Journal: Advanced Science

Article Title: Cryo‐Inactivated Cancer Cells Derived Magnetic Micromotors for Tumor Immunotherapy

doi: 10.1002/advs.202504986

Figure Lengend Snippet: In vitro anti‐cancer efficacy of CICC@FeMnP and DC maturation. a) Live/dead staining images of 4T1 cells after different treatments. Scale bars, 100 µm. (b, c) FCM analysis b) and corresponding apoptosis rates c) of 4T1 cells after various treatments. d) Analysis of 4T1 cell viability following various treatments using the CCK8 assay. e,f) CRT (e) and HMGB1 (f) expression of 4T1 cells after various treatments by immunofluorescence staining. Scale bars, 50 µm. g) WB analysis of p‐STING, p‐IRF3, and p‐TBK1 expression in 4T1 cells incubated with various formulations. h) Schematic diagram of ICD and DC maturation processes. i,j) FCM analysis of DC maturation (i) and corresponding maturation ratios (j) after various treatments. k,l) Quantitative assessment of cytokine secretion (TNF‐α and IL‐6) by DCs. Data are presented as the mean ± SD. n. s.: no significance, *** p < 0.001.

Article Snippet: DCFH‐DA reactive oxygen species assay kit, CCK8 assay kit, mitochondrial membrane potential assay kit with JC‐1, annexin V‐FITC/PI apoptosis detection kit were purchased from Beyotime Biotechnology Co., Ltd. Prussian blue stain kit was obtained from Solarbio Science & Technology Co., Ltd. C11‐BODIPY 581/591 was bought from Invitrogen.

Techniques: In Vitro, Staining, CCK-8 Assay, Expressing, Immunofluorescence, Incubation

Journal: eLife

Article Title: Metabolic modulation regulates cardiac wall morphogenesis in zebrafish

doi: 10.7554/eLife.50161

Figure Lengend Snippet: ( a ) qPCR analysis of mRNA levels of glycolytic enzyme genes in control and Erbb2 overexpressing (OE) rat neonatal CMs ( n = 3). Error bars, s.e.m. ( b ) Staining for PKM2, CTNI and DNA (DAPI) in control and Erbb2 OE rat neonatal CMs; arrowheads point to PKM2+ CMs. ( c ) Western blot analysis of PKM2 levels in control and Erbb2 OE rat neonatal CMs. ( d ) Extracellular acidification rate (ECAR) analysis in control and Erbb2 OE rat neonatal CMs; glycolytic capacity shown on the right ( n = 7). Error bars, s.d. ( e ) qPCR analysis of mRNA levels of glycolytic enzyme genes in DMSO and Erbb2 inhibitor treated zebrafish hearts ( n = 3). Error bars, s.e.m.; *p<0.05 and **p<0.001 by two-tailed unpaired t -test. NS, not significant. Scale bar, 20 μm. Figure 2—source data 1. Mass spectrometry data. P7 WT and CAERBB 2 OE mouse hearts were isolated and protein expression levels analyzed by mass spectrometry. All presented proteins are statistically significant at p<0.05. Figure 2—source data 2. Primer sequences for qPCR analysis. Primer sequences used in . Figure 2—source data 3. Mean Ct values of qPCR analysis in .

Article Snippet: To generate adenovirus vectors encoding PDK3 (NM_001106581) or ERBB2 (NM_004448), the following primers were used to amplify Pdk3 from rat neonatal CM or ERBB2 from Addgene clone # 39321: Pdk3 (forward 5’- TAGAGATCTGGTACCGTCGACCACCATGCGGCTCTTCTACCG -3’ and reverse 5’- GGATATCTTATCTAGAAGCTTCTAGAAAGTTTTATTACTCTTGATCTTGTCC -3’); ERBB2 (forward 5’- TAGAGATCTGGTACCGTCGACGCGGCCGCACCACCATGTATCCATATGATGTTCCAGATTATGCTATGGAGCTGGCGGCCTTG -3’ and reverse 5’- GGATATCTTATCTAGAAGCTTTCACACTGGCACGTCCAG ).

Techniques: Control, Staining, Western Blot, Two Tailed Test, Mass Spectrometry, Isolation, Expressing

Journal: eLife

Article Title: Metabolic modulation regulates cardiac wall morphogenesis in zebrafish

doi: 10.7554/eLife.50161

Figure Lengend Snippet: ( a ) ECAR analysis in control and NRG1 treated rat neonatal CMs; glycolytic capacity shown on the right ( n = 7). ( b ) Confocal images (mid-sagittal sections) of 77 hpf zebrafish hearts treated with DMSO or Erbb2 inhibitor; magnified view of area in white boxes shown below; arrowheads point to CMs in the trabecular layer. Error bars, s.d.; *p<0.05 by two-tailed unpaired t -test. Scale bars, 20 μm.

Article Snippet: To generate adenovirus vectors encoding PDK3 (NM_001106581) or ERBB2 (NM_004448), the following primers were used to amplify Pdk3 from rat neonatal CM or ERBB2 from Addgene clone # 39321: Pdk3 (forward 5’- TAGAGATCTGGTACCGTCGACCACCATGCGGCTCTTCTACCG -3’ and reverse 5’- GGATATCTTATCTAGAAGCTTCTAGAAAGTTTTATTACTCTTGATCTTGTCC -3’); ERBB2 (forward 5’- TAGAGATCTGGTACCGTCGACGCGGCCGCACCACCATGTATCCATATGATGTTCCAGATTATGCTATGGAGCTGGCGGCCTTG -3’ and reverse 5’- GGATATCTTATCTAGAAGCTTTCACACTGGCACGTCCAG ).

Techniques: Control, Two Tailed Test

Journal: eLife

Article Title: Metabolic modulation regulates cardiac wall morphogenesis in zebrafish

doi: 10.7554/eLife.50161

Figure Lengend Snippet: ( a ) Confocal images (mid-sagittal sections) of 77 hpf hearts treated with DMSO, dichloroacetate (DCA) or Erbb2 inhibitor; magnified view of area in white boxes shown below; arrowheads point to CMs in the trabecular layer; percentage of CMs in the trabecular layer shown on the right ( n = 5–7 ventricles). ( b ) Confocal images (mid-sagittal sections) of 77 hpf Tg(myl7:BFP-CAAX) alone or in combination with Tg(myl7:pdha1aSTA-P2A-tdTomato) or Tg(myl7:pdk3b-P2A-tdTomato) hearts; magnified view of area in white boxes shown below; arrowheads point to CMs in the trabecular layer; percentage of CMs in the trabecular layer shown on the right ( n = 5–7 ventricles). ( c–e” ) Staining for CTNI, N-cadherin and DNA (DAPI) in control ( c ), Pdk3 ( d ) and Erbb2 ( e ) OE rat neonatal CMs; magnified view of area in yellow ( c’, d’, e’ ) and white ( c”, d”, e” ) boxes; percentage of CMs exhibiting membrane protrusions shown on the right ( n = 3 individual experiments; each value corresponds to an average of 30 CMs). Pdk3 and Erbb2 OE causes rat neonatal CMs to exhibit membrane protrusions (d’, e’; arrows) and cell-cell junction rearrangements (d’, e’; arrowheads). Error bars, s.e.m.; *p<0.05 and **p<0.001 by ANOVA followed by Tukey’s HSD test. Scale bars, 20 μm.

Article Snippet: To generate adenovirus vectors encoding PDK3 (NM_001106581) or ERBB2 (NM_004448), the following primers were used to amplify Pdk3 from rat neonatal CM or ERBB2 from Addgene clone # 39321: Pdk3 (forward 5’- TAGAGATCTGGTACCGTCGACCACCATGCGGCTCTTCTACCG -3’ and reverse 5’- GGATATCTTATCTAGAAGCTTCTAGAAAGTTTTATTACTCTTGATCTTGTCC -3’); ERBB2 (forward 5’- TAGAGATCTGGTACCGTCGACGCGGCCGCACCACCATGTATCCATATGATGTTCCAGATTATGCTATGGAGCTGGCGGCCTTG -3’ and reverse 5’- GGATATCTTATCTAGAAGCTTTCACACTGGCACGTCCAG ).

Techniques: Staining, Control, Membrane

Journal: eLife

Article Title: Metabolic modulation regulates cardiac wall morphogenesis in zebrafish

doi: 10.7554/eLife.50161

Figure Lengend Snippet:

Article Snippet: To generate adenovirus vectors encoding PDK3 (NM_001106581) or ERBB2 (NM_004448), the following primers were used to amplify Pdk3 from rat neonatal CM or ERBB2 from Addgene clone # 39321: Pdk3 (forward 5’- TAGAGATCTGGTACCGTCGACCACCATGCGGCTCTTCTACCG -3’ and reverse 5’- GGATATCTTATCTAGAAGCTTCTAGAAAGTTTTATTACTCTTGATCTTGTCC -3’); ERBB2 (forward 5’- TAGAGATCTGGTACCGTCGACGCGGCCGCACCACCATGTATCCATATGATGTTCCAGATTATGCTATGGAGCTGGCGGCCTTG -3’ and reverse 5’- GGATATCTTATCTAGAAGCTTTCACACTGGCACGTCCAG ).

Techniques: Software, Microscopy, Staining