining: EZH2 (1:100, 5246 S, CST, USA), pSTAT3 (1:50, 4113 S, CST, USA), podocin (1:200, ab50339, Abcam, UK), WT-1 (1:200, ab89901, Abcam, UK), Flag (1:200, 80010-1-RR, Proteintech, Wuhan, China) and B7-1 (1:200, sc-376012, Santa Cruz Biotechnology, USA).

Techniques: Cell Culture, Western Blot

The EZH2 inhibitor GSK126 alleviated podocyte injury and glomerular senescence in db/db mice. ( A - B ) uACRs and blood glucose levels measured in each group. ns: P > 0.05 vs. db/db group. P values vs. db/db group ( n = 6). ( C ) Representative images of PAS staining of glomeruli in each group (40×). Scale bar = 20 μm. ( D ) Micrographs of podocyte foot processes (green arrows), podocyte foot process effacement and fusion (red arrows) and GBM (blue arrows) observed by TEM in each group. Scale bar = 500 nm. ( E - F ) Western blotting and quantitative analysis of EZH2, H3K27me3, nephrin, podocin, B7-1, p21, and Klotho in each group. H3 and β-actin served as loading controls. ns: P > 0.05 vs. db/db group. P values vs. db/db group ( n = 6). ( G ) Illustrative confocal microscopic images of podocin (green) and B7-1 (red) in different groups. Scale bar = 20 μm. ( H - I ) Graphs of SA-β-gal (yellow arrows) staining and immunohistochemistry staining for p16 INK4A in each group (40×). Scale bar = 20 μm. The dashed lines represent the enlarged images of the area indicated by the arrows. ( J - K ) Quantifications of the number of foot processes and p16 INK4A in different groups of mice. ns: P > 0.05 vs. db/db group. P values vs. db/db group ( n = 6). ( L - M ) Quantitative analysis of podocin and B7-1 in the glomeruli of different groups. ns: P > 0.05 vs. db/db group. P values vs. db/db group ( n = 6). β-CD, SBE-β-CD; GSK126, GSK2816126A

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Histone methyltransferase EZH2 drives podocyte injury and senescence in diabetic nephropathy through STAT3 activation

doi: 10.1007/s00018-026-06136-x

Figure Lengend Snippet: The EZH2 inhibitor GSK126 alleviated podocyte injury and glomerular senescence in db/db mice. ( A - B ) uACRs and blood glucose levels measured in each group. ns: P > 0.05 vs. db/db group. P values vs. db/db group ( n = 6). ( C ) Representative images of PAS staining of glomeruli in each group (40×). Scale bar = 20 μm. ( D ) Micrographs of podocyte foot processes (green arrows), podocyte foot process effacement and fusion (red arrows) and GBM (blue arrows) observed by TEM in each group. Scale bar = 500 nm. ( E - F ) Western blotting and quantitative analysis of EZH2, H3K27me3, nephrin, podocin, B7-1, p21, and Klotho in each group. H3 and β-actin served as loading controls. ns: P > 0.05 vs. db/db group. P values vs. db/db group ( n = 6). ( G ) Illustrative confocal microscopic images of podocin (green) and B7-1 (red) in different groups. Scale bar = 20 μm. ( H - I ) Graphs of SA-β-gal (yellow arrows) staining and immunohistochemistry staining for p16 INK4A in each group (40×). Scale bar = 20 μm. The dashed lines represent the enlarged images of the area indicated by the arrows. ( J - K ) Quantifications of the number of foot processes and p16 INK4A in different groups of mice. ns: P > 0.05 vs. db/db group. P values vs. db/db group ( n = 6). ( L - M ) Quantitative analysis of podocin and B7-1 in the glomeruli of different groups. ns: P > 0.05 vs. db/db group. P values vs. db/db group ( n = 6). β-CD, SBE-β-CD; GSK126, GSK2816126A

Article Snippet: The following antibodies were used for immunofluorescence staining: EZH2 (1:100, 5246 S, CST, USA), pSTAT3 (1:50, 4113 S, CST, USA), podocin (1:200, ab50339, Abcam, UK), WT-1 (1:200, ab89901, Abcam, UK), Flag (1:200, 80010-1-RR, Proteintech, Wuhan, China) and B7-1 (1:200, sc-376012, Santa Cruz Biotechnology, USA).

Techniques: Staining, Western Blot, Immunohistochemistry

EZH2 methylates and activates STAT3 in podocytes. ( A - B ) Western blotting and quantitative analysis of pSTAT3/STAT3 in each group. P values vs. db/m group ( n = 6). ( C - D ) Western blotting and quantitative analysis of pSTAT3/STAT3 in MPCs. ns: P > 0.05 vs. NG group. P values vs. NG group ( n = 3). ( E - F ) Western blotting and quantifications of pSTAT3/STAT3 in different groups. ns: P > 0.05 vs. db/db group. P values vs. db/db group ( n = 6). ( G - H ) Western blotting and quantitative analysis of pSTAT3/STAT3 and H3K27me3 in MPCs. ns: P > 0.05 vs. HG group. P values vs. HG group ( n = 3). ( I ) Co-immunoprecipitation (Co-IP) revealed a relationship between EZH2 and STAT3, as well as EZH2 and pSTAT3. The Input group served as a positive control, and the IgG group served as a negative control. ( J ) Illustrative confocal microscopic images of EZH2 (red) and pSTAT3 (green) in MPCs counterstained with DAPI (blue). Scale bar = 20 μm. ( K ) Image of molecular docking between EZH2 (pink) and STAT3 (green). ( L ) Co-IP showed the interaction between EZH2 and STAT3 after EZH2 inhibition by GSK126. ( M ) The methylation status of lysine residues of STAT3 was evaluated by Co-IP in MPCs treated with NG or HG. ( N ) The methylation status of lysine residues of STAT3 after EZH2 knockdown (KD) by adenovirus

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Histone methyltransferase EZH2 drives podocyte injury and senescence in diabetic nephropathy through STAT3 activation

doi: 10.1007/s00018-026-06136-x

Figure Lengend Snippet: EZH2 methylates and activates STAT3 in podocytes. ( A - B ) Western blotting and quantitative analysis of pSTAT3/STAT3 in each group. P values vs. db/m group ( n = 6). ( C - D ) Western blotting and quantitative analysis of pSTAT3/STAT3 in MPCs. ns: P > 0.05 vs. NG group. P values vs. NG group ( n = 3). ( E - F ) Western blotting and quantifications of pSTAT3/STAT3 in different groups. ns: P > 0.05 vs. db/db group. P values vs. db/db group ( n = 6). ( G - H ) Western blotting and quantitative analysis of pSTAT3/STAT3 and H3K27me3 in MPCs. ns: P > 0.05 vs. HG group. P values vs. HG group ( n = 3). ( I ) Co-immunoprecipitation (Co-IP) revealed a relationship between EZH2 and STAT3, as well as EZH2 and pSTAT3. The Input group served as a positive control, and the IgG group served as a negative control. ( J ) Illustrative confocal microscopic images of EZH2 (red) and pSTAT3 (green) in MPCs counterstained with DAPI (blue). Scale bar = 20 μm. ( K ) Image of molecular docking between EZH2 (pink) and STAT3 (green). ( L ) Co-IP showed the interaction between EZH2 and STAT3 after EZH2 inhibition by GSK126. ( M ) The methylation status of lysine residues of STAT3 was evaluated by Co-IP in MPCs treated with NG or HG. ( N ) The methylation status of lysine residues of STAT3 after EZH2 knockdown (KD) by adenovirus

Article Snippet: The following antibodies were used for immunofluorescence staining: EZH2 (1:100, 5246 S, CST, USA), pSTAT3 (1:50, 4113 S, CST, USA), podocin (1:200, ab50339, Abcam, UK), WT-1 (1:200, ab89901, Abcam, UK), Flag (1:200, 80010-1-RR, Proteintech, Wuhan, China) and B7-1 (1:200, sc-376012, Santa Cruz Biotechnology, USA).

Techniques: Western Blot, Immunoprecipitation, Co-Immunoprecipitation Assay, Positive Control, Negative Control, Inhibition, Methylation, Knockdown

Overexpression of STAT3 eliminated the reversal role of EZH2 inhibition against podocyte damage and senescence in db/db mice. ( A ) Flow chart of treatment, sampling and observation end points for the db/db mice. ( B ) Illustrative immunofluorescence staining images of Flag (red) and Wilms Tumor-1 (green) in db/db + EZH2 KD + STAT3 OE group mice. Scale bar = 20 μm. ( C - D ) uACRs and blood glucose levels were measured in different groups ( n = 6). ( E ) Representative images of PAS staining of glomeruli in each group (40×). Scale bar = 20 μm. ( F ) Micrographs of podocyte foot processes (green arrows), podocyte foot process effacement and fusion (red arrows) and GBM (blue arrows) as observed by TEM in each group. Scale bar = 500 nm. ( G - H ) Western blotting and quantitative analysis of p21, Klotho, nephrin, podocin, and desmin levels in each group. H3 and β-actin served as loading controls. P values vs. db/db + EZH2 KD group ( n = 6). ( I ) Illustrative confocal microscopic images of podocin (green) and B7-1 (red) in each group. Scale bar = 20 μm. ( J - K ) Graphs of SA-β-gal (yellow arrows) staining and immunohistochemistry staining for p16 INK4A in each group (40×). Scale bar = 20 μm. The dashed lines represent the enlarged images of the area indicated by the arrows. ( L - O ) Quantifications of the number of foot processes, podocin, B7-1 and p16 INK4A in different groups of mice ( n = 6). OE, overexpression

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Histone methyltransferase EZH2 drives podocyte injury and senescence in diabetic nephropathy through STAT3 activation

doi: 10.1007/s00018-026-06136-x

Figure Lengend Snippet: Overexpression of STAT3 eliminated the reversal role of EZH2 inhibition against podocyte damage and senescence in db/db mice. ( A ) Flow chart of treatment, sampling and observation end points for the db/db mice. ( B ) Illustrative immunofluorescence staining images of Flag (red) and Wilms Tumor-1 (green) in db/db + EZH2 KD + STAT3 OE group mice. Scale bar = 20 μm. ( C - D ) uACRs and blood glucose levels were measured in different groups ( n = 6). ( E ) Representative images of PAS staining of glomeruli in each group (40×). Scale bar = 20 μm. ( F ) Micrographs of podocyte foot processes (green arrows), podocyte foot process effacement and fusion (red arrows) and GBM (blue arrows) as observed by TEM in each group. Scale bar = 500 nm. ( G - H ) Western blotting and quantitative analysis of p21, Klotho, nephrin, podocin, and desmin levels in each group. H3 and β-actin served as loading controls. P values vs. db/db + EZH2 KD group ( n = 6). ( I ) Illustrative confocal microscopic images of podocin (green) and B7-1 (red) in each group. Scale bar = 20 μm. ( J - K ) Graphs of SA-β-gal (yellow arrows) staining and immunohistochemistry staining for p16 INK4A in each group (40×). Scale bar = 20 μm. The dashed lines represent the enlarged images of the area indicated by the arrows. ( L - O ) Quantifications of the number of foot processes, podocin, B7-1 and p16 INK4A in different groups of mice ( n = 6). OE, overexpression

Article Snippet: The following antibodies were used for immunofluorescence staining: EZH2 (1:100, 5246 S, CST, USA), pSTAT3 (1:50, 4113 S, CST, USA), podocin (1:200, ab50339, Abcam, UK), WT-1 (1:200, ab89901, Abcam, UK), Flag (1:200, 80010-1-RR, Proteintech, Wuhan, China) and B7-1 (1:200, sc-376012, Santa Cruz Biotechnology, USA).

Techniques: Over Expression, Inhibition, Sampling, Immunofluorescence, Staining, Wilms Tumor Assay, Western Blot, Immunohistochemistry

STAT3 overexpression counteracts podocyte protection mediated by EZH2 inhibition in high glucose-treated MPCs. ( A - B ) Western blotting and quantitative analysis of p21, Klotho, synapotopodin, podocin, and B7-1 levels. H3 and β-actin served as loading controls. P values vs. HG + EZH2 KD group ( n = 3). ( C - D ) Graphs and quantitative analysis of SA-β-gal (yellow arrows) staining in MPCs ( n = 3). ( E - F ) Representative images of western blotting and quantifications of p21, Klotho, synapotopodin, podocin, and B7-1 levels. H3 and β-actin served as loading controls. P values vs. HG + EZH2 KD group ( n = 3)

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Histone methyltransferase EZH2 drives podocyte injury and senescence in diabetic nephropathy through STAT3 activation

doi: 10.1007/s00018-026-06136-x

Figure Lengend Snippet: STAT3 overexpression counteracts podocyte protection mediated by EZH2 inhibition in high glucose-treated MPCs. ( A - B ) Western blotting and quantitative analysis of p21, Klotho, synapotopodin, podocin, and B7-1 levels. H3 and β-actin served as loading controls. P values vs. HG + EZH2 KD group ( n = 3). ( C - D ) Graphs and quantitative analysis of SA-β-gal (yellow arrows) staining in MPCs ( n = 3). ( E - F ) Representative images of western blotting and quantifications of p21, Klotho, synapotopodin, podocin, and B7-1 levels. H3 and β-actin served as loading controls. P values vs. HG + EZH2 KD group ( n = 3)

Article Snippet: The following antibodies were used for immunofluorescence staining: EZH2 (1:100, 5246 S, CST, USA), pSTAT3 (1:50, 4113 S, CST, USA), podocin (1:200, ab50339, Abcam, UK), WT-1 (1:200, ab89901, Abcam, UK), Flag (1:200, 80010-1-RR, Proteintech, Wuhan, China) and B7-1 (1:200, sc-376012, Santa Cruz Biotechnology, USA).

Techniques: Over Expression, Inhibition, Western Blot, Staining

A schematic diagram illustrates the multifaceted role of the EZH2 in podocyte senescence upon diabetic insult and the protective effect of targeting EZH2. The present study demonstrated that EZH2 is highly expressed in DN and negatively correlated with eGFR. EZH2-mediated STAT3 activation promotes podocyte senescence. The aforementioned pathogenic pathways contribute to kidney aging in DN and can be mitigated by targeting EZH2, either genetically through adeno-associated virus-mediated knockdown, or pharmacologically using small-molecule inhibitors such as GSK126

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Histone methyltransferase EZH2 drives podocyte injury and senescence in diabetic nephropathy through STAT3 activation

doi: 10.1007/s00018-026-06136-x

Figure Lengend Snippet: A schematic diagram illustrates the multifaceted role of the EZH2 in podocyte senescence upon diabetic insult and the protective effect of targeting EZH2. The present study demonstrated that EZH2 is highly expressed in DN and negatively correlated with eGFR. EZH2-mediated STAT3 activation promotes podocyte senescence. The aforementioned pathogenic pathways contribute to kidney aging in DN and can be mitigated by targeting EZH2, either genetically through adeno-associated virus-mediated knockdown, or pharmacologically using small-molecule inhibitors such as GSK126

Article Snippet: The following antibodies were used for immunofluorescence staining: EZH2 (1:100, 5246 S, CST, USA), pSTAT3 (1:50, 4113 S, CST, USA), podocin (1:200, ab50339, Abcam, UK), WT-1 (1:200, ab89901, Abcam, UK), Flag (1:200, 80010-1-RR, Proteintech, Wuhan, China) and B7-1 (1:200, sc-376012, Santa Cruz Biotechnology, USA).

Techniques: Activation Assay, Virus, Knockdown

Figure 3. SETD2 Loss Aggravates PCa Progression through EZH2 Upregulation (A) Volcano plots showing the differentially expressed genes between the indicated organoids generated from 3-month-old mice. The represented genes are listed. (B) Heatmap summarizing the qRT-PCR results in organoids generated from 3-month-old mice. The expression was normalized to the mean level of each gene in Pten+/ cells. (C) IHC for the indicated proteins in 6-month-old mice prostates. Scale bar, 50 mm. (D) IB analysis of C4-2 cells in control and SETD2 KD cells with CHX treatment as indicated, and the graph represents the quantification of EZH2 protein levels relative to b-actin level from three independent experiments. Gray dot line indicates the half-life of EZH2 levels in control cells. Data are presented as mean ± SEM and analyzed by two-way ANOVA followed by multiple comparison. **p < 0.01. (E) Heatmap of H3K27me3 signal from 2 kb of transcription start site (TSS) to +2 kb of the transcription end site (TES) of 13,412 genes harboring H3K27me3 peaks in the indicated organoids generated from 3-month-old mice. (F) RNA sequencing and ChIP-seq tracks for H3K27me3 at Cdkn2a and Sox7 gene locus. (G) Heatmap of IHC score (by Pearson’s) between SETD2 and EZH2 in PCa specimens.

Journal: Cancer cell

Article Title: SETD2 Restricts Prostate Cancer Metastasis by Integrating EZH2 and AMPK Signaling Pathways.

doi: 10.1016/j.ccell.2020.05.022

Figure Lengend Snippet: Figure 3. SETD2 Loss Aggravates PCa Progression through EZH2 Upregulation (A) Volcano plots showing the differentially expressed genes between the indicated organoids generated from 3-month-old mice. The represented genes are listed. (B) Heatmap summarizing the qRT-PCR results in organoids generated from 3-month-old mice. The expression was normalized to the mean level of each gene in Pten+/ cells. (C) IHC for the indicated proteins in 6-month-old mice prostates. Scale bar, 50 mm. (D) IB analysis of C4-2 cells in control and SETD2 KD cells with CHX treatment as indicated, and the graph represents the quantification of EZH2 protein levels relative to b-actin level from three independent experiments. Gray dot line indicates the half-life of EZH2 levels in control cells. Data are presented as mean ± SEM and analyzed by two-way ANOVA followed by multiple comparison. **p < 0.01. (E) Heatmap of H3K27me3 signal from 2 kb of transcription start site (TSS) to +2 kb of the transcription end site (TES) of 13,412 genes harboring H3K27me3 peaks in the indicated organoids generated from 3-month-old mice. (F) RNA sequencing and ChIP-seq tracks for H3K27me3 at Cdkn2a and Sox7 gene locus. (G) Heatmap of IHC score (by Pearson’s) between SETD2 and EZH2 in PCa specimens.

Article Snippet: To create a C57BL/6 mouse model with point mutation (K735R) at mouse Ezh2 locus by CRISPR/Cas9-mediated genome engineering (CyagenBiosciences), EZH2K735R (AAG toCGC) specific sgRNA oligos were designed by the CRISPRwebsite (http://crispr.mit. edu/) targeting sequence at K735 locus (5’-GTTCGATGCCCACATACTTC-3’) and oligo donor sequence (5’-GTTGGATAGGTTGTCACTTCTTGTTCATATTGTTTCAGATACAGCCAGG CTGATGCCCTGCGCTATGTGGGCATCGAACGAGAAATGGAAATCCCTTGACATCTACTACCTCTTCCCCTTCTC-3’).

Techniques: Generated, Quantitative RT-PCR, Expressing, Control, Comparison, RNA Sequencing, ChIP-sequencing

Figure 4. SETD2-Mediated K735me1 Promotes EZH2 Degradation in a Smurf2-Dependent Manner (A) IB analysis of whole-cell lysates (WCLs) and immunoprecipitation (IP) of 293T cells transfected with the indicated plasmids. (B) IB analysis of WCLs and IP of C4-2 and LNCaP cells. (C) IB analysis of EZH2-K735me1 by in vitro methylation assay. (D) IHC for K735me1 and EZH2 in the 3-month-old mouse prostates. Scale bar, 50 mm. (E) IB analysis of K735me1 in IP of organoid cells generated from 3-month-old mice with or without 20 mM MG132 treatment for 8 h. (F) Quantification of methylated and unmethylated EZH2-K735 peptides by MS analysis in C4-2 cells with or without 20 mM MG132 for 8 h. Data are presented as the mean ± SEM of three independent experiments, and p values were calculated by two-tailed Student’s t test. **p < 0.01. (G) IB analysis of the indicated protein in WT and C4-2K735R cells. (H and I) IB (H) and tumor volume (I) arising from WT and C4-2K735R cells with or without SETD2-F2 overexpression (n = 6). Data are presented as mean ± SEM, two-way ANOVA followed by multiple comparison. **p < 0.01. (J) IB analysis of WCLs of WT, SETD2 KD, and C4-2K735R cells with or without Smurf2 overexpression. (K) IB analysis of WCLs and anti-EZH2 IP of the indicated cells with or without SETD2-F2 overexpression. See also Figure S4.

Journal: Cancer cell

Article Title: SETD2 Restricts Prostate Cancer Metastasis by Integrating EZH2 and AMPK Signaling Pathways.

doi: 10.1016/j.ccell.2020.05.022

Figure Lengend Snippet: Figure 4. SETD2-Mediated K735me1 Promotes EZH2 Degradation in a Smurf2-Dependent Manner (A) IB analysis of whole-cell lysates (WCLs) and immunoprecipitation (IP) of 293T cells transfected with the indicated plasmids. (B) IB analysis of WCLs and IP of C4-2 and LNCaP cells. (C) IB analysis of EZH2-K735me1 by in vitro methylation assay. (D) IHC for K735me1 and EZH2 in the 3-month-old mouse prostates. Scale bar, 50 mm. (E) IB analysis of K735me1 in IP of organoid cells generated from 3-month-old mice with or without 20 mM MG132 treatment for 8 h. (F) Quantification of methylated and unmethylated EZH2-K735 peptides by MS analysis in C4-2 cells with or without 20 mM MG132 for 8 h. Data are presented as the mean ± SEM of three independent experiments, and p values were calculated by two-tailed Student’s t test. **p < 0.01. (G) IB analysis of the indicated protein in WT and C4-2K735R cells. (H and I) IB (H) and tumor volume (I) arising from WT and C4-2K735R cells with or without SETD2-F2 overexpression (n = 6). Data are presented as mean ± SEM, two-way ANOVA followed by multiple comparison. **p < 0.01. (J) IB analysis of WCLs of WT, SETD2 KD, and C4-2K735R cells with or without Smurf2 overexpression. (K) IB analysis of WCLs and anti-EZH2 IP of the indicated cells with or without SETD2-F2 overexpression. See also Figure S4.

Article Snippet: To create a C57BL/6 mouse model with point mutation (K735R) at mouse Ezh2 locus by CRISPR/Cas9-mediated genome engineering (CyagenBiosciences), EZH2K735R (AAG toCGC) specific sgRNA oligos were designed by the CRISPRwebsite (http://crispr.mit. edu/) targeting sequence at K735 locus (5’-GTTCGATGCCCACATACTTC-3’) and oligo donor sequence (5’-GTTGGATAGGTTGTCACTTCTTGTTCATATTGTTTCAGATACAGCCAGG CTGATGCCCTGCGCTATGTGGGCATCGAACGAGAAATGGAAATCCCTTGACATCTACTACCTCTTCCCCTTCTC-3’).

Techniques: Immunoprecipitation, Transfection, In Vitro, Methylation, Generated, Two Tailed Test, Over Expression, Comparison

Figure 5. Methylation-Deficient Ezh2 Promotes PCa Metastasis in Mice (A) IHC for K735me1 and EZH2 in ventral prostate sections as indicated. Scale bar, 50 mm. (B) H&E staining of mouse prostates at 8–10 months of age. Scale bar, 100 mm. Quantification of histological grade is shown (n = 10). Data are presented as mean ± SEM, c2 test. **p < 0.01. (C) IHC staining as indicated in 4-month-old prostatic sections. Scale bar, 100 mm. Quantification of histological grade is shown (n = 6). The results are presented as the mean ± SEM, c2 test. **p < 0.01. (D) IHC staining for AR and CK8 in lymph nodes and lungs from 4-month-old mice. Scale bar, 100 mm. (E) IB analysis of the indicated protein in the organoid cells with or without Setd2 KD or overexpression (CRISPRa/dCas9-based induction).

Journal: Cancer cell

Article Title: SETD2 Restricts Prostate Cancer Metastasis by Integrating EZH2 and AMPK Signaling Pathways.

doi: 10.1016/j.ccell.2020.05.022

Figure Lengend Snippet: Figure 5. Methylation-Deficient Ezh2 Promotes PCa Metastasis in Mice (A) IHC for K735me1 and EZH2 in ventral prostate sections as indicated. Scale bar, 50 mm. (B) H&E staining of mouse prostates at 8–10 months of age. Scale bar, 100 mm. Quantification of histological grade is shown (n = 10). Data are presented as mean ± SEM, c2 test. **p < 0.01. (C) IHC staining as indicated in 4-month-old prostatic sections. Scale bar, 100 mm. Quantification of histological grade is shown (n = 6). The results are presented as the mean ± SEM, c2 test. **p < 0.01. (D) IHC staining for AR and CK8 in lymph nodes and lungs from 4-month-old mice. Scale bar, 100 mm. (E) IB analysis of the indicated protein in the organoid cells with or without Setd2 KD or overexpression (CRISPRa/dCas9-based induction).

Article Snippet: To create a C57BL/6 mouse model with point mutation (K735R) at mouse Ezh2 locus by CRISPR/Cas9-mediated genome engineering (CyagenBiosciences), EZH2K735R (AAG toCGC) specific sgRNA oligos were designed by the CRISPRwebsite (http://crispr.mit. edu/) targeting sequence at K735 locus (5’-GTTCGATGCCCACATACTTC-3’) and oligo donor sequence (5’-GTTGGATAGGTTGTCACTTCTTGTTCATATTGTTTCAGATACAGCCAGG CTGATGCCCTGCGCTATGTGGGCATCGAACGAGAAATGGAAATCCCTTGACATCTACTACCTCTTCCCCTTCTC-3’).

Techniques: Methylation, Staining, Immunohistochemistry, Over Expression

Figure 6. SETD2-R1523H Variants Potentiate Tumorigenesis via EZH2 (A) List of the most significant missense mutation sites in SETD2. The number among all SETD2 missense mutation tumors is shown. p values were calculated by recurrent mutations analysis as reported previously (Chang et al., 2016; Makohon-Moore et al., 2017). (B) Summary of the regions mediating SETD2 interaction with EZH2. (C) IB analysis of the IP in 293T cells transfected with the indicated plasmids. (D) GST pull-down assay of the interaction between the indicated protein. (E) IB analysis of C4-2 cells stably transfected with the indicated plasmids.

Journal: Cancer cell

Article Title: SETD2 Restricts Prostate Cancer Metastasis by Integrating EZH2 and AMPK Signaling Pathways.

doi: 10.1016/j.ccell.2020.05.022

Figure Lengend Snippet: Figure 6. SETD2-R1523H Variants Potentiate Tumorigenesis via EZH2 (A) List of the most significant missense mutation sites in SETD2. The number among all SETD2 missense mutation tumors is shown. p values were calculated by recurrent mutations analysis as reported previously (Chang et al., 2016; Makohon-Moore et al., 2017). (B) Summary of the regions mediating SETD2 interaction with EZH2. (C) IB analysis of the IP in 293T cells transfected with the indicated plasmids. (D) GST pull-down assay of the interaction between the indicated protein. (E) IB analysis of C4-2 cells stably transfected with the indicated plasmids.

Article Snippet: To create a C57BL/6 mouse model with point mutation (K735R) at mouse Ezh2 locus by CRISPR/Cas9-mediated genome engineering (CyagenBiosciences), EZH2K735R (AAG toCGC) specific sgRNA oligos were designed by the CRISPRwebsite (http://crispr.mit. edu/) targeting sequence at K735 locus (5’-GTTCGATGCCCACATACTTC-3’) and oligo donor sequence (5’-GTTGGATAGGTTGTCACTTCTTGTTCATATTGTTTCAGATACAGCCAGG CTGATGCCCTGCGCTATGTGGGCATCGAACGAGAAATGGAAATCCCTTGACATCTACTACCTCTTCCCCTTCTC-3’).

Techniques: Mutagenesis, Transfection, Pull Down Assay, Stable Transfection

Figure 7. AMPK-FOXO3 Axis-Mediated SETD2 Expression Modulates EZH2-K735me1 (A) Heatmap showing SETD2mRNA levels after 12 h treatment with the indicated compound in C4-2 cells. The expression was normalized to the mean level of each gene in the vehicle treatment group. (B and C) IB analysis of C4-2 cells treated with 1 mM AICAR for 24 h with or without AMPK KD (B) or FOXO3 KD (C). (D) Heatmap summary of the correlations (by Pearson’s) of the indicated protein in localized and metastatic tumors. The log2(relative intensity) derived from each band intensity normalized to the average of indicated protein across all samples. (E) IB analysis of organoid cells generated from 2-month-old indicated mice with or without metformin treatment for 7 days. (F) Representative images and quantification of the volume for the subcutaneous organoids (n = 5, data are presented as mean ± SEM and analyzed by two-tailed Student’s t test, *p < 0.05, **p < 0.01). Mice were treated with vehicle or metformin (100 mg/kg/day) every 2 days for 6 weeks. (G) Volume of tumors derived from PDXs treated with metformin (100 mg/kg/day) or vehicle every 2 days for 4–6 weeks (n = 6, two-way ANOVA followed by multiple comparison, *p < 0.05, **p < 0.01). Data are presented as mean ± SEM. Scale bar, 1 cm. See also Figure S7 and Table S6.

Journal: Cancer cell

Article Title: SETD2 Restricts Prostate Cancer Metastasis by Integrating EZH2 and AMPK Signaling Pathways.

doi: 10.1016/j.ccell.2020.05.022

Figure Lengend Snippet: Figure 7. AMPK-FOXO3 Axis-Mediated SETD2 Expression Modulates EZH2-K735me1 (A) Heatmap showing SETD2mRNA levels after 12 h treatment with the indicated compound in C4-2 cells. The expression was normalized to the mean level of each gene in the vehicle treatment group. (B and C) IB analysis of C4-2 cells treated with 1 mM AICAR for 24 h with or without AMPK KD (B) or FOXO3 KD (C). (D) Heatmap summary of the correlations (by Pearson’s) of the indicated protein in localized and metastatic tumors. The log2(relative intensity) derived from each band intensity normalized to the average of indicated protein across all samples. (E) IB analysis of organoid cells generated from 2-month-old indicated mice with or without metformin treatment for 7 days. (F) Representative images and quantification of the volume for the subcutaneous organoids (n = 5, data are presented as mean ± SEM and analyzed by two-tailed Student’s t test, *p < 0.05, **p < 0.01). Mice were treated with vehicle or metformin (100 mg/kg/day) every 2 days for 6 weeks. (G) Volume of tumors derived from PDXs treated with metformin (100 mg/kg/day) or vehicle every 2 days for 4–6 weeks (n = 6, two-way ANOVA followed by multiple comparison, *p < 0.05, **p < 0.01). Data are presented as mean ± SEM. Scale bar, 1 cm. See also Figure S7 and Table S6.

Article Snippet: To create a C57BL/6 mouse model with point mutation (K735R) at mouse Ezh2 locus by CRISPR/Cas9-mediated genome engineering (CyagenBiosciences), EZH2K735R (AAG toCGC) specific sgRNA oligos were designed by the CRISPRwebsite (http://crispr.mit. edu/) targeting sequence at K735 locus (5’-GTTCGATGCCCACATACTTC-3’) and oligo donor sequence (5’-GTTGGATAGGTTGTCACTTCTTGTTCATATTGTTTCAGATACAGCCAGG CTGATGCCCTGCGCTATGTGGGCATCGAACGAGAAATGGAAATCCCTTGACATCTACTACCTCTTCCCCTTCTC-3’).

Techniques: Expressing, Derivative Assay, Generated, Two Tailed Test, Comparison

Identification and validation of miR-101-3p downstream targets. ( a ) Bioinformatics analysis of potential miR-101-3p target genes. ( b , c ) EZH2 and MCL1 expression in GC cells transfected with NC mimics or miR-101-3p mimics was analyzed by qRT-PCR (b) and Western blot ( c ). ( d , e ) EZH2 and MCL1 expression in GC cells treated with N-Exo: ( d ) mRNA quantification via qRT-PCR and ( e ) protein analysis by Western blot. ( f ) Western blot analysis of EZH2 and MCL1 protein expression in GC cells treated with NC/101-IN-N-Exo. ( g ) Validation of EZH2 and MCL1 as direct targets of miR-101-3p by dual-luciferase reporter assay. ** n = 3; * P < 0.05, ** P < 0.01, *** P < 0.001

Journal: Cancer Cell International

Article Title: Neutrophil-derived exosomes inhibit gastric cancer progression via miR-101-3p-mediated suppression of MCL1

doi: 10.1186/s12935-026-04173-x

Figure Lengend Snippet: Identification and validation of miR-101-3p downstream targets. ( a ) Bioinformatics analysis of potential miR-101-3p target genes. ( b , c ) EZH2 and MCL1 expression in GC cells transfected with NC mimics or miR-101-3p mimics was analyzed by qRT-PCR (b) and Western blot ( c ). ( d , e ) EZH2 and MCL1 expression in GC cells treated with N-Exo: ( d ) mRNA quantification via qRT-PCR and ( e ) protein analysis by Western blot. ( f ) Western blot analysis of EZH2 and MCL1 protein expression in GC cells treated with NC/101-IN-N-Exo. ( g ) Validation of EZH2 and MCL1 as direct targets of miR-101-3p by dual-luciferase reporter assay. ** n = 3; * P < 0.05, ** P < 0.01, *** P < 0.001

Article Snippet: After blocking with 5% non-fat milk, membranes were incubated overnight with primary antibodies against PARP, Cleaved PARP, Caspase3, Cleaved Caspase3, CD9, CD63, TSG101, Calnexin, GM130, APOA1 (Cell Signaling Technology; USA), EZH2, MCL1, c-Myc, and β-actin (Proteintech; China).

Techniques: Biomarker Discovery, Expressing, Transfection, Quantitative RT-PCR, Western Blot, Luciferase, Reporter Assay

EZH2 combines with c-Myc to activate the transcription of MCL1. ( a ) Western blot analysis for the expression of EZH2, c-Myc, and MCL1 in GC cells following EZH2 knockdown. ( b ) Co-IP assays for the interaction between endogenous EZH2 and c-Myc in GC cells. ( c ) Co-IP assays for the influence of miR-101-3p overexpression on the binding of endogenous EZH2 and c-Myc in GC cells. ( d ) c-Myc expression was positively correlated with MCL1 in the STAD cohort. ( e ) Motif sequence. ( f ) Agarose gel electrophoresis for assessment of the quality of ultrasonic fragments. ( g ) The interaction between endogenous c-Myc and MCL1 promoter was determined in GC cells by ChIP-PCR. ** n = 3; * P < 0.05, ** P < 0.01, *** P < 0.001

Journal: Cancer Cell International

Article Title: Neutrophil-derived exosomes inhibit gastric cancer progression via miR-101-3p-mediated suppression of MCL1

doi: 10.1186/s12935-026-04173-x

Figure Lengend Snippet: EZH2 combines with c-Myc to activate the transcription of MCL1. ( a ) Western blot analysis for the expression of EZH2, c-Myc, and MCL1 in GC cells following EZH2 knockdown. ( b ) Co-IP assays for the interaction between endogenous EZH2 and c-Myc in GC cells. ( c ) Co-IP assays for the influence of miR-101-3p overexpression on the binding of endogenous EZH2 and c-Myc in GC cells. ( d ) c-Myc expression was positively correlated with MCL1 in the STAD cohort. ( e ) Motif sequence. ( f ) Agarose gel electrophoresis for assessment of the quality of ultrasonic fragments. ( g ) The interaction between endogenous c-Myc and MCL1 promoter was determined in GC cells by ChIP-PCR. ** n = 3; * P < 0.05, ** P < 0.01, *** P < 0.001

Article Snippet: After blocking with 5% non-fat milk, membranes were incubated overnight with primary antibodies against PARP, Cleaved PARP, Caspase3, Cleaved Caspase3, CD9, CD63, TSG101, Calnexin, GM130, APOA1 (Cell Signaling Technology; USA), EZH2, MCL1, c-Myc, and β-actin (Proteintech; China).

Techniques: Western Blot, Expressing, Knockdown, Co-Immunoprecipitation Assay, Over Expression, Binding Assay, Sequencing, Agarose Gel Electrophoresis

FIGURE 1 Combined FGFR and EZH2 inhibition reveals strong synergy in BAP1-deficient mesothelioma. A, 3D synergy plots visualizing the synergy

Journal: Cancer Research Communications

Article Title: Combined Inhibition of EZH2 and FGFR is Synergistic in BAP1-deficient Malignant Mesothelioma

doi: 10.1158/2767-9764.crc-23-0276

Figure Lengend Snippet: FIGURE 1 Combined FGFR and EZH2 inhibition reveals strong synergy in BAP1-deficient mesothelioma. A, 3D synergy plots visualizing the synergy

Article Snippet: Knockdown of Bap1 and Ezh2 by Inducible Short Hairpin RNA For BAP knockdown experiments in cell line MP41, we used doxycycline (dox)-inducible FH1-tUTG-RNAi vectors (Taconic Artemis) targeting the following sequence: 5′-GAGUUCAUCUGCACCUUUA-3′.

Techniques: Inhibition

FIGURE 2 EZH2 inhibition results in upregulation of FGFR pathways. A, GO-term analysis on differentially expressed genes between BNC cell lines (n = 2) that were treated with GSK126 or untreated. B, KEGG pathway enrichment analysis on samples mentioned in A. C, Long-term clonogenicity

Journal: Cancer Research Communications

Article Title: Combined Inhibition of EZH2 and FGFR is Synergistic in BAP1-deficient Malignant Mesothelioma

doi: 10.1158/2767-9764.crc-23-0276

Figure Lengend Snippet: FIGURE 2 EZH2 inhibition results in upregulation of FGFR pathways. A, GO-term analysis on differentially expressed genes between BNC cell lines (n = 2) that were treated with GSK126 or untreated. B, KEGG pathway enrichment analysis on samples mentioned in A. C, Long-term clonogenicity

Article Snippet: Knockdown of Bap1 and Ezh2 by Inducible Short Hairpin RNA For BAP knockdown experiments in cell line MP41, we used doxycycline (dox)-inducible FH1-tUTG-RNAi vectors (Taconic Artemis) targeting the following sequence: 5′-GAGUUCAUCUGCACCUUUA-3′.

Techniques: Inhibition

FIGURE 5 EZH2 and FGFR combination prolong survival of autochthonous BNC mouse models. A, Schematic representation of the experimental

Journal: Cancer Research Communications

Article Title: Combined Inhibition of EZH2 and FGFR is Synergistic in BAP1-deficient Malignant Mesothelioma

doi: 10.1158/2767-9764.crc-23-0276

Figure Lengend Snippet: FIGURE 5 EZH2 and FGFR combination prolong survival of autochthonous BNC mouse models. A, Schematic representation of the experimental

Article Snippet: Knockdown of Bap1 and Ezh2 by Inducible Short Hairpin RNA For BAP knockdown experiments in cell line MP41, we used doxycycline (dox)-inducible FH1-tUTG-RNAi vectors (Taconic Artemis) targeting the following sequence: 5′-GAGUUCAUCUGCACCUUUA-3′.

Techniques:

Biochemical validation of USP8, a protein shown to be down-regulated by quantitative proteomics. PSD fractions (15 μg protein) from morphine or saline treated animals were subjected to Western blot analysis using antibodies to USP8 (A) as described under “Experimental Procedures.” The total level of ubiquitinated proteins (B) was assessed using anti-ubiquitin antibodies. Representative blot is shown in the figure. Data represent Mean ± S.E. of 4 independent animals. *p < 0.05; **p < 0.01; t test.

Journal: Molecular & Cellular Proteomics : MCP

Article Title: Morphine Regulated Synaptic Networks Revealed by Integrated Proteomics and Network Analysis *

doi: 10.1074/mcp.M115.047977

Figure Lengend Snippet: Biochemical validation of USP8, a protein shown to be down-regulated by quantitative proteomics. PSD fractions (15 μg protein) from morphine or saline treated animals were subjected to Western blot analysis using antibodies to USP8 (A) as described under “Experimental Procedures.” The total level of ubiquitinated proteins (B) was assessed using anti-ubiquitin antibodies. Representative blot is shown in the figure. Data represent Mean ± S.E. of 4 independent animals. *p < 0.05; **p < 0.01; t test.

Article Snippet: M.W. (kDa) Ratio (M/S) p value EST Domain-containing transcription factor ERF D3ZJW0 ERF 59 0.8 0.01 FTS and Hook interacting protein D4A7B7 FAM160A2 99 0.8 0.02 Opioid growth factor receptor D4ABV6 OGFR 63 0.8 0.02 Similar to E3 ubiquitin-protein ligase Praja-1 {"type":"entrez-protein","attrs":{"text":"Q66HF7","term_id":"81890522","term_text":"Q66HF7"}} Q66HF7 PJA1 45 0.8 0.03 Synaptopodin {"type":"entrez-protein","attrs":{"text":"Q9Z327","term_id":"48428501","term_text":"Q9Z327"}} Q9Z327 SYNPO 100 0.8 0.03 Ubiquitin carboxyl-terminal hydrolase D3ZN39 USP8 124 0.8 0.03 Serine/threonine protein kinase PAK6 D3ZQ51 PAK6 75 0.8 0.03 Protein Lima1 F1LR10 LIMA1 83 0.3 0.03 CST complex subunit STN1 {"type":"entrez-protein","attrs":{"text":"Q6AYD2","term_id":"62900633","term_text":"Q6AYD2"}} Q6AYD2 OBFC1 47 0.8 0.05 Dnajb5 protein (Fragment) B2GV48 DNAJB5 44 0.8 0.05 Open in a separate window caption a8 Seed list of 13 striatal PSD proteins down-regulated by morphine treatment.

Techniques: Western Blot

Network representation of proteins altered by morphine treatment generated using intermediates from a background data set. Genes2FANS (30, 38) was used to connect the up-regulated proteins (green) with the down-regulated proteins (red) from the seed list using a maximum of two intermediates from the background literature-based PPI network. The network contains a total of 99 proteins and 180 interactions. Significant intermediates are shown in orange (z-score > 2.5). Up-regulated proteins (green): CD81, CD81 protein; CLDN11, Claudin-11; GAP43, Neuromodulin; GNAO1, Guanine nucleotide-binding protein G(o) subunit alpha; GNB1, Guanine nucleotide-binding protein G(i)/G(s)/G(t) subunit beta-1; GNB2, Guanine nucleotide-binding protein G(i)/G(s)/G(t) subunit beta-2; PPP3R1, Calcineurin subunit B type 1; RAP1B, Ras-related protein Rap-1b; RPL18A, 60S ribosomal protein L18a; RPS24, 40S ribosomal protein S24; TNX, Thioredoxin. Down-regulated proteins (red): DNAJB5, DnaJ homolog subfamily B member 5; LIMA1, LIM domain and actin-binding protein 1; PAK6, Serine/threonine-protein kinase PAK6; PJA1, E3 ubiquitin-protein ligase Praja-1; TRAF3, TNF receptor-associated factor 3; USP8, Ubiquitin carboxyl-terminal hydrolase 8. Significant intermediates (orange): ADRA2A, Alpha-2A adrenergic receptor; ADRBK1, Beta-adrenergic receptor kinase 1; AKT1, Protein kinase B alpha; CALM3, Calmodulin-3; CASP3, Caspase-3; GNG2, Guanine nucleotide-binding protein G(i)/G(s)/G(o) subunit gamma-2; GRM7, Metabotropic glutamate receptor 7; HD4C4, Histone deacetylase 4; IKBKG, NF-kappa B essential modulator (NEMO); MAP3K14, Mitogen-activated protein kinase kinase kinase 14; MAP3K3, Mitogen-activated protein kinase kinase kinase 3; MAP3K5, Mitogen-activated protein kinase kinase kinase 5; NEDD4, E3 ubiquitin-protein ligase NEDD4; NFKB2, Nuclear factor NF-kappa B p100 subunit; OPRD1, Delta type opioid receptor; OPRk1, Kappa type opioid receptor; OPRL1, Nociceptin receptor; OPRM1, Mu type opioid receptor; RIPK3, Receptor-interacting serine/threonine protein kinase 3; RNF128, E3 ubiquitin protein ligase RNF128; RNF41, E3 ubiquitin protein ligase NRDP1; SPTBN1, Spectrin beta chain, non-erythrocytic 1; TSPAN4, Tetraspanin-4; UBC, Ubiquitin-conjugating enzyme; YWHAZ, 14–3-3 protein zeta/delta.

Journal: Molecular & Cellular Proteomics : MCP

Article Title: Morphine Regulated Synaptic Networks Revealed by Integrated Proteomics and Network Analysis *

doi: 10.1074/mcp.M115.047977

Figure Lengend Snippet: Network representation of proteins altered by morphine treatment generated using intermediates from a background data set. Genes2FANS (30, 38) was used to connect the up-regulated proteins (green) with the down-regulated proteins (red) from the seed list using a maximum of two intermediates from the background literature-based PPI network. The network contains a total of 99 proteins and 180 interactions. Significant intermediates are shown in orange (z-score > 2.5). Up-regulated proteins (green): CD81, CD81 protein; CLDN11, Claudin-11; GAP43, Neuromodulin; GNAO1, Guanine nucleotide-binding protein G(o) subunit alpha; GNB1, Guanine nucleotide-binding protein G(i)/G(s)/G(t) subunit beta-1; GNB2, Guanine nucleotide-binding protein G(i)/G(s)/G(t) subunit beta-2; PPP3R1, Calcineurin subunit B type 1; RAP1B, Ras-related protein Rap-1b; RPL18A, 60S ribosomal protein L18a; RPS24, 40S ribosomal protein S24; TNX, Thioredoxin. Down-regulated proteins (red): DNAJB5, DnaJ homolog subfamily B member 5; LIMA1, LIM domain and actin-binding protein 1; PAK6, Serine/threonine-protein kinase PAK6; PJA1, E3 ubiquitin-protein ligase Praja-1; TRAF3, TNF receptor-associated factor 3; USP8, Ubiquitin carboxyl-terminal hydrolase 8. Significant intermediates (orange): ADRA2A, Alpha-2A adrenergic receptor; ADRBK1, Beta-adrenergic receptor kinase 1; AKT1, Protein kinase B alpha; CALM3, Calmodulin-3; CASP3, Caspase-3; GNG2, Guanine nucleotide-binding protein G(i)/G(s)/G(o) subunit gamma-2; GRM7, Metabotropic glutamate receptor 7; HD4C4, Histone deacetylase 4; IKBKG, NF-kappa B essential modulator (NEMO); MAP3K14, Mitogen-activated protein kinase kinase kinase 14; MAP3K3, Mitogen-activated protein kinase kinase kinase 3; MAP3K5, Mitogen-activated protein kinase kinase kinase 5; NEDD4, E3 ubiquitin-protein ligase NEDD4; NFKB2, Nuclear factor NF-kappa B p100 subunit; OPRD1, Delta type opioid receptor; OPRk1, Kappa type opioid receptor; OPRL1, Nociceptin receptor; OPRM1, Mu type opioid receptor; RIPK3, Receptor-interacting serine/threonine protein kinase 3; RNF128, E3 ubiquitin protein ligase RNF128; RNF41, E3 ubiquitin protein ligase NRDP1; SPTBN1, Spectrin beta chain, non-erythrocytic 1; TSPAN4, Tetraspanin-4; UBC, Ubiquitin-conjugating enzyme; YWHAZ, 14–3-3 protein zeta/delta.

Article Snippet: M.W. (kDa) Ratio (M/S) p value EST Domain-containing transcription factor ERF D3ZJW0 ERF 59 0.8 0.01 FTS and Hook interacting protein D4A7B7 FAM160A2 99 0.8 0.02 Opioid growth factor receptor D4ABV6 OGFR 63 0.8 0.02 Similar to E3 ubiquitin-protein ligase Praja-1 {"type":"entrez-protein","attrs":{"text":"Q66HF7","term_id":"81890522","term_text":"Q66HF7"}} Q66HF7 PJA1 45 0.8 0.03 Synaptopodin {"type":"entrez-protein","attrs":{"text":"Q9Z327","term_id":"48428501","term_text":"Q9Z327"}} Q9Z327 SYNPO 100 0.8 0.03 Ubiquitin carboxyl-terminal hydrolase D3ZN39 USP8 124 0.8 0.03 Serine/threonine protein kinase PAK6 D3ZQ51 PAK6 75 0.8 0.03 Protein Lima1 F1LR10 LIMA1 83 0.3 0.03 CST complex subunit STN1 {"type":"entrez-protein","attrs":{"text":"Q6AYD2","term_id":"62900633","term_text":"Q6AYD2"}} Q6AYD2 OBFC1 47 0.8 0.05 Dnajb5 protein (Fragment) B2GV48 DNAJB5 44 0.8 0.05 Open in a separate window caption a8 Seed list of 13 striatal PSD proteins down-regulated by morphine treatment.

Techniques: Generated, Binding Assay, Histone Deacetylase Assay

Seed list of 13 striatal PSD proteins down-regulated by morphine treatment. Striatal PSD proteins from saline and morphine treated animals (n = 4/group) were subjected to proteomics analysis and quantified as described in Experimental Procedures. Acc. #, accession number; M/S, morphine/saline

Journal: Molecular & Cellular Proteomics : MCP

Article Title: Morphine Regulated Synaptic Networks Revealed by Integrated Proteomics and Network Analysis *

doi: 10.1074/mcp.M115.047977

Figure Lengend Snippet: Seed list of 13 striatal PSD proteins down-regulated by morphine treatment. Striatal PSD proteins from saline and morphine treated animals (n = 4/group) were subjected to proteomics analysis and quantified as described in Experimental Procedures. Acc. #, accession number; M/S, morphine/saline

Article Snippet: M.W. (kDa) Ratio (M/S) p value EST Domain-containing transcription factor ERF D3ZJW0 ERF 59 0.8 0.01 FTS and Hook interacting protein D4A7B7 FAM160A2 99 0.8 0.02 Opioid growth factor receptor D4ABV6 OGFR 63 0.8 0.02 Similar to E3 ubiquitin-protein ligase Praja-1 {"type":"entrez-protein","attrs":{"text":"Q66HF7","term_id":"81890522","term_text":"Q66HF7"}} Q66HF7 PJA1 45 0.8 0.03 Synaptopodin {"type":"entrez-protein","attrs":{"text":"Q9Z327","term_id":"48428501","term_text":"Q9Z327"}} Q9Z327 SYNPO 100 0.8 0.03 Ubiquitin carboxyl-terminal hydrolase D3ZN39 USP8 124 0.8 0.03 Serine/threonine protein kinase PAK6 D3ZQ51 PAK6 75 0.8 0.03 Protein Lima1 F1LR10 LIMA1 83 0.3 0.03 CST complex subunit STN1 {"type":"entrez-protein","attrs":{"text":"Q6AYD2","term_id":"62900633","term_text":"Q6AYD2"}} Q6AYD2 OBFC1 47 0.8 0.05 Dnajb5 protein (Fragment) B2GV48 DNAJB5 44 0.8 0.05 Open in a separate window caption a8 Seed list of 13 striatal PSD proteins down-regulated by morphine treatment.

Techniques:

a RASSF10 expression across human normal tissues (log2, data GTEX— n = 2921—RPKM—ensgtexv4). b Kidney cancer cell lines were analyzed by combined bisulfite restriction analysis (+ Taq I digested; −mock digest) for RASSF10 promoter hypermethylation and 9 out of 15 (60%) were methylated (m). HeLa was used as positive control. HEK293 cell line is partially methylated (pm). c Pharmacological inhibition of DNA-methyl-transferases by 5-Aza-2′deoxycytidine (Aza) significantly reestablished RASSF10 expression in kidney cancer cell lines MZ1257 and MZ1973 ( t -test). RASSF10 was normalized to ß-ACTIN . d In kidney cancer patient samples RASSF10 methylation (cg05817758 in beta value) blocks RASSF10 expression (log2; norm. rsem + 1) shown for renal clear cell and e renal papillary carcinoma. Analyzed using . f RASSF10 inhibition by CRISPR-Cas9 genomic targeting of RASSF10. HEK293 (RASSF10-TetOn) cells were transfected with CRISPR-Cas9 guide RNAs in px549 vector targeting RASSF10 (three guide combinations) for 48 h and RASSF10 was induced by doxycycline for 24 h. g RASSF10 is epigenetically regulated by EZH2 and p300. HEK293 (RASSF10-TetOn) cells were transfected with RASSF10 guide RNAs in px549 (deadCas) targeting RASSF10 and recruiting EZH2(deadCas) or p300(deadCas) for 72 h and RASSF10 was induced by doxycycline for 24 h. Protein lysates were separated by SDS-Page and western blotted with indicated antibodies.

Journal: Oncogene

Article Title: RASSF10 is frequently epigenetically inactivated in kidney cancer and its knockout promotes neoplasia in cancer prone mice

doi: 10.1038/s41388-020-1195-6

Figure Lengend Snippet: a RASSF10 expression across human normal tissues (log2, data GTEX— n = 2921—RPKM—ensgtexv4). b Kidney cancer cell lines were analyzed by combined bisulfite restriction analysis (+ Taq I digested; −mock digest) for RASSF10 promoter hypermethylation and 9 out of 15 (60%) were methylated (m). HeLa was used as positive control. HEK293 cell line is partially methylated (pm). c Pharmacological inhibition of DNA-methyl-transferases by 5-Aza-2′deoxycytidine (Aza) significantly reestablished RASSF10 expression in kidney cancer cell lines MZ1257 and MZ1973 ( t -test). RASSF10 was normalized to ß-ACTIN . d In kidney cancer patient samples RASSF10 methylation (cg05817758 in beta value) blocks RASSF10 expression (log2; norm. rsem + 1) shown for renal clear cell and e renal papillary carcinoma. Analyzed using . f RASSF10 inhibition by CRISPR-Cas9 genomic targeting of RASSF10. HEK293 (RASSF10-TetOn) cells were transfected with CRISPR-Cas9 guide RNAs in px549 vector targeting RASSF10 (three guide combinations) for 48 h and RASSF10 was induced by doxycycline for 24 h. g RASSF10 is epigenetically regulated by EZH2 and p300. HEK293 (RASSF10-TetOn) cells were transfected with RASSF10 guide RNAs in px549 (deadCas) targeting RASSF10 and recruiting EZH2(deadCas) or p300(deadCas) for 72 h and RASSF10 was induced by doxycycline for 24 h. Protein lysates were separated by SDS-Page and western blotted with indicated antibodies.

Article Snippet: EZH2 (Ezh2[SET]-dCas9 Addgene) and p300 (pcDNA-dCas9-p300 Core Addgene) were used as epigenetic modifiers upon cotransfection in HEK293 with guide RNAs(dCas).

Techniques: Expressing, Methylation, Positive Control, Inhibition, CRISPR, Transfection, Plasmid Preparation, SDS Page, Western Blot