Journal: Genes & Development

Article Title: Diet-induced obesity mediated by the JNK/DIO2 signal transduction pathway

doi: 10.1101/gad.223800.113

Figure Lengend Snippet: JNK promotes expression of Dio2 in the anterior pituitary gland. ( A ) P WT and P ΔJ1,J2 mice were fed an ND or a HFD (16 wk). Total RNA was isolated from the anterior pituitary gland, and the expression of Dio ( Dio1 , Dio2 , and Dio3 ) mRNA was measured by quantitative RT–PCR assays (mean ± SEM, n = 7∼12). (*) P < 0.05. ( B ) Primary cultures of anterior pituitary gland cells were treated without and with 10 ng/mL TNFα (12 h). The expression of Dio2 mRNA was measured by quantitative RT–PCR assays (mean ± SEM; n = 6). (*) P < 0.05. ( C ) P WT and P ΔJ1,J2 mice were fed a ND or a HFD (16 wk). Total RNA was isolated from the anterior pituitary gland, and the expression of AP-1 transcription factor ( cJun , JunB , JunD , and cFos ) mRNA was measured by quantitative RT–PCR assays (mean ± SEM, n = 7∼12). (*) P < 0.05. ( D ) Extracts prepared from the anterior pituitary gland of P WT and P ΔJ1,J2 mice were examined by immunoblot analysis by probing with antibodies to cJun, JNK, and αTubulin.

Article Snippet: TaqMan assays were used to quantitate Ccl2 (Mm00441242_m1), cFos (Mm00487425_m1), cJun (Mm00495062_s1), Cga/Tsha (Mm01209400_m1), Dio1 (Mm00839358_m1), Dio2 (Mm00515664_m1), Dio3 (Mm00548953_s1), Emr1 (F4/80) (Mm00802530_m1), Gata2 (Mm00492301_m1), Glut4 (Mm00436615-m1), Jnk1 (Mm00489514_m1), Jnk2 (Mm00444231_m1), JunB (Mm00492781_s1), JunD (Mm00495088_s1), Ldhb (Mm00493146_m1), Leptin (Mm00434759_m1), Pou1f1 (Mm00476852_m1), Slc16a2 (Mm00486204_m1), Spot14 (Mm01273967_m1), Thrb (Mm00437044_m1), Trh (Mm01963590_s1), Trhr (Mm00443262_m1), Tshb (Mm00437190_m1), and Tnfα (Mm00443258_m1).

Techniques: Expressing, Isolation, Quantitative RT-PCR, Western Blot

Journal: Toxicological sciences : an official journal of the Society of Toxicology

Article Title: Thyroid Hormone Disruption in the Fetal and Neonatal Rat: Predictive Hormone Measures and Bioindicators of Hormone Action in the Developing Cortex

doi: 10.1093/toxsci/kfy190

Figure Lengend Snippet: Complete list of genes interrogated and Supplementary material . All genes were previously shown or speculated to be thyroid hormone targets (see extended version, Supplementary Table 1 ). Taqman primer codes represent the Assay ID (Thermofisher Scientific).

Article Snippet: GD20, PN14 , Deiodonase 11 , Dio2 , 65162 , Rn00581867_m1 , No.

Techniques: Derivative Assay, Activity Assay

Journal: Poultry Science

Article Title: Expression profile of thyroid hormone deiodinases in the adult laying hen ( Gallus gallus domesticus )

doi: 10.1016/j.psj.2025.106079

Figure Lengend Snippet: Expression levels of DIO2 mRNA in chicken hens. (A) Internal organs: Lu - lungs, H - heart, L - liver, K - kidney, Sp - spleen, P – pancreas. (B) Other tissues: Hyp - hypothalamus, Pit - pituitary gland, St - stomach, SI- small intestine, SM - skeletal muscles, AT - adipose tissue, Sk – skin. (C) Ovary: SWF – small white follicles 1–4 mm, LWF – large white follicles 4–8 mm, the granulosa and theca layer of preovulatory follicles F3−F1. (D) Oviduct: I - infundibulum, M - magnum, Is - isthmus, SG - shell gland, V - vagina. Each value represents the mean of the normalised relative quantity ± SEM ( n = 8), normalised to hypoxanthine phosphoribosyltransferase as a reference gene and standardised to the DIO2 mRNA expression in the thyroid gland as a control tissue. Values ​​marked with different letters are significantly different ( P < 0.05); one-way analysis of variance with Tukey’s post-hoc test.

Article Snippet: DIO2 , Deiodinase, iodothyronine type II , Gg03362313_m1 , ACAAGCAGGTCAAACTTGGAGGAGA , 76.

Techniques: Expressing, Muscles, Control

Journal: Nature communications

Article Title: Loss of p53 activates thyroid hormone via type 2 deiodinase and enhances DNA damage.

doi: 10.1038/s41467-023-36755-y

Figure Lengend Snippet: Fig. 8 | Loss of p53 leads to D2 re-expression and enhanced DNA damage. Graphical illustration of the p53-mediated D2 regulation and the transcriptional program leading to modulation of genes involved in the DNA Damage Response (DDR).

Article Snippet: DIO2 targeted mutagenesis Targeted mutagenesis of DIO2 gene in SCC011 cells was achieved by using the CRISPR/Cas9 system from Santa Cruz Biotechnology (DIO2 CRISPR/Cas9 KO Plasmid (h), cod. sc-402262).

Techniques: Expressing

Journal: Journal of Clinical Medicine

Article Title: Deiodinase Types 1 and 3 and Proinflammatory Cytokine Values May Discriminate Depressive Disorder Patients from Healthy Controls

doi: 10.3390/jcm12196163

Figure Lengend Snippet: Comparison of cytokine and DIO mRNA and protein levels between the rDD group and the control group.

Article Snippet: To assess the mRNA expression levels of the examined genes, real-time PCR was performed in 96-well plates with TaqMan ® Universal PCR Master Mix, No UNG, and the following probes: Hs00174944_m1 for DIO1 , Hs00988260_m1 for DIO2 , Hs00956431_s1 for DIO3 , Hs00174092_ml for IL1B , Hs 00985639_ml for IL6, Hs01113624_gl for TNFA, Hs00989291_m1 for IFNG , Hs04194366_g1 for RPL13A, and Hs04194366_g1 for 18S rRNA (Applied Biosystems, Foster City, CA, USA).

Techniques: Comparison, Control