Journal: bioRxiv

Article Title: Convergent DNA Methylation Abnormalities at Bivalent Chromatin in Human Growth Disorders

doi: 10.1101/2025.07.08.663614

Figure Lengend Snippet: (A) Schematic of generating human embryonic stem cell (hESC) models that harbor heterozygous growth syndrome-associated mutations in DNMT3A and NSD1 by CRISPR-Cas9 genome engineering. Schematic was created using BioRender. See for detailed genotypes of the mutant clones. (B) Relative expression of DNMT3A transcripts normalized to RNA18S transcript levels. Each dot represents an independent clone. (C) Western blot analysis of DNMT3A protein expression. DNMT3A knockout (KO) clones were included as controls. HDAC1 was used as a loading control. Each lane represents an independent clone. DNMT3A genotypes are as follows: WT, WT/WT; frameshift, WT/frameshift; R882H, WT/R882H; KO, frameshift/frameshift; GoF, WT/W330R or WT/D333N. The plots on the right show the relative intensity of DNMT3A bands, normalized to HDAC1. (D) Relative expression of NSD1 transcripts normalized to RNA18S transcript levels. (E) Mass spectrometry of histones H3.1 and H3.3 K36 modifications in WT and NSD1 LoF hESCs. Each dot represents an independent clone. unmod., unmodified; me1, monomethylated; me2, dimethylated; me3, trimethylated; ac, acetylated. For panels B, C, D, and E, Statistical significance was determined by Student’s t-test. *, p<0.05; **, p<0.01; ***, p<0.001; ns, not significant.

Article Snippet: Membranes were incubated overnight at 4 °C with a primary antibody against DNMT3A (C-12, Santa Cruz Biotechnology, sc-365769), followed by HRP-conjugated anti-mouse IgG secondary antibody (Cell Signaling Technology, #7076) for 1 hour at room temperature.

Techniques: CRISPR, Mutagenesis, Clone Assay, Expressing, Western Blot, Knock-Out, Control, Mass Spectrometry

Journal: bioRxiv

Article Title: Convergent DNA Methylation Abnormalities at Bivalent Chromatin in Human Growth Disorders

doi: 10.1101/2025.07.08.663614

Figure Lengend Snippet: Proportions of in each full-stack chromatin state for (A) DNMT3A LoF hESCs, (B) TBRS patient blood (HypoMPs n=832), (C) DNMT3A GoF hESCs, (D) a HESJAS patient peripheral blood leukocyte sample (HypoMPs n=2,796; HyperMPs n=9,576), (E) NSD1 LoF hESCs, and (F) Sotos syndrome patient blood (HypoMPs n=24,148; HyperMPs n=4,168) Background represents proportion of all probes in each state. HyperMPs of TBRS patients were not analyzed due to a small size (n=38). Statistical significance was determined by Fisher test. *, p<0.001.

Article Snippet: Membranes were incubated overnight at 4 °C with a primary antibody against DNMT3A (C-12, Santa Cruz Biotechnology, sc-365769), followed by HRP-conjugated anti-mouse IgG secondary antibody (Cell Signaling Technology, #7076) for 1 hour at room temperature.

Techniques:

Journal: bioRxiv

Article Title: Convergent DNA Methylation Abnormalities at Bivalent Chromatin in Human Growth Disorders

doi: 10.1101/2025.07.08.663614

Figure Lengend Snippet: (A) Number of overlapping HypoMPs between DNMT3A LoF and GoF mutants. P<2.2*10^-16, Fisher’s exact test of unique DNMT3A GoF in all probes compared to DNMT3A GoF shared with DNMT3A LoF. (B) Log2 odds ratios showing enrichment of shared HypoMPs from DNMT3A mutants across full-stack chromatin states. Top 10 enriched states are shown (all p<1*10-18). (C) Mean DNA methylation values at CpG positions within selected enhancer chromatin states. Each dot represents an independent clone. Statistical significance was determined by Student’s t-test. *, p<0.05; **, p<0.01; ***,p<0.001; ns, not significant. (D-E) RELI analysis of shared HypoMPs intersected with >10,000 public chromatin datasets. Shown are the top 200 datasets ranked by Z-score. Most enriched chromatin factors (D) and cell types (E) are highlighted. PSC TF: POU5F1, NANOG, SOX2, cohesion: RAD21, NIPBL, PRC1.1: BCOR, KDM2B, PCGF1, RYBP, RNF2. Controls represent randomly sampled EPIC probe regions. Each dot represents a dataset profiling a chromatin factor in a human cell type. Supplemental Table 2 contains RELI results of all examined datasets. PSC, pluripotent stem cells; TF, transcription factors. (F) CUT&RUN (H2AK119ub) or ChIP-seq (all others) signal in WT hESCs 10 kilobases upstream and downstream from the center of shared HypoMPs or matched control regions. BCOR, KDM2B, PCGF1, H3K36me2 occupancy data are from GEO accession number GSE104690, RNF2 data is from GSE105028, H3K36me3 is from ENCODE (ENCSR476KTK), and H2AK119ub is from GSE301386 (this study).

Article Snippet: Membranes were incubated overnight at 4 °C with a primary antibody against DNMT3A (C-12, Santa Cruz Biotechnology, sc-365769), followed by HRP-conjugated anti-mouse IgG secondary antibody (Cell Signaling Technology, #7076) for 1 hour at room temperature.

Techniques: DNA Methylation Assay, ChIP-sequencing, Control

Journal: Nature Communications

Article Title: Combined and differential roles of ADD domains of DNMT3A and DNMT3L on DNA methylation landscapes in mouse germ cells

doi: 10.1038/s41467-024-47699-2

Figure Lengend Snippet: a Structure of mouse DNMT3A isoforms and DNMT3L and positions of the nucleotide substitutions and resulting amino acid substitutions. The introduced nucleotides and resulting amino acids are shown in red. The ADD, PWWP, UDR, and methyltransferase (MTase) motifs of the catalytic domain are indicated by colored boxes. While both DNMT3A1 and DNMT3A2 are expressed in male and female germ cells, DNMT3A2 is the predominant form in FGOs. b Western blotting of DNMT3A ADD and DNMT3L ADD in wild-type and [ Dnmt3a ADD/ADD , Dnmt3L ADD/ADD ] whole testes. This experiment was repeated twice independently. c Pie graph showing the genotypes of mice generated by crossing [ Dnmt3a ADD/+ , Dnmt3L ADD/+ ] males and females. A total of 597 mice were genotyped at 3 weeks old. The expected Mendelian ratios for wild-type and [ Dnmt3a ADD/ADD , Dnmt3L ADD/ADD ] female and male are respectively 3.12%. d Boxplots comparing the body weights of wild-type and [ Dnmt3a ADD/ADD , Dnmt3L ADD/ADD ] mice at 12 weeks old. Females and males were examined separately. All boxplots hereafter are defined as following: central bar, median; lower and upper box limits, 25th and 75th percentiles, respectively; whiskers, minimum and maximum value within the rage of (1st quartile − 1.5*(3rd quartile − 1st quartile)) to (3rd quartile + 1.5*(3rd quartile − 1st quartile)). ** p value = 2.0E-03 and *** p value = 4.4E−05 by two-tailed t-test. e Fertility of wild-type, Dnmt3a ADD/ADD , Dnmt3L ADD/ADD , and [ Dnmt3a ADD/ADD , Dnmt3L ADD/ADD ] females and males that were crossed with a C57BL/6L partner. One to three stillborn pups were obtained from Dnmt3a ADD/ADD females per delivery, as indicated by a cross (†). ns 1 and ns 2 p value = 0.10 and 0.47, respectively, and ** p value = 4.92E−03 by two-tailed t -test. f Representative images of ovaries and testes obtained from wild-type and [ Dnmt3a ADD/ADD , Dnmt3L ADD/ADD ] mice. Boxplots on the right show the size (long axis) of these reproductive tissues. ns p value = 0.61 and *** p value = 6.65E-05 by two-tailed t-test. Source data are provided as a Source Data file.

Article Snippet: The FGOs were then incubated with primary antibodies against DNMT3A (NOVUS, 64B14446) or DNMT3L (Abcam, ab194094) (dilution 1:500) overnight at 4 °C.

Techniques: Western Blot, Generated, Two Tailed Test

Journal: Nature Communications

Article Title: Combined and differential roles of ADD domains of DNMT3A and DNMT3L on DNA methylation landscapes in mouse germ cells

doi: 10.1038/s41467-024-47699-2

Figure Lengend Snippet: a Immunofluorescence staining of wild-type, Dnmt3L ADD/ADD , Dnmt3a ADD/ADD , and [ Dnmt3a ADD/ADD , Dnmt3L ADD/ADD ] FGOs for DNMT3A (red) and DNMT3L (green). Nuclei were counterstained with DAPI. b Boxplots showing the relative fluorescence intensity of DNMT3A (top) and DNMT3L (bottom) in the nucleus of FGOs of indicated genotypes. The relative values were obtained by dividing the fluorescence intensity of the DAPI-dense region by that of the non-DAPI-dense region in the same nucleus. *** 1 – *** 6 p value = 2.25E-05, 3.10E−06, 5.86E−05, 1.38E-09, 2.23E−13, and 2.13E−13, respectively, by two-tailed t-test. Source data are provided as a Source Data file.

Article Snippet: The FGOs were then incubated with primary antibodies against DNMT3A (NOVUS, 64B14446) or DNMT3L (Abcam, ab194094) (dilution 1:500) overnight at 4 °C.

Techniques: Immunofluorescence, Staining, Fluorescence, Two Tailed Test

Journal: Nature Communications

Article Title: Combined and differential roles of ADD domains of DNMT3A and DNMT3L on DNA methylation landscapes in mouse germ cells

doi: 10.1038/s41467-024-47699-2

Figure Lengend Snippet: a Scatter plots comparing CG methylation levels of 10-kb genomic bins between FGOs of the indicated genotypes. A comparison between wild-type and Dnmt3L knockout FGOs is also shown. Data from biological replicates were combined after confirming their consistency. b Genome browser view of CG methylation levels of 10-kb bins across a 10-Mb region in FGOs of the indicated genotypes. Violin plots on the right show distributions of CG methylation levels of 10-kb bins from the whole genome. The numbers on the right indicate the global CG methylation levels. c Scatter plots comparing CG methylation levels of 10-kb genomic bins between Dnmt3a ADD/ADD and Dnmt3L ADD/ADD FGOs. d CG methylation levels of the maternally and paternally methylated ICRs in FGOs of the indicated genotypes. e CG methylation levels of repeat elements (LINEs, LTRs, and SINEs) in FGOs of the indicated genotypes. The color code is as Fig. 3d. Source data are provided as a Source Data file.

Article Snippet: The FGOs were then incubated with primary antibodies against DNMT3A (NOVUS, 64B14446) or DNMT3L (Abcam, ab194094) (dilution 1:500) overnight at 4 °C.

Techniques: Methylation, Comparison, Knock-Out

Journal: Nature Communications

Article Title: Combined and differential roles of ADD domains of DNMT3A and DNMT3L on DNA methylation landscapes in mouse germ cells

doi: 10.1038/s41467-024-47699-2

Figure Lengend Snippet: a Scatter plots comparing CG methylation levels of 10-kb bins between spermatozoa of the indicated genotypes. A comparison between wild-type and Dnmt3L knockout spermatogonia at postnatal day 10 (P10 SG) is also shown. Data from biological replicates were combined after confirming their consistency. While the wild-type data was produced from one sample, it was consistent with our previous dataset . b Genome browser view of CG methylation levels of 10-kb bins across a 10-Mb region (the same region as in Fig. ) in spermatozoa of the indicated genotypes. Violin plots on the right show distributions of CG methylation levels in 10-kb bins from the whole genome. The numbers on the right indicate the global CG methylation levels. c Scatter plots comparing CG methylation levels of 10-kb genomic bins between Dnmt3a ADD/ADD and Dnmt3L ADD/ADD spermatozoa. d CG methylation levels of the maternally and paternally methylated ICRs in spermatozoa of the indicated genotypes. e , CG methylation levels of repeat elements (LINEs, LTRs, and SINEs) in spermatozoa of the indicated genotypes. The color code is as Fig. 4d. Source data are provided as a Source Data file.

Article Snippet: The FGOs were then incubated with primary antibodies against DNMT3A (NOVUS, 64B14446) or DNMT3L (Abcam, ab194094) (dilution 1:500) overnight at 4 °C.

Techniques: Methylation, Comparison, Knock-Out, Produced

Journal: Nature Communications

Article Title: Combined and differential roles of ADD domains of DNMT3A and DNMT3L on DNA methylation landscapes in mouse germ cells

doi: 10.1038/s41467-024-47699-2

Figure Lengend Snippet: a Changes in gene expression detected between wild-type and [ Dnmt3a ADD/ADD , Dnmt3L ADD/ADD ] FGOs. Genes that are up-regulated and down-regulated in [ Dnmt3a ADD/ADD , Dnmt3L ADD/ADD ] FGOs are plotted in red and blue, respectively (fold-change > 2, FDR < 0.05). b Multi-dimensional scaling plots of the gene expression profiles of FGOs of the indicated genotypes. The profiles of the wild-type MII oocytes are also shown. Each color-coded dot shows single-cell data. c Representative images of embryos recovered at E9.5. Wild-type embryo (top) and embryo obtained from [ Dnmt3a ADD/ADD , Dnmt3L ADD/ADD ] oocyte fertilized with wild-type spermatozoa (bottom). This experiment was repeated twice independently. d Volcano plots showing gene expression differences of each parental allele between embryos obtained from wild-type and [ Dnmt3a ADD/ADD , Dnmt3L ADD/ADD ] oocytes. Data from the maternal (left) and paternal allele (right) are separately shown. Red dots indicate the maternally imprinted genes ( n = 35). P values by the exact test under a negative binomial distribution. Source data are provided as a Source Data file.

Article Snippet: The FGOs were then incubated with primary antibodies against DNMT3A (NOVUS, 64B14446) or DNMT3L (Abcam, ab194094) (dilution 1:500) overnight at 4 °C.

Techniques: Gene Expression

Journal: Nature Communications

Article Title: Combined and differential roles of ADD domains of DNMT3A and DNMT3L on DNA methylation landscapes in mouse germ cells

doi: 10.1038/s41467-024-47699-2

Figure Lengend Snippet: a Scatter plots comparing non-CG methylation levels of 10-kb genomic bins between FGOs of the indicated genotypes. A comparison between wild-type and Dnmt3L knockout FGOs is also shown. b Scatter plots comparing the non-CG methylation levels of 10-kb bins between spermatozoa of the indicated genotypes. A comparison between wild-type and Dnmt3L knockout P10 SG is also shown. c Genome browser view of CG methylation (mCG) and non-CG methylation (mCH) levels in FGOs and spermatozoa of the indicated genotypes. Two genomic regions of 4.6 Mb (left) and 4.0 Mb (right) are shown. H3K36me3 ChIP-seq peaks in wild-type FGOs and round spermatids (RS) are also shown. The 10-kb bins exhibiting non-CG methylation levels > 5% higher in [ Dnmt3a ADD/ADD , Dnmt3L ADD/ADD ] oocytes and spermatozoa compared to their wild-type counterparts are indicated in a row designated “ΔmCH>5%”. Four representative regions containing such high mCH bins are indicated by open boxes and their zoomed-in snapshots are displayed at the bottom. d Bar graphs showing the fractions of methylated cytosines in all cytosines for FGOs (top) and spermatozoa (bottom) of the indicated genotypes. Each bar is divided into subsegments representing mCH and mCG. e Pie charts showing the ratios of methylated CA, CT, and CC in FGOs (top) and spermatozoa (bottom) of the indicated genotypes. f A motif showing enrichment in high-mCH 1-kb bins of [ Dnmt3a ADD/ADD , Dnmt3L ADD/ADD ] FGOs and spermatozoa ( N = 1855) over randomly selected 1-kb bins. g Violin plots showing distributions of non-CG methylation levels of 1-kb bins in wild-type FGOs (left) and spermatozoa (right). The 1-kb bins exhibiting non-CG methylation levels > 20% higher in [ Dnmt3a ADD/ADD , Dnmt3L ADD/ADD ] compared to their wild-type counterparts were compared with randomly selected bins. *** 1 and *** 2 p value = 5.92E-291, and 3.44E−72, respectively, by two-tailed t-test. Source data are provided as a Source Data file.

Article Snippet: The FGOs were then incubated with primary antibodies against DNMT3A (NOVUS, 64B14446) or DNMT3L (Abcam, ab194094) (dilution 1:500) overnight at 4 °C.

Techniques: Methylation, Comparison, Knock-Out, ChIP-sequencing, Two Tailed Test

Journal: Genes & development

Article Title: De novo DNA methylation by Dnmt3a and Dnmt3b is dispensable for nuclear reprogramming of somatic cells to a pluripotent state.

doi: 10.1101/gad.2039011

Figure Lengend Snippet: Figure 1. Generation of iPSCs in the absence of de novo DNA methyltransferase activity. (A) Schematic of the two approaches to reprogram conditional knockout MEFs for Dnmt3a and Dnmt3b. MEFs were infected with adenovirus harboring a Cre recombinase and GFP either after or before infection with inducible lentiviruses encoding the reprogramming factors Oct4, Sox2, c-Myc and Klf4. (B) Immunostaining for the pluripotency marker Nanog. Bars, 100mm.

Article Snippet: The antibodies to detect Dnmt3a and Dnmt3b were purchased from Imgenex (IMG-268A and IMG-184A).

Techniques: Activity Assay, Knock-Out, Infection, Immunostaining, Marker

Journal: Genes & development

Article Title: De novo DNA methylation by Dnmt3a and Dnmt3b is dispensable for nuclear reprogramming of somatic cells to a pluripotent state.

doi: 10.1101/gad.2039011

Figure Lengend Snippet: Figure 2. Characterization of 3ab-deficient iPSC lines. (A) Southern blot analysis shows 3ab-deficient iPSC lines obtained through approach 1 (Fig. 1A). Clone #8 is indicated by an asterisk. (B) Southern blot analysis of 3ab-deficient iPSC lines obtained through approach 2 (Fig. 1A). Clones A6 and B2 are indicated by an asterisk. Additionally, 3ab MEFs infected with Adeno-Cre-GFP are shown before the transduction with the reprogramming factors and over the course of several passages (1– 3). Lane 4 displays DNA from a culture dish containing mixed iPSC colonies. Note that the loop-out induced by Cre recombinase was highly efficient. ‘‘2lox’’ represents the conditional alleles and ‘‘1lox’’ represents the deficient alleles of Dnmt3a and Dnmt3b, respectively.

Article Snippet: The antibodies to detect Dnmt3a and Dnmt3b were purchased from Imgenex (IMG-268A and IMG-184A).

Techniques: Southern Blot, Clone Assay, Infection, Transduction

Journal: Genes & development

Article Title: De novo DNA methylation by Dnmt3a and Dnmt3b is dispensable for nuclear reprogramming of somatic cells to a pluripotent state.

doi: 10.1101/gad.2039011

Figure Lengend Snippet: Figure 3. 3ab-deficient iPSCs form teratomas with a restricted developmental potential. (A) Teratomas from #8 and B2 3ab-deficient iPSCs. Reintroduction of functional Dnmt3a and Dnmt3b into 3ab-deficient iPSCs rescues the ability to efficiently form cells from the three germ layers in a teratoma assay. (B) eGFP-marked rescue lines were injected into blastocysts, and resulting chimeric embryos at mid-gestation are shown. The eGFP signal was clearly visible in the majority of embryos, whereas the degree of chimerism varied. Two embryos with developmental defects are shown. The first embryo of the bottom panel did not show any eGFP signal and serves as a reference of background.

Article Snippet: The antibodies to detect Dnmt3a and Dnmt3b were purchased from Imgenex (IMG-268A and IMG-184A).

Techniques: Functional Assay, Injection

Journal: FEBS letters

Article Title: Hypoxia-induced endothelial-mesenchymal transition is associated with RASAL1 promoter hypermethylation in human coronary endothelial cells.

doi: 10.1002/1873-3468.12158

Figure Lengend Snippet: Fig. 3. Silencing of DNMT3a expression alleviates hypoxia-induced EndMT. (A–D) qRT-PCR results showing the mRNA expression of DNA methyltransferases (DNMT1, DNMT3a, DNMT3b and DNMT3l) in normoxic and hypoxic cells. DNMT3a is significantly upregulated upon hypoxia treatment. (E) qRT-PCR results showing DNMT3a mRNA expression in the cells which were transfected with different DNMT3a siRNA oligos. The combination of all three oligos contributed to over 70% reduction in DNMT3a. (F) Western blot results showing increased DNMT3a protein expression under hypoxic condition but not under normoxic condition, both transfected with combined DNMT3a. DNMT3a siRNAs treatment under hypoxic condition abolished expression of DNMT3a. (G) qRT-PCR results showing DNMT1, DNMT3b, and DNMT3l mRNA expression in HCAEC cells transfected with DNMT3a siRNA compared to cells transfected with scrambled control. (H) Western blot analysis showing protein expression of CD31, S100A4, a-SMA in DNMT3a siRNA transfected cells compared to scrambled control transfected cells. All blots were reprobed with an anti-a-TUBULIN antibody as a control for equal loading. (I) qRT-PCR results showing DNMT3a mRNA expression in cells transfected with scrambled controls siRNA treated with normoxia and hypoxia and cells transfected with combined DNMT3a siRNAs treated with hypoxia. (J) DNA virtual gel pictures showing the MeDIP results of decreased methylation level of immunoprecipitated RASAL1 promoter in DNMT3a siRNA transfected cells compared to scrambled control transfected cells under hypoxic condition. (K) qRT-PCR data showing mRNA expression of the key EndMT transcription factors (SNAIL, SLUG, and TWIST) in DNMT3a siRNA transfected cells as compared to scrambled control transfected cells exposed to hypoxic condition (gene expression and associated error bars, representing mean SEM, n = 3 independent experiments, n.s., no significance, *P < 0.05, **P < 0.01, ***P < 0.001).

Article Snippet: For gene silencing experiment, DNMT3a siRNAs were purchased from OriGene (Rockville, MD, USA). pLKO.1 vector was used for generating of pLKO.1shSMAD2 (CCAGCAGGAATTGAGCCACAGAGTAAT TA), pLKO.1-shSMAD4 (CCAACATTCCTGTGGCTTCCACAAGTCAG) constructs.

Techniques: Expressing, Quantitative RT-PCR, Transfection, Western Blot, Control, Methylated DNA Immunoprecipitation, Methylation, Immunoprecipitation, Gene Expression

Journal: FEBS letters

Article Title: Hypoxia-induced endothelial-mesenchymal transition is associated with RASAL1 promoter hypermethylation in human coronary endothelial cells.

doi: 10.1002/1873-3468.12158

Figure Lengend Snippet: Fig. 6. Hypoxia induces EndMT in HCAEC cells through different pathways. Schematic representation of hypoxia-induced endothelial- to-mesenchymal transition through different cascades. Under hypoxic condition, transcription factor HIF1a protein is stabilised, which can directly activate EndMT transcriptional factor, Snail, to trigger the EndMT program. Besides, hypoxia can also activate TGFb2 receptor regulated signalling pathway through SMAD2/3 proteins to induce EndMT transcription factor expression. In addition, we identified that hypoxia synergistically induces EndMT by DNMT3a-mediated hypermethylation of RASAL1 with consecutive Ras hyperactivity.

Article Snippet: For gene silencing experiment, DNMT3a siRNAs were purchased from OriGene (Rockville, MD, USA). pLKO.1 vector was used for generating of pLKO.1shSMAD2 (CCAGCAGGAATTGAGCCACAGAGTAAT TA), pLKO.1-shSMAD4 (CCAACATTCCTGTGGCTTCCACAAGTCAG) constructs.

Techniques: Expressing