erm Search Results


94
Thermo Fisher gene exp etv5 hs00927578 g1
Gene Exp Etv5 Hs00927578 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp etv5 hs00927578 g1/product/Thermo Fisher
Average 94 stars, based on 1 article reviews
gene exp etv5 hs00927578 g1 - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology rabbit anti
Rabbit Anti, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit anti/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
rabbit anti - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

93
Addgene inc cytosol
Bright-field and electron microscopy (EM) images of cultured cells stained <t>by</t> <t>APEX2</t> and its variants. Asterisks indicate the locations of cells lacking APEX2 staining. In some images, earlier versions of APEX2 (such as APEX or dimeric APXW41F) were used, and these cases are explicitly stated. Except where indicated, bright-field images show cells immediately after DAB staining, but before OsO4 staining. All cells were fixed using 2% (vol/vol) glutaraldehyde. (a–c) APEX targeted to the mitochondrial matrix via fusion to an N-terminal-targeting peptide in COS-7 cells. Mitochondria in untransfected cells are visible in b, but lack contrast in the matrix. (d–f) APEX targeted to the nucleus via fusion to a nuclear localization sequence (NLS). (d) COS-7 cells; (e,f) HEK293T cells. The arrowhead in f points to the nuclear membrane. (g–i) Dimeric APXW41F attached to the plasma membrane, facing <t>cytosol,</t> via fusion to the palmitoylation sequence of GAP-43. Expression in cultured rat hippocampal neurons. The neuronal processes in h appear discontinuous because the neuron is not contained within a single thin section. The arrowhead in i points to an APX-stained plasma membrane. (j–l) APEX targeted to the ER lumen via a KDEL localization sequence in COS-7 cells. The EM images show staining from APEX, whereas the bright-field image shows staining from horseradish peroxidase (HRP). This bright-field image of HRP-stained cells was selected because it clearly demonstrates ER morphology. Similar bright-field results can be obtained with APEX2. The arrowhead in l, which is an enlargement of the red box in k, points to DAB-stained ER. The images shown in k and l are from a sample that was published previously12. (m–o) APEX fused to the N-terminal end of the mitochondrial calcium uniporter (MCU), a transmembrane protein of the mitochondrial inner membrane expressed in COS-7 cells. APEX faces the mitochondrial matrix. The arrowhead in o, which is an enlargement of the red box in n, points to APEX staining, which is confined to a subset of sites located between cristae. The images shown in n and o are from a sample that was published previously12. (p–r) APEX fused to histone H2B, a chromatin protein in COS-7 cells. (p) The three APEX-stained nuclei exhibit a range of staining intensities because of variability in expression levels with transient transfection. The arrowhead in r points to a nuclear pore complex. APEX staining of chromatin is visible in the nucleus on the left in r. (s–u) APEX2 fused to α-tubulin expressed in cultured rat hippocampal neurons by lentiviral infection. APEX2 is fused to the N-terminal end of α-tubulin and faces the hollow core of the microtubule polymer. (s) A bright-field image after OsO4 staining and embedding in resin; the OsO4 staining causes APEX2-negative cells to become slightly dark. (t) A neuron with high APEX2 expression and dark staining is visible. (u) In an enlargement of the red box in t, APEX2-stained microtubules are visible in the dendrite at the center (arrowhead), and microtubules lacking contrast from APEX2 are visible at the top (asterisk). The images shown in t and u are from a sample that was published previously15. (v–x) APEX2 fused to β-actin, expressed in cultured hippocampal rat neurons by lentiviral infection. (v) Punctate staining on dendritic spines is visible in a bright-field image after OsO4 staining and embedding in resin; the OsO4 staining causes APEX2-negative cells to become slightly dark. (w) APEX2-stained spines are visible along the dendrite at the center. (x) An APEX2-stained spine at high magnification (enlargement of the red box in w), with synaptic vesicles (SVs) visible in the axon on the left. The images shown in w and x are from a sample that was published previously15. mag, magnification.
Cytosol, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cytosol/product/Addgene inc
Average 93 stars, based on 1 article reviews
cytosol - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

92
Addgene inc plx trc311 etv5
(A) Actinomycin D or vehicle (DMSO) was treated for 48 hrs in acute brain slice cultures. Results are from two independent brain slice cultures (2 mice each for WT and Ataxin-1 KO). n (brain slices) = 3–4. *p < 0.05, **p < 0.01, ***p < 0.001, t-test. (B) Left: extracellular field potential records of multiple unit activity in CA1 areas of brain slices 48 hrs after incubation. Right: histograms representing spike amplitude distribution (bin size 10 mV) and inter-spike interval (bin size 2 ms). (C) Representative real-time qPCR amplification graphs of steady-state (total) and nascent Bace1 mRNA. Brain slices were incubated for 16 hrs in ACSF containing 5-ethynyl uridine. n (brain slices) = 4. (D) Locations of predicted CIC and PEA3 (ETV1/4/5) binding sites in Etv1/4/5 and Bace1 promoter regions, respectively. The CIC binding site in Etv1 promoter is relative distal (−1486) than those in Etv4/5. (E) CIC expression in medial cortex (left) and hippocampal CA1 (right). Bar = 50 μm. (F) mRNA levels of Etv1, Etv4, and <t>Etv5</t> in the cortex and cerebellum. Gapdh was used as an internal control for RT-qPCR.All levels were presented as relative to Etv1-WT (100). Compared to cortex, the relative levels of Etv4 and Etv5 versus Etv1 mRNA are very low in cerebellum. n= 6 (cortex), 4 (cerebellum). (G) Western blot analysis for cortical levels of Ataxin-1, CIC, ETV4, ETV5, BACE1, sAPPβ, and sAPPα. (H) Cerebellar levels of ETV4 and ETV5. Vertical lines indicate that different parts within same blot were placed together for better comparison. (I) Densitometric quantification. n = 5, except ETV4 and ETV5 (n = 7). (J) Luciferase activity in HEK293T cells measured 24 hr after transfection with pGL3 plasmids harboring BACE1 promoter and vectors expressing either ETV4 or ETV5. Results from 3 independent experiments of sextuplicate transfection were normalized and combined. n = 18. See also Figure S2.
Plx Trc311 Etv5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plx trc311 etv5/product/Addgene inc
Average 92 stars, based on 1 article reviews
plx trc311 etv5 - by Bioz Stars, 2026-05
92/100 stars
  Buy from Supplier

90
Cyagen Biosciences targeting mouse etv5 gene
Figure 1. <t>ETV5</t> is regulated by nutrient status in the liver.
Targeting Mouse Etv5 Gene, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/targeting mouse etv5 gene/product/Cyagen Biosciences
Average 90 stars, based on 1 article reviews
targeting mouse etv5 gene - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

93
R&D Systems mouse monoclonal anti etv5 antibody
Figure 4. Global analysis of Etv4 and <t>Etv5</t> binding regions in the genome. (A) Expression of Etv4 and Etv5 by RNA-seq of EpH4 and EpRas cells treated with 1 ng/ml TGF-β for 48 h. FPKM, fragments per kilobase of exons per million mapped fragments. The experiment was performed in two biological replicates. Data are a subset of the findings shown in Supplementary Fig. S2C. (B) Immunoblot analysis of endogenous Etv4 protein expression in EpH4 and EpRas cells. pSmad2, phosphorylated Smad2. (C) Relationship between the anti-Etv4 and anti-Etv5 ChIP-seq data and FAIRE-seq data obtained from TGF-β-treated EpRas cells. (D) De novo motif prediction identifies ETS family (ELK4) binding motif, and shown as in Fig. 3A. Anti-Etv4 ChIP-seq data were used for enriched motif calculation. q value (minimal false discovery rate required to include the motif) is shown. (E) Etv4 and Etv5 binding regions at the Cdh1 and Fn1 gene loci. HBB cluster region is shown as a control. Black bars represent the significant Etv4 and Etv5 binding regions. Significant FAIRE-positive regions in EpH4 and EpRas cells, without (first row) and with (second row) TGF-β stimulation, are shown as blue and red bars, respectively, as a reference (shown in Fig. 2A).
Mouse Monoclonal Anti Etv5 Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse monoclonal anti etv5 antibody/product/R&D Systems
Average 93 stars, based on 1 article reviews
mouse monoclonal anti etv5 antibody - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

93
Addgene inc inducible vector pnbu2 erm tetr p1t dp gh023
Extended Data 1. Characterization of screened gene targets and generation of isogenic knockout and transformant strains. a) Loss-of-function screening identified a transposon insertion mutant (Tn8A7) with depleted BfaGC production. The relative abundance was quantified by LC-MS/MS based on peak area. b) BfaGC production was abrogasted in the B. fragilis Δ3069 mutant. The abundance of BfaGC (C34:0) was quantified by LC-MS/MS based on peak area. c) RNA-seq volcano plot comparing B. fragilis Δ3069 to wild type revealed multiple genes downregulated in Δ3069 mutant. d) The expression of agcT is reduced in B. fragilis Δ3069. Transcript levels of agcT , normalized to leuB , were measured by qRT-PCR. Significance was determined by an unpaired two-tailed t-test. e) Gain-of-function screening identified P. vulgatus transformant producing aGCs. The relative abundance of aGC/Cer was quantified by LC-MS/MS based on peak area. f) agcT -transformed P. vulgatus produced molecules identical to BfaGC. XICs of aGCs from B. fragilis , P. vulgatus wild type and P. vulgatus expressing agcT were displayed. Chromosome-integrated expressing system <t>pNBU2-tetR</t> was used to expressing agcT in P. vulgatus . g) MS/MS spectra mirror plot demonstrated a match between aGCs from P. vulgatus expressing agcT and those from B. fragilis . h) B. thetaiotaomicron and P. vulgatus heterologously expressing agcT produced aGCs. Chromosome-integrated expressing system pNBU2-tetR was used to expressing agcT in B. thetaiotaomicron and P. vulgatus . i) Relative abundance of KDS, ketoCer, Cer, and BfaGC in B. fragilis wild type, Δ spt , Δ cerS , Δ cerR , and Δ agcT were shown. The abundance was quantified by LC-MS/MS based on peak area.
Inducible Vector Pnbu2 Erm Tetr P1t Dp Gh023, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/inducible vector pnbu2 erm tetr p1t dp gh023/product/Addgene inc
Average 93 stars, based on 1 article reviews
inducible vector pnbu2 erm tetr p1t dp gh023 - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

92
Novus Biologicals rabbit antietv5 antibody
Extended Data 1. Characterization of screened gene targets and generation of isogenic knockout and transformant strains. a) Loss-of-function screening identified a transposon insertion mutant (Tn8A7) with depleted BfaGC production. The relative abundance was quantified by LC-MS/MS based on peak area. b) BfaGC production was abrogasted in the B. fragilis Δ3069 mutant. The abundance of BfaGC (C34:0) was quantified by LC-MS/MS based on peak area. c) RNA-seq volcano plot comparing B. fragilis Δ3069 to wild type revealed multiple genes downregulated in Δ3069 mutant. d) The expression of agcT is reduced in B. fragilis Δ3069. Transcript levels of agcT , normalized to leuB , were measured by qRT-PCR. Significance was determined by an unpaired two-tailed t-test. e) Gain-of-function screening identified P. vulgatus transformant producing aGCs. The relative abundance of aGC/Cer was quantified by LC-MS/MS based on peak area. f) agcT -transformed P. vulgatus produced molecules identical to BfaGC. XICs of aGCs from B. fragilis , P. vulgatus wild type and P. vulgatus expressing agcT were displayed. Chromosome-integrated expressing system <t>pNBU2-tetR</t> was used to expressing agcT in P. vulgatus . g) MS/MS spectra mirror plot demonstrated a match between aGCs from P. vulgatus expressing agcT and those from B. fragilis . h) B. thetaiotaomicron and P. vulgatus heterologously expressing agcT produced aGCs. Chromosome-integrated expressing system pNBU2-tetR was used to expressing agcT in B. thetaiotaomicron and P. vulgatus . i) Relative abundance of KDS, ketoCer, Cer, and BfaGC in B. fragilis wild type, Δ spt , Δ cerS , Δ cerR , and Δ agcT were shown. The abundance was quantified by LC-MS/MS based on peak area.
Rabbit Antietv5 Antibody, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit antietv5 antibody/product/Novus Biologicals
Average 92 stars, based on 1 article reviews
rabbit antietv5 antibody - by Bioz Stars, 2026-05
92/100 stars
  Buy from Supplier

94
Cell Signaling Technology Inc etv5
Extended Data 1. Characterization of screened gene targets and generation of isogenic knockout and transformant strains. a) Loss-of-function screening identified a transposon insertion mutant (Tn8A7) with depleted BfaGC production. The relative abundance was quantified by LC-MS/MS based on peak area. b) BfaGC production was abrogasted in the B. fragilis Δ3069 mutant. The abundance of BfaGC (C34:0) was quantified by LC-MS/MS based on peak area. c) RNA-seq volcano plot comparing B. fragilis Δ3069 to wild type revealed multiple genes downregulated in Δ3069 mutant. d) The expression of agcT is reduced in B. fragilis Δ3069. Transcript levels of agcT , normalized to leuB , were measured by qRT-PCR. Significance was determined by an unpaired two-tailed t-test. e) Gain-of-function screening identified P. vulgatus transformant producing aGCs. The relative abundance of aGC/Cer was quantified by LC-MS/MS based on peak area. f) agcT -transformed P. vulgatus produced molecules identical to BfaGC. XICs of aGCs from B. fragilis , P. vulgatus wild type and P. vulgatus expressing agcT were displayed. Chromosome-integrated expressing system <t>pNBU2-tetR</t> was used to expressing agcT in P. vulgatus . g) MS/MS spectra mirror plot demonstrated a match between aGCs from P. vulgatus expressing agcT and those from B. fragilis . h) B. thetaiotaomicron and P. vulgatus heterologously expressing agcT produced aGCs. Chromosome-integrated expressing system pNBU2-tetR was used to expressing agcT in B. thetaiotaomicron and P. vulgatus . i) Relative abundance of KDS, ketoCer, Cer, and BfaGC in B. fragilis wild type, Δ spt , Δ cerS , Δ cerR , and Δ agcT were shown. The abundance was quantified by LC-MS/MS based on peak area.
Etv5, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/etv5/product/Cell Signaling Technology Inc
Average 94 stars, based on 1 article reviews
etv5 - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier

93
Addgene inc plx208 cmv hygro plasmid
Extended Data 1. Characterization of screened gene targets and generation of isogenic knockout and transformant strains. a) Loss-of-function screening identified a transposon insertion mutant (Tn8A7) with depleted BfaGC production. The relative abundance was quantified by LC-MS/MS based on peak area. b) BfaGC production was abrogasted in the B. fragilis Δ3069 mutant. The abundance of BfaGC (C34:0) was quantified by LC-MS/MS based on peak area. c) RNA-seq volcano plot comparing B. fragilis Δ3069 to wild type revealed multiple genes downregulated in Δ3069 mutant. d) The expression of agcT is reduced in B. fragilis Δ3069. Transcript levels of agcT , normalized to leuB , were measured by qRT-PCR. Significance was determined by an unpaired two-tailed t-test. e) Gain-of-function screening identified P. vulgatus transformant producing aGCs. The relative abundance of aGC/Cer was quantified by LC-MS/MS based on peak area. f) agcT -transformed P. vulgatus produced molecules identical to BfaGC. XICs of aGCs from B. fragilis , P. vulgatus wild type and P. vulgatus expressing agcT were displayed. Chromosome-integrated expressing system <t>pNBU2-tetR</t> was used to expressing agcT in P. vulgatus . g) MS/MS spectra mirror plot demonstrated a match between aGCs from P. vulgatus expressing agcT and those from B. fragilis . h) B. thetaiotaomicron and P. vulgatus heterologously expressing agcT produced aGCs. Chromosome-integrated expressing system pNBU2-tetR was used to expressing agcT in B. thetaiotaomicron and P. vulgatus . i) Relative abundance of KDS, ketoCer, Cer, and BfaGC in B. fragilis wild type, Δ spt , Δ cerS , Δ cerR , and Δ agcT were shown. The abundance was quantified by LC-MS/MS based on peak area.
Plx208 Cmv Hygro Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plx208 cmv hygro plasmid/product/Addgene inc
Average 93 stars, based on 1 article reviews
plx208 cmv hygro plasmid - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

91
Proteintech ermn
Detail of hub genes in each significant module
Ermn, supplied by Proteintech, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ermn/product/Proteintech
Average 91 stars, based on 1 article reviews
ermn - by Bioz Stars, 2026-05
91/100 stars
  Buy from Supplier

Image Search Results


Bright-field and electron microscopy (EM) images of cultured cells stained by APEX2 and its variants. Asterisks indicate the locations of cells lacking APEX2 staining. In some images, earlier versions of APEX2 (such as APEX or dimeric APXW41F) were used, and these cases are explicitly stated. Except where indicated, bright-field images show cells immediately after DAB staining, but before OsO4 staining. All cells were fixed using 2% (vol/vol) glutaraldehyde. (a–c) APEX targeted to the mitochondrial matrix via fusion to an N-terminal-targeting peptide in COS-7 cells. Mitochondria in untransfected cells are visible in b, but lack contrast in the matrix. (d–f) APEX targeted to the nucleus via fusion to a nuclear localization sequence (NLS). (d) COS-7 cells; (e,f) HEK293T cells. The arrowhead in f points to the nuclear membrane. (g–i) Dimeric APXW41F attached to the plasma membrane, facing cytosol, via fusion to the palmitoylation sequence of GAP-43. Expression in cultured rat hippocampal neurons. The neuronal processes in h appear discontinuous because the neuron is not contained within a single thin section. The arrowhead in i points to an APX-stained plasma membrane. (j–l) APEX targeted to the ER lumen via a KDEL localization sequence in COS-7 cells. The EM images show staining from APEX, whereas the bright-field image shows staining from horseradish peroxidase (HRP). This bright-field image of HRP-stained cells was selected because it clearly demonstrates ER morphology. Similar bright-field results can be obtained with APEX2. The arrowhead in l, which is an enlargement of the red box in k, points to DAB-stained ER. The images shown in k and l are from a sample that was published previously12. (m–o) APEX fused to the N-terminal end of the mitochondrial calcium uniporter (MCU), a transmembrane protein of the mitochondrial inner membrane expressed in COS-7 cells. APEX faces the mitochondrial matrix. The arrowhead in o, which is an enlargement of the red box in n, points to APEX staining, which is confined to a subset of sites located between cristae. The images shown in n and o are from a sample that was published previously12. (p–r) APEX fused to histone H2B, a chromatin protein in COS-7 cells. (p) The three APEX-stained nuclei exhibit a range of staining intensities because of variability in expression levels with transient transfection. The arrowhead in r points to a nuclear pore complex. APEX staining of chromatin is visible in the nucleus on the left in r. (s–u) APEX2 fused to α-tubulin expressed in cultured rat hippocampal neurons by lentiviral infection. APEX2 is fused to the N-terminal end of α-tubulin and faces the hollow core of the microtubule polymer. (s) A bright-field image after OsO4 staining and embedding in resin; the OsO4 staining causes APEX2-negative cells to become slightly dark. (t) A neuron with high APEX2 expression and dark staining is visible. (u) In an enlargement of the red box in t, APEX2-stained microtubules are visible in the dendrite at the center (arrowhead), and microtubules lacking contrast from APEX2 are visible at the top (asterisk). The images shown in t and u are from a sample that was published previously15. (v–x) APEX2 fused to β-actin, expressed in cultured hippocampal rat neurons by lentiviral infection. (v) Punctate staining on dendritic spines is visible in a bright-field image after OsO4 staining and embedding in resin; the OsO4 staining causes APEX2-negative cells to become slightly dark. (w) APEX2-stained spines are visible along the dendrite at the center. (x) An APEX2-stained spine at high magnification (enlargement of the red box in w), with synaptic vesicles (SVs) visible in the axon on the left. The images shown in w and x are from a sample that was published previously15. mag, magnification.

Journal: Nature protocols

Article Title: Electron microscopy using the genetically encoded APEX2 tag in cultured mammalian cells

doi: 10.1038/nprot.2017.065

Figure Lengend Snippet: Bright-field and electron microscopy (EM) images of cultured cells stained by APEX2 and its variants. Asterisks indicate the locations of cells lacking APEX2 staining. In some images, earlier versions of APEX2 (such as APEX or dimeric APXW41F) were used, and these cases are explicitly stated. Except where indicated, bright-field images show cells immediately after DAB staining, but before OsO4 staining. All cells were fixed using 2% (vol/vol) glutaraldehyde. (a–c) APEX targeted to the mitochondrial matrix via fusion to an N-terminal-targeting peptide in COS-7 cells. Mitochondria in untransfected cells are visible in b, but lack contrast in the matrix. (d–f) APEX targeted to the nucleus via fusion to a nuclear localization sequence (NLS). (d) COS-7 cells; (e,f) HEK293T cells. The arrowhead in f points to the nuclear membrane. (g–i) Dimeric APXW41F attached to the plasma membrane, facing cytosol, via fusion to the palmitoylation sequence of GAP-43. Expression in cultured rat hippocampal neurons. The neuronal processes in h appear discontinuous because the neuron is not contained within a single thin section. The arrowhead in i points to an APX-stained plasma membrane. (j–l) APEX targeted to the ER lumen via a KDEL localization sequence in COS-7 cells. The EM images show staining from APEX, whereas the bright-field image shows staining from horseradish peroxidase (HRP). This bright-field image of HRP-stained cells was selected because it clearly demonstrates ER morphology. Similar bright-field results can be obtained with APEX2. The arrowhead in l, which is an enlargement of the red box in k, points to DAB-stained ER. The images shown in k and l are from a sample that was published previously12. (m–o) APEX fused to the N-terminal end of the mitochondrial calcium uniporter (MCU), a transmembrane protein of the mitochondrial inner membrane expressed in COS-7 cells. APEX faces the mitochondrial matrix. The arrowhead in o, which is an enlargement of the red box in n, points to APEX staining, which is confined to a subset of sites located between cristae. The images shown in n and o are from a sample that was published previously12. (p–r) APEX fused to histone H2B, a chromatin protein in COS-7 cells. (p) The three APEX-stained nuclei exhibit a range of staining intensities because of variability in expression levels with transient transfection. The arrowhead in r points to a nuclear pore complex. APEX staining of chromatin is visible in the nucleus on the left in r. (s–u) APEX2 fused to α-tubulin expressed in cultured rat hippocampal neurons by lentiviral infection. APEX2 is fused to the N-terminal end of α-tubulin and faces the hollow core of the microtubule polymer. (s) A bright-field image after OsO4 staining and embedding in resin; the OsO4 staining causes APEX2-negative cells to become slightly dark. (t) A neuron with high APEX2 expression and dark staining is visible. (u) In an enlargement of the red box in t, APEX2-stained microtubules are visible in the dendrite at the center (arrowhead), and microtubules lacking contrast from APEX2 are visible at the top (asterisk). The images shown in t and u are from a sample that was published previously15. (v–x) APEX2 fused to β-actin, expressed in cultured hippocampal rat neurons by lentiviral infection. (v) Punctate staining on dendritic spines is visible in a bright-field image after OsO4 staining and embedding in resin; the OsO4 staining causes APEX2-negative cells to become slightly dark. (w) APEX2-stained spines are visible along the dendrite at the center. (x) An APEX2-stained spine at high magnification (enlargement of the red box in w), with synaptic vesicles (SVs) visible in the axon on the left. The images shown in w and x are from a sample that was published previously15. mag, magnification.

Article Snippet: If you need to prepare a new construct, see ‘Experimental design’ section for guidelines. mito-V5-APEX2: APEX2 localized to the mitochondrial matrix (Addgene, cat. no. 72480) APEX2-NES: APEX2 localized to the cytosol, but excluded from the nucleus (Addgene, cat. no. 49386) IMS-APEX2: APEX2 localized to mitochondrial intermembrane space (Addgene, cat. no. 79058) APEX2-OMM: APEX2 localized to the mitochondrial outer membrane, facing cytosol (Addgene, cat. no. 79056) ERM-APEX2: APEX2 localized to the ER membrane, facing cytosol (Addgene, cat. no. 79055) MICU1-APEX2: APEX2 fused to the mitochondrial intermembrane space protein MICU1 (Addgene, cat. no. 79057) Vimentin-APEX2: APEX2 fused to the cytoskeletal protein vimentin (Addgene, cat. no. 66170) APEX2-Tubulin: APEX2 fused to the cytoskeletal protein tubulin (Addgene, cat. no. 66171) APEX2-Actin: APEX2 fused to the cytoskeletal protein actin (Addgene, cat. no. 66172) Connexin43-GFP-APEX2: APEX2 fused in tandem with GFP to the gap junction protein connexin43 (Addgene, cat. no. 49385)

Techniques: Electron Microscopy, Cell Culture, Staining, Sequencing, Membrane, Clinical Proteomics, Expressing, Transfection, Infection, Polymer

Troubleshooting table.

Journal: Nature protocols

Article Title: Electron microscopy using the genetically encoded APEX2 tag in cultured mammalian cells

doi: 10.1038/nprot.2017.065

Figure Lengend Snippet: Troubleshooting table.

Article Snippet: If you need to prepare a new construct, see ‘Experimental design’ section for guidelines. mito-V5-APEX2: APEX2 localized to the mitochondrial matrix (Addgene, cat. no. 72480) APEX2-NES: APEX2 localized to the cytosol, but excluded from the nucleus (Addgene, cat. no. 49386) IMS-APEX2: APEX2 localized to mitochondrial intermembrane space (Addgene, cat. no. 79058) APEX2-OMM: APEX2 localized to the mitochondrial outer membrane, facing cytosol (Addgene, cat. no. 79056) ERM-APEX2: APEX2 localized to the ER membrane, facing cytosol (Addgene, cat. no. 79055) MICU1-APEX2: APEX2 fused to the mitochondrial intermembrane space protein MICU1 (Addgene, cat. no. 79057) Vimentin-APEX2: APEX2 fused to the cytoskeletal protein vimentin (Addgene, cat. no. 66170) APEX2-Tubulin: APEX2 fused to the cytoskeletal protein tubulin (Addgene, cat. no. 66171) APEX2-Actin: APEX2 fused to the cytoskeletal protein actin (Addgene, cat. no. 66172) Connexin43-GFP-APEX2: APEX2 fused in tandem with GFP to the gap junction protein connexin43 (Addgene, cat. no. 49385)

Techniques: Staining, Light Microscopy, Transfection, Gentle, Modification, Positive Control, Construct, Plasmid Preparation, Imaging, Concentration Assay, Incubation, Labeling, Activity Assay, Fluorescence, Western Blot, Immunostaining, Isolation, Glycoproteomics, Introduce, Expressing, Recombinant, Over Expression, Blocking Assay, Knock-In, Membrane, Cell Culture, Preserving, Infection, Negative Control

(A) Actinomycin D or vehicle (DMSO) was treated for 48 hrs in acute brain slice cultures. Results are from two independent brain slice cultures (2 mice each for WT and Ataxin-1 KO). n (brain slices) = 3–4. *p < 0.05, **p < 0.01, ***p < 0.001, t-test. (B) Left: extracellular field potential records of multiple unit activity in CA1 areas of brain slices 48 hrs after incubation. Right: histograms representing spike amplitude distribution (bin size 10 mV) and inter-spike interval (bin size 2 ms). (C) Representative real-time qPCR amplification graphs of steady-state (total) and nascent Bace1 mRNA. Brain slices were incubated for 16 hrs in ACSF containing 5-ethynyl uridine. n (brain slices) = 4. (D) Locations of predicted CIC and PEA3 (ETV1/4/5) binding sites in Etv1/4/5 and Bace1 promoter regions, respectively. The CIC binding site in Etv1 promoter is relative distal (−1486) than those in Etv4/5. (E) CIC expression in medial cortex (left) and hippocampal CA1 (right). Bar = 50 μm. (F) mRNA levels of Etv1, Etv4, and Etv5 in the cortex and cerebellum. Gapdh was used as an internal control for RT-qPCR.All levels were presented as relative to Etv1-WT (100). Compared to cortex, the relative levels of Etv4 and Etv5 versus Etv1 mRNA are very low in cerebellum. n= 6 (cortex), 4 (cerebellum). (G) Western blot analysis for cortical levels of Ataxin-1, CIC, ETV4, ETV5, BACE1, sAPPβ, and sAPPα. (H) Cerebellar levels of ETV4 and ETV5. Vertical lines indicate that different parts within same blot were placed together for better comparison. (I) Densitometric quantification. n = 5, except ETV4 and ETV5 (n = 7). (J) Luciferase activity in HEK293T cells measured 24 hr after transfection with pGL3 plasmids harboring BACE1 promoter and vectors expressing either ETV4 or ETV5. Results from 3 independent experiments of sextuplicate transfection were normalized and combined. n = 18. See also Figure S2.

Journal: Cell

Article Title: Loss of Ataxin-1 Potentiates Alzheimer's Pathogenesis by Elevating Cerebral BACE1 Transcription

doi: 10.1016/j.cell.2019.07.043

Figure Lengend Snippet: (A) Actinomycin D or vehicle (DMSO) was treated for 48 hrs in acute brain slice cultures. Results are from two independent brain slice cultures (2 mice each for WT and Ataxin-1 KO). n (brain slices) = 3–4. *p < 0.05, **p < 0.01, ***p < 0.001, t-test. (B) Left: extracellular field potential records of multiple unit activity in CA1 areas of brain slices 48 hrs after incubation. Right: histograms representing spike amplitude distribution (bin size 10 mV) and inter-spike interval (bin size 2 ms). (C) Representative real-time qPCR amplification graphs of steady-state (total) and nascent Bace1 mRNA. Brain slices were incubated for 16 hrs in ACSF containing 5-ethynyl uridine. n (brain slices) = 4. (D) Locations of predicted CIC and PEA3 (ETV1/4/5) binding sites in Etv1/4/5 and Bace1 promoter regions, respectively. The CIC binding site in Etv1 promoter is relative distal (−1486) than those in Etv4/5. (E) CIC expression in medial cortex (left) and hippocampal CA1 (right). Bar = 50 μm. (F) mRNA levels of Etv1, Etv4, and Etv5 in the cortex and cerebellum. Gapdh was used as an internal control for RT-qPCR.All levels were presented as relative to Etv1-WT (100). Compared to cortex, the relative levels of Etv4 and Etv5 versus Etv1 mRNA are very low in cerebellum. n= 6 (cortex), 4 (cerebellum). (G) Western blot analysis for cortical levels of Ataxin-1, CIC, ETV4, ETV5, BACE1, sAPPβ, and sAPPα. (H) Cerebellar levels of ETV4 and ETV5. Vertical lines indicate that different parts within same blot were placed together for better comparison. (I) Densitometric quantification. n = 5, except ETV4 and ETV5 (n = 7). (J) Luciferase activity in HEK293T cells measured 24 hr after transfection with pGL3 plasmids harboring BACE1 promoter and vectors expressing either ETV4 or ETV5. Results from 3 independent experiments of sextuplicate transfection were normalized and combined. n = 18. See also Figure S2.

Article Snippet: One day after seeding, the cells were transfected with 100 ng pGL3-BACE1 promoter, 50 ng pRL-TK (for renilla luciferase expression, Promega), and either 200 ng of pLX_TRC311 (Addgene #113668), pLX_TRC311 ETV4-S (Addgene #74983), pLX_TRC311 ETV4-L (Addgene #74982), or pLX_TRC311 ETV5 (Addgene #74984) using jetPrime transfection reagent (Polyplus transfection) according to manufacturer’s instructions.

Techniques: Slice Preparation, Activity Assay, Incubation, Amplification, Binding Assay, Expressing, Quantitative RT-PCR, Western Blot, Luciferase, Transfection

KEY RESOURCES TABLE

Journal: Cell

Article Title: Loss of Ataxin-1 Potentiates Alzheimer's Pathogenesis by Elevating Cerebral BACE1 Transcription

doi: 10.1016/j.cell.2019.07.043

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: One day after seeding, the cells were transfected with 100 ng pGL3-BACE1 promoter, 50 ng pRL-TK (for renilla luciferase expression, Promega), and either 200 ng of pLX_TRC311 (Addgene #113668), pLX_TRC311 ETV4-S (Addgene #74983), pLX_TRC311 ETV4-L (Addgene #74982), or pLX_TRC311 ETV5 (Addgene #74984) using jetPrime transfection reagent (Polyplus transfection) according to manufacturer’s instructions.

Techniques: Recombinant, Plasmid Preparation, Enzyme-linked Immunosorbent Assay, Luciferase, Reporter Assay, Staining, Expressing, Knock-In, SYBR Green Assay, Clone Assay, Mutagenesis, Software, Microscopy, Real-time Polymerase Chain Reaction, Transfection

Figure 1. ETV5 is regulated by nutrient status in the liver.

Journal: Diabetes

Article Title: ETV5 Regulates Hepatic Fatty Acid Metabolism Through PPAR Signaling Pathway.

doi: 10.2337/db20-0619

Figure Lengend Snippet: Figure 1. ETV5 is regulated by nutrient status in the liver.

Article Snippet: Lentivirus production Recombinant lentivirus containing shETV5 construct were generated by the Cyagen (Guangzhou) using the sequence “TACATGAGAGGCGGGTATTTC” or “CCGAAGGCTTCGCTTACTAAG” targeting mouse Etv5 gene.

Techniques:

Figure 4. Liver specific depletion of ETV5 in mice leads to increased lipid accumulation in liver.

Journal: Diabetes

Article Title: ETV5 Regulates Hepatic Fatty Acid Metabolism Through PPAR Signaling Pathway.

doi: 10.2337/db20-0619

Figure Lengend Snippet: Figure 4. Liver specific depletion of ETV5 in mice leads to increased lipid accumulation in liver.

Article Snippet: Lentivirus production Recombinant lentivirus containing shETV5 construct were generated by the Cyagen (Guangzhou) using the sequence “TACATGAGAGGCGGGTATTTC” or “CCGAAGGCTTCGCTTACTAAG” targeting mouse Etv5 gene.

Techniques:

Figure 4. Global analysis of Etv4 and Etv5 binding regions in the genome. (A) Expression of Etv4 and Etv5 by RNA-seq of EpH4 and EpRas cells treated with 1 ng/ml TGF-β for 48 h. FPKM, fragments per kilobase of exons per million mapped fragments. The experiment was performed in two biological replicates. Data are a subset of the findings shown in Supplementary Fig. S2C. (B) Immunoblot analysis of endogenous Etv4 protein expression in EpH4 and EpRas cells. pSmad2, phosphorylated Smad2. (C) Relationship between the anti-Etv4 and anti-Etv5 ChIP-seq data and FAIRE-seq data obtained from TGF-β-treated EpRas cells. (D) De novo motif prediction identifies ETS family (ELK4) binding motif, and shown as in Fig. 3A. Anti-Etv4 ChIP-seq data were used for enriched motif calculation. q value (minimal false discovery rate required to include the motif) is shown. (E) Etv4 and Etv5 binding regions at the Cdh1 and Fn1 gene loci. HBB cluster region is shown as a control. Black bars represent the significant Etv4 and Etv5 binding regions. Significant FAIRE-positive regions in EpH4 and EpRas cells, without (first row) and with (second row) TGF-β stimulation, are shown as blue and red bars, respectively, as a reference (shown in Fig. 2A).

Journal: Scientific reports

Article Title: Dynamics of chromatin accessibility during TGF-β-induced EMT of Ras-transformed mammary gland epithelial cells.

doi: 10.1038/s41598-017-00973-4

Figure Lengend Snippet: Figure 4. Global analysis of Etv4 and Etv5 binding regions in the genome. (A) Expression of Etv4 and Etv5 by RNA-seq of EpH4 and EpRas cells treated with 1 ng/ml TGF-β for 48 h. FPKM, fragments per kilobase of exons per million mapped fragments. The experiment was performed in two biological replicates. Data are a subset of the findings shown in Supplementary Fig. S2C. (B) Immunoblot analysis of endogenous Etv4 protein expression in EpH4 and EpRas cells. pSmad2, phosphorylated Smad2. (C) Relationship between the anti-Etv4 and anti-Etv5 ChIP-seq data and FAIRE-seq data obtained from TGF-β-treated EpRas cells. (D) De novo motif prediction identifies ETS family (ELK4) binding motif, and shown as in Fig. 3A. Anti-Etv4 ChIP-seq data were used for enriched motif calculation. q value (minimal false discovery rate required to include the motif) is shown. (E) Etv4 and Etv5 binding regions at the Cdh1 and Fn1 gene loci. HBB cluster region is shown as a control. Black bars represent the significant Etv4 and Etv5 binding regions. Significant FAIRE-positive regions in EpH4 and EpRas cells, without (first row) and with (second row) TGF-β stimulation, are shown as blue and red bars, respectively, as a reference (shown in Fig. 2A).

Article Snippet: Rabbit polyclonal anti-Etv4 antibody, previously used for ChIP-seq by Hollenhorst et al.54, was from AVIVA Systems Biology (ARP32263, San Diego, CA, USA), and mouse monoclonal anti-Etv5 antibody (MAB7107) was from R&D Systems.

Techniques: Binding Assay, Expressing, RNA Sequencing, Western Blot, ChIP-sequencing, Control

Figure 5. Effect of Etv4 and Etv5 siRNAs on stress fiber formation, cell invasiveness and global gene expression in EpRas cells. (A) Effect of the siRNAs on the expression of Etv4 protein. EpRas cells were transfected with the siRNAs as indicated. After 24 h of incubation, cells were treated with TGF-β for additional 48 h and lysed for immunoblotting analysis. (B) Effect of Etv4/5 siRNAs on the TGF-β-induced down-regulation of E-cadherin protein. siRNA-transfected cells were treated with TGF-β for 8 days. Transfection of siRNAs were repeated at day 2 and 5. (C) Effect of Etv4/5 siRNAs on the stress fiber formation induced by TGF-β. F-actin formation of EpRas cells was evaluated by phalloidin staining. Cells were transfected with siRNAs for Etv4/5 and stimulated with TGF-β for 48 h. (D) Matrigel invasion assay in EpRas cells. Cells were transfected with the indicated siRNAs and then seeded on the Matrigel-coated plate, incubated for 48 h with TGF-β, and fixed. (upper panels) Representative images of the cells that migrated through the Matrigel-coated membrane. (bottom graph) Quantified data representing the means of four independent experiments. Error bars, standard deviations. (E and F) EpRas cells were transfected with siRNAs for Etv4/5 and treated with 1 ng/ml TGF-β for 48 h. Then, RNA-seq and ontology analysis using GSEA were performed. Genes with maximum FPKM (fragments per kilobase of exon per million mapped sequence reads) values ≥5 among the samples were selected for evaluation. (E) A list of top-enriched c5 (gene ontology) gene sets (MSigDB) downregulated by siEtv4/5 in the absence of TGF-β. The averaged gene expression data from the two distinct sets of siEtv4/5-transfected cells were compared to the data from the siNC-transfected cells. SIZE: number of genes in the phenotype, NES: normalized enrichment score, FDR: false discovery rate. (F) An enrichment plot showing the up-regulation of a gene set “EXTRACELLULAR REGION” by Etv4 and Etv5, which was identified as the top-enriched phenotype by GSEA.

Journal: Scientific reports

Article Title: Dynamics of chromatin accessibility during TGF-β-induced EMT of Ras-transformed mammary gland epithelial cells.

doi: 10.1038/s41598-017-00973-4

Figure Lengend Snippet: Figure 5. Effect of Etv4 and Etv5 siRNAs on stress fiber formation, cell invasiveness and global gene expression in EpRas cells. (A) Effect of the siRNAs on the expression of Etv4 protein. EpRas cells were transfected with the siRNAs as indicated. After 24 h of incubation, cells were treated with TGF-β for additional 48 h and lysed for immunoblotting analysis. (B) Effect of Etv4/5 siRNAs on the TGF-β-induced down-regulation of E-cadherin protein. siRNA-transfected cells were treated with TGF-β for 8 days. Transfection of siRNAs were repeated at day 2 and 5. (C) Effect of Etv4/5 siRNAs on the stress fiber formation induced by TGF-β. F-actin formation of EpRas cells was evaluated by phalloidin staining. Cells were transfected with siRNAs for Etv4/5 and stimulated with TGF-β for 48 h. (D) Matrigel invasion assay in EpRas cells. Cells were transfected with the indicated siRNAs and then seeded on the Matrigel-coated plate, incubated for 48 h with TGF-β, and fixed. (upper panels) Representative images of the cells that migrated through the Matrigel-coated membrane. (bottom graph) Quantified data representing the means of four independent experiments. Error bars, standard deviations. (E and F) EpRas cells were transfected with siRNAs for Etv4/5 and treated with 1 ng/ml TGF-β for 48 h. Then, RNA-seq and ontology analysis using GSEA were performed. Genes with maximum FPKM (fragments per kilobase of exon per million mapped sequence reads) values ≥5 among the samples were selected for evaluation. (E) A list of top-enriched c5 (gene ontology) gene sets (MSigDB) downregulated by siEtv4/5 in the absence of TGF-β. The averaged gene expression data from the two distinct sets of siEtv4/5-transfected cells were compared to the data from the siNC-transfected cells. SIZE: number of genes in the phenotype, NES: normalized enrichment score, FDR: false discovery rate. (F) An enrichment plot showing the up-regulation of a gene set “EXTRACELLULAR REGION” by Etv4 and Etv5, which was identified as the top-enriched phenotype by GSEA.

Article Snippet: Rabbit polyclonal anti-Etv4 antibody, previously used for ChIP-seq by Hollenhorst et al.54, was from AVIVA Systems Biology (ARP32263, San Diego, CA, USA), and mouse monoclonal anti-Etv5 antibody (MAB7107) was from R&D Systems.

Techniques: Gene Expression, Expressing, Transfection, Incubation, Western Blot, Staining, Invasion Assay, Membrane, RNA Sequencing, Sequencing

Figure 6. Regulation of Mmp13 expression by Etv4 and Etv5. (A) FAIRE-seq and ChIP-seq data at the matrix metalloproteinase 13 (Mmp13) gene locus as a target of Etv4 and 5. Data are shown as in Figs 2A and 4E. Arrow heads show the positions evaluated by FAIRE-qPCR in (D). (B) RNA-seq data of siEtv4/5-transfected EpRas cells treated with TGF-β. siNC; negative control siRNA. Error bars, 95% confidence intervals. (C) Matrigel invasion assay in EpRas cells. Cells were transfected with the indicated siRNAs and then seeded on the Matrigel- coated plate, incubated for 48 h with TGF-β, and fixed. (upper panels) Representative images of the cells that migrated through the Matrigel-coated membrane. (bottom graph) Quantified data representing the means of four independent experiments. Error bars, standard deviations. (D) Changes in the FAIRE-seq signal intensities by Etv4/5 siRNAs at FAIRE-positive regions of Mmp13 gene locus shown in (A). EpRas cells transfected with the indicated siRNAs were treated with TGF-β for 4 days and fixed for FAIRE-seq data acquisition. The data represent the result of two biological replicates. Error bars, standard deviations.

Journal: Scientific reports

Article Title: Dynamics of chromatin accessibility during TGF-β-induced EMT of Ras-transformed mammary gland epithelial cells.

doi: 10.1038/s41598-017-00973-4

Figure Lengend Snippet: Figure 6. Regulation of Mmp13 expression by Etv4 and Etv5. (A) FAIRE-seq and ChIP-seq data at the matrix metalloproteinase 13 (Mmp13) gene locus as a target of Etv4 and 5. Data are shown as in Figs 2A and 4E. Arrow heads show the positions evaluated by FAIRE-qPCR in (D). (B) RNA-seq data of siEtv4/5-transfected EpRas cells treated with TGF-β. siNC; negative control siRNA. Error bars, 95% confidence intervals. (C) Matrigel invasion assay in EpRas cells. Cells were transfected with the indicated siRNAs and then seeded on the Matrigel- coated plate, incubated for 48 h with TGF-β, and fixed. (upper panels) Representative images of the cells that migrated through the Matrigel-coated membrane. (bottom graph) Quantified data representing the means of four independent experiments. Error bars, standard deviations. (D) Changes in the FAIRE-seq signal intensities by Etv4/5 siRNAs at FAIRE-positive regions of Mmp13 gene locus shown in (A). EpRas cells transfected with the indicated siRNAs were treated with TGF-β for 4 days and fixed for FAIRE-seq data acquisition. The data represent the result of two biological replicates. Error bars, standard deviations.

Article Snippet: Rabbit polyclonal anti-Etv4 antibody, previously used for ChIP-seq by Hollenhorst et al.54, was from AVIVA Systems Biology (ARP32263, San Diego, CA, USA), and mouse monoclonal anti-Etv5 antibody (MAB7107) was from R&D Systems.

Techniques: Expressing, ChIP-sequencing, RNA Sequencing, Transfection, Negative Control, Invasion Assay, Incubation, Membrane

Figure 7. Effect of Etv4/5 siRNAs on the global chromatin accessibility. (A) Scatter plots showing the effect of TGF-β (X-axis) and Etv4/5 siRNAs (Y-axis) on the genome-wide chromatin accessibility determined by FAIRE-seq. Note that there was a significant correlation between the effect of two different siRNA sets (r = 0.51, p < 2.2e-16, Supplementary Fig. S7). (B) Enrichment of ETS binding motif in the FAIRE-positive regions of EpRas cells treated by TGF-β and siRNAs as indicated. (C) A schematic model for regulation of EMT-related gene expression through the differential expression of transcription factors and alteration of chromatin accessibility. In the process of EMT, chromatins are gradually closed by Ras and TGF-β at the Cdh1/E-cadherin gene locus. In contrast, upregulated genes are regulated by a variety of mechanisms. The Fn1/fibronectin gene locus is open irrespective of Ras and TGF-β treatment, while Cdh2/N-cadherin gene locus becomes accessible upon Ras transformation, and the Mmp13 gene locus becomes accessible upon Ras transformation and TGF-β stimulation. Differentially expressed transcription factors, Etv4 and Etv5, are responsible for a subset of EMT- related changes in gene expression partially through the alteration of chromatin accessibility.

Journal: Scientific reports

Article Title: Dynamics of chromatin accessibility during TGF-β-induced EMT of Ras-transformed mammary gland epithelial cells.

doi: 10.1038/s41598-017-00973-4

Figure Lengend Snippet: Figure 7. Effect of Etv4/5 siRNAs on the global chromatin accessibility. (A) Scatter plots showing the effect of TGF-β (X-axis) and Etv4/5 siRNAs (Y-axis) on the genome-wide chromatin accessibility determined by FAIRE-seq. Note that there was a significant correlation between the effect of two different siRNA sets (r = 0.51, p < 2.2e-16, Supplementary Fig. S7). (B) Enrichment of ETS binding motif in the FAIRE-positive regions of EpRas cells treated by TGF-β and siRNAs as indicated. (C) A schematic model for regulation of EMT-related gene expression through the differential expression of transcription factors and alteration of chromatin accessibility. In the process of EMT, chromatins are gradually closed by Ras and TGF-β at the Cdh1/E-cadherin gene locus. In contrast, upregulated genes are regulated by a variety of mechanisms. The Fn1/fibronectin gene locus is open irrespective of Ras and TGF-β treatment, while Cdh2/N-cadherin gene locus becomes accessible upon Ras transformation, and the Mmp13 gene locus becomes accessible upon Ras transformation and TGF-β stimulation. Differentially expressed transcription factors, Etv4 and Etv5, are responsible for a subset of EMT- related changes in gene expression partially through the alteration of chromatin accessibility.

Article Snippet: Rabbit polyclonal anti-Etv4 antibody, previously used for ChIP-seq by Hollenhorst et al.54, was from AVIVA Systems Biology (ARP32263, San Diego, CA, USA), and mouse monoclonal anti-Etv5 antibody (MAB7107) was from R&D Systems.

Techniques: Genome Wide, Binding Assay, Gene Expression, Quantitative Proteomics, Transformation Assay

Extended Data 1. Characterization of screened gene targets and generation of isogenic knockout and transformant strains. a) Loss-of-function screening identified a transposon insertion mutant (Tn8A7) with depleted BfaGC production. The relative abundance was quantified by LC-MS/MS based on peak area. b) BfaGC production was abrogasted in the B. fragilis Δ3069 mutant. The abundance of BfaGC (C34:0) was quantified by LC-MS/MS based on peak area. c) RNA-seq volcano plot comparing B. fragilis Δ3069 to wild type revealed multiple genes downregulated in Δ3069 mutant. d) The expression of agcT is reduced in B. fragilis Δ3069. Transcript levels of agcT , normalized to leuB , were measured by qRT-PCR. Significance was determined by an unpaired two-tailed t-test. e) Gain-of-function screening identified P. vulgatus transformant producing aGCs. The relative abundance of aGC/Cer was quantified by LC-MS/MS based on peak area. f) agcT -transformed P. vulgatus produced molecules identical to BfaGC. XICs of aGCs from B. fragilis , P. vulgatus wild type and P. vulgatus expressing agcT were displayed. Chromosome-integrated expressing system pNBU2-tetR was used to expressing agcT in P. vulgatus . g) MS/MS spectra mirror plot demonstrated a match between aGCs from P. vulgatus expressing agcT and those from B. fragilis . h) B. thetaiotaomicron and P. vulgatus heterologously expressing agcT produced aGCs. Chromosome-integrated expressing system pNBU2-tetR was used to expressing agcT in B. thetaiotaomicron and P. vulgatus . i) Relative abundance of KDS, ketoCer, Cer, and BfaGC in B. fragilis wild type, Δ spt , Δ cerS , Δ cerR , and Δ agcT were shown. The abundance was quantified by LC-MS/MS based on peak area.

Journal: Nature microbiology

Article Title: Human gut bacteria produce structurally related monoglycolipids with contrasting immune functions

doi: 10.1038/s41564-025-02141-1

Figure Lengend Snippet: Extended Data 1. Characterization of screened gene targets and generation of isogenic knockout and transformant strains. a) Loss-of-function screening identified a transposon insertion mutant (Tn8A7) with depleted BfaGC production. The relative abundance was quantified by LC-MS/MS based on peak area. b) BfaGC production was abrogasted in the B. fragilis Δ3069 mutant. The abundance of BfaGC (C34:0) was quantified by LC-MS/MS based on peak area. c) RNA-seq volcano plot comparing B. fragilis Δ3069 to wild type revealed multiple genes downregulated in Δ3069 mutant. d) The expression of agcT is reduced in B. fragilis Δ3069. Transcript levels of agcT , normalized to leuB , were measured by qRT-PCR. Significance was determined by an unpaired two-tailed t-test. e) Gain-of-function screening identified P. vulgatus transformant producing aGCs. The relative abundance of aGC/Cer was quantified by LC-MS/MS based on peak area. f) agcT -transformed P. vulgatus produced molecules identical to BfaGC. XICs of aGCs from B. fragilis , P. vulgatus wild type and P. vulgatus expressing agcT were displayed. Chromosome-integrated expressing system pNBU2-tetR was used to expressing agcT in P. vulgatus . g) MS/MS spectra mirror plot demonstrated a match between aGCs from P. vulgatus expressing agcT and those from B. fragilis . h) B. thetaiotaomicron and P. vulgatus heterologously expressing agcT produced aGCs. Chromosome-integrated expressing system pNBU2-tetR was used to expressing agcT in B. thetaiotaomicron and P. vulgatus . i) Relative abundance of KDS, ketoCer, Cer, and BfaGC in B. fragilis wild type, Δ spt , Δ cerS , Δ cerR , and Δ agcT were shown. The abundance was quantified by LC-MS/MS based on peak area.

Article Snippet: 61 Heterologous expression of agcT in P. vulgatus and B. thetaiotaomicron was conducted with a chromosome-integrated and inducible vector pNBU2 erm-TetR-P1T_DP-GH023, a gift from Andrew Goodman (Addgene 90324).

Techniques: Knock-Out, Mutagenesis, Liquid Chromatography with Mass Spectroscopy, RNA Sequencing, Expressing, Quantitative RT-PCR, Two Tailed Test, Transformation Assay, Produced, Tandem Mass Spectroscopy

Detail of hub genes in each significant module

Journal: Bioengineered

Article Title: Four specific biomarkers associated with the progression of glioblastoma multiforme in older adults identified using weighted gene co-expression network analysis

doi: 10.1080/21655979.2021.1975980

Figure Lengend Snippet: Detail of hub genes in each significant module

Article Snippet: The primary antibodies including ERMN (1:200; Cat No. 66,605-1-Ig, Proteintech, Wuhan, China), MOBP (1:100; Cat No.12472-1-AP, Proteintech, Wuhan, China), PLP1 (1:100; Cat No. A20009, Abconal, Wuhan, China) and OPALIN (1:300; Cat. ab121425, Abcam, China), were added to the sections and incubated overnight at 4°C, followed by incubation with anti-mouse (1:2000; cat. no. BM3895) and anti-rabbit (1:2000; cat. no. BM3894) horseradish peroxidase-conjugated goat secondary antibodies (Boster, Wuhan, China) after washing three times with PBS.

Techniques:

ERMN, MOBP, PLP1 and OPALIN were highly expressed in the GBM tissues provided by the older patients with lower KPS scores . (a) IHC stain determined the expression of ERMN, MOBP, PLP1 and OPALIN in GBM tissues provided by the older patients with low and high KPS scores. (b) ROC analysis was performed to determine the diagnostic value of ERMN, MOBP, PLP1 and OPALIN to distinguish the GBM tissues provided by the older patients with low and high KPS scores

Journal: Bioengineered

Article Title: Four specific biomarkers associated with the progression of glioblastoma multiforme in older adults identified using weighted gene co-expression network analysis

doi: 10.1080/21655979.2021.1975980

Figure Lengend Snippet: ERMN, MOBP, PLP1 and OPALIN were highly expressed in the GBM tissues provided by the older patients with lower KPS scores . (a) IHC stain determined the expression of ERMN, MOBP, PLP1 and OPALIN in GBM tissues provided by the older patients with low and high KPS scores. (b) ROC analysis was performed to determine the diagnostic value of ERMN, MOBP, PLP1 and OPALIN to distinguish the GBM tissues provided by the older patients with low and high KPS scores

Article Snippet: The primary antibodies including ERMN (1:200; Cat No. 66,605-1-Ig, Proteintech, Wuhan, China), MOBP (1:100; Cat No.12472-1-AP, Proteintech, Wuhan, China), PLP1 (1:100; Cat No. A20009, Abconal, Wuhan, China) and OPALIN (1:300; Cat. ab121425, Abcam, China), were added to the sections and incubated overnight at 4°C, followed by incubation with anti-mouse (1:2000; cat. no. BM3895) and anti-rabbit (1:2000; cat. no. BM3894) horseradish peroxidase-conjugated goat secondary antibodies (Boster, Wuhan, China) after washing three times with PBS.

Techniques: Staining, Expressing, Diagnostic Assay

Detail IHC score of  ERMN,   MOBP,  PLP1 and OPALIN in GBM tissues provided by the elder patients with low KPS score and high KPS score

Journal: Bioengineered

Article Title: Four specific biomarkers associated with the progression of glioblastoma multiforme in older adults identified using weighted gene co-expression network analysis

doi: 10.1080/21655979.2021.1975980

Figure Lengend Snippet: Detail IHC score of ERMN, MOBP, PLP1 and OPALIN in GBM tissues provided by the elder patients with low KPS score and high KPS score

Article Snippet: The primary antibodies including ERMN (1:200; Cat No. 66,605-1-Ig, Proteintech, Wuhan, China), MOBP (1:100; Cat No.12472-1-AP, Proteintech, Wuhan, China), PLP1 (1:100; Cat No. A20009, Abconal, Wuhan, China) and OPALIN (1:300; Cat. ab121425, Abcam, China), were added to the sections and incubated overnight at 4°C, followed by incubation with anti-mouse (1:2000; cat. no. BM3895) and anti-rabbit (1:2000; cat. no. BM3894) horseradish peroxidase-conjugated goat secondary antibodies (Boster, Wuhan, China) after washing three times with PBS.

Techniques: