Journal: Scientific Reports

Article Title: LncRNA CCAT1 enhances chemoresistance in hepatocellular carcinoma by targeting QKI-5

doi: 10.1038/s41598-022-11644-4

Figure Lengend Snippet: CCAT1 enhanced HCC resistance to oxaliplatin in vitro. ( A ) HCC cells received OXA treatment for 48 h, the expression of CCAT1 was determined by qRT-PCR. ( B , C ) HCCLM3 and HepG2 HCC cell lines were knocked out of CCAT1 and exposed to increasing concentrations of oxaliplatin from 0.1 to 1 mM for 48 h to determine the IC50 values by CCK-8 assay. (IC50 of HCCLM3 control and KO-CCAT1: 46.56 vs. 23.22 μM; HepG2 control and KO-CCAT1: IC50: 27.98 vs. 13.28 μM, p < 0.01 respectively). ( D ) The colony formation assay showed that the numbers of colonies were reduced when CCAT1 was knocked out. ( E ) Significantly increased proportion of apoptotic cells by in the KO-CCAT1 groups. ( F ) Significantly increased caspase-3 activation following knock out of CCAT1, indicated by red fluorescence staining ( p < 0.01). ( G ) Caspase-3 and caspase-7 activities were measured by Caspase-Glo® 3/7 Assay ( p < 0.05).

Article Snippet: CRISPR guide RNA specifically targeting CCAT1 sequence (forward gRNA GCCCCTGGCCAACTATATCT; reverse gRNA ATTTGGTCATAATGCGGAAA) was constructed by Genechem (Shanghai, China) and transfected into the above cells.

Techniques: In Vitro, Expressing, Quantitative RT-PCR, CCK-8 Assay, Control, Colony Assay, Activation Assay, Knock-Out, Fluorescence, Staining, Caspase-Glo Assay

Journal: Scientific Reports

Article Title: LncRNA CCAT1 enhances chemoresistance in hepatocellular carcinoma by targeting QKI-5

doi: 10.1038/s41598-022-11644-4

Figure Lengend Snippet: CCAT1 involved in HCC resistance to oxaliplatin in vivo . All groups received intraperitoneal injections of OXA (0.8 mg/kg/w). ( A ) Tumor growth curves of subcutaneous implantation models of HCC. ( B ) The average tumor volumes were calculated using the following formula: V(mm 3 ) = (L × W 2 ) × 0.5 (L: tumor length, W: width). ( C ) TUNEL assay was applied to detect HCC apoptosis in subcutaneous implantation tumor (Original magnification: × 200). ( D ) Immunohistochemistry staining for Bel-2 and active caspase-3 expressions in subcutaneous tumor (Original magnification: × 400). * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: CRISPR guide RNA specifically targeting CCAT1 sequence (forward gRNA GCCCCTGGCCAACTATATCT; reverse gRNA ATTTGGTCATAATGCGGAAA) was constructed by Genechem (Shanghai, China) and transfected into the above cells.

Techniques: In Vivo, TUNEL Assay, Immunohistochemistry, Staining

Journal: Scientific Reports

Article Title: LncRNA CCAT1 enhances chemoresistance in hepatocellular carcinoma by targeting QKI-5

doi: 10.1038/s41598-022-11644-4

Figure Lengend Snippet: CCAT1 interacted with QKI-5. ( A ) Subcellular localization plots displayed by lncATLAS. ( B ) This nuclear location was confirmed by the cytoplasmic and nuclear extracts measured from qRT-PCR. ( C ) RNA-binding proteins of CCAT1 was predicted by RBPDB ( http://rbpdb.ccbr.utoronto.ca/ ) database. ( D ) Immunohistochemistry staining indicated that QKI-5 was located in the nucleus (Original magnification: × 400). ( E ) CCAT1 was enriched with QKI-5-immunoprecipitation. RNA pull-down assay was applied to detect the QKI-5 antibody.

Article Snippet: CRISPR guide RNA specifically targeting CCAT1 sequence (forward gRNA GCCCCTGGCCAACTATATCT; reverse gRNA ATTTGGTCATAATGCGGAAA) was constructed by Genechem (Shanghai, China) and transfected into the above cells.

Techniques: Quantitative RT-PCR, RNA Binding Assay, Immunohistochemistry, Staining, Immunoprecipitation, Pull Down Assay

Journal: Scientific Reports

Article Title: LncRNA CCAT1 enhances chemoresistance in hepatocellular carcinoma by targeting QKI-5

doi: 10.1038/s41598-022-11644-4

Figure Lengend Snippet: Overexpression of QKI-5 reversed oxaliplatin resistance induced by CCAT1. ( A ) Western blotting analysis of expression levels of QKI-5, JNK, p-JNK, ERK1/2, p-ERK1/2, p38 and p-p38 MAPK in control and pcDNA3.1-QKI-5 cells. ( B ) The phosphorylation and total levels of p38 MAPK in the CCAT1 and QKI-5 overexpression HCC cells. ( C ) IC50 of oxaliplatin was determined when QKI-5 was upregulated. ( D ) The colony formation assay showed that overexpressed QKI-5 significantly attenuated cell proliferation induced by CCAT1 both in HCCLM3 and HepG2 cells. ( E , F ) Fluorescence staining and Caspase-Glo® 3/7 Assay showed caspase-3 activity influenced by CCAT1 and QKI-5. Overexpressed QKI-5 could increase caspase-3 activity reduced by CCAT1. * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: CRISPR guide RNA specifically targeting CCAT1 sequence (forward gRNA GCCCCTGGCCAACTATATCT; reverse gRNA ATTTGGTCATAATGCGGAAA) was constructed by Genechem (Shanghai, China) and transfected into the above cells.

Techniques: Over Expression, Western Blot, Expressing, Control, Phospho-proteomics, Colony Assay, Fluorescence, Staining, Caspase-Glo Assay, Activity Assay

Journal: JCO Precision Oncology

Article Title: Genomic Resistance Patterns to Second-Generation Androgen Blockade in Paired Tumor Biopsies of Metastatic Castration-Resistant Prostate Cancer

doi: 10.1200/PO.17.00140

Figure Lengend Snippet: CDK overexpression is sufficient to drive enzalutamide resistance. (A) Schematic diagram of engineering CDK4/6 -overexpressing LnCAP cells and the subsequent experimental determination of enzalutamide sensitivity. (B) CDK4/6 -overexpressing androgen-sensitive LnCAP cells continue to proliferate when cultured in androgen-free media (charcoal-stripped serum [CSS]) and enzalutamide 2.5 μM. The same treatment negatively impacted luciferase control–expressing LnCAP cells. The resistant phenotype was ablated when additional CDK4/6 inhibitors, palbociclib or ribociclib, were supplemented with androgen-deprivation and enzalutamide treatment. The average of three experiments is plotted and error bars represent standard deviation. (*) Overexpression of a gene led to a significant difference compared with luciferase control cells. (†) Cell-cycle inhibitor treatment led to a significant reduction of proliferation ( P < .005, two-tailed t test).

Article Snippet: Broad Institute Genomic Perturbation Platform protocols ( http://portals.broadinstitute.org/gpp/public/resources/protocols ) were followed to produce lentiviruses particles that contained open reading frames of CDK4 (TRCN0000473179), CDK6 (TRCN0000488331), or luciferase control (cloned into pLX307 plasmid).

Techniques: Over Expression, Cell Culture, Luciferase, Control, Expressing, Standard Deviation, Two Tailed Test

Journal: Cell Death & Disease

Article Title: Type 3 inositol 1,4,5-trisphosphate receptor has antiapoptotic and proliferative role in cancer cells

doi: 10.1038/s41419-019-1433-4

Figure Lengend Snippet: IP 3 R3-knockout DLD1 cell line, DLD1/IP 3 R3_del, was established using the CRISPR/Cas9 gene editing method. The IP 3 R3 protein knockout in DLD1/IP 3 R3_del cells was confirmed by immunofluorescence ( a ) and also by Western blot analysis ( b ) using anti-IP 3 R3 antibody. Either DLD1, or DLD1/IP 3 R3_del cells were subcutaneously injected into the lower flank of the nude mice and growth of tumors was compared ( c ). After 12 days, tumors were extirpated ( c ) and relative volumes were significantly lower from DLD1/IP 3 R3_del cells compared to DLD1 cells ( d ). Western blot analysis revealed increased expression of the IP 3 R1 in tumors from DLD1/IP 3 R3_del cells compared to DLD1 cells ( e ), while no expression of the IP 3 R3 was observed in tumors induced by DLD1/IP 3 R3_del cells ( f ). Apoptosis was determined in tumor slices by TUNEL assay ( g ), and differenced in morphology are shown by hematoxylin/eosin staining (HaE; g , bottom). NC negative control. In graphs, results are displayed as mean ± SEM, n = 6. Statistical significance * p < 0.05, ** p < 0.001, and *** p < 0.0001

Article Snippet: The IP 3 R3 CRISPR guide RNA sequences (GTGCCCCATGAACCGCTACT and TACGAGCTCAGCGACAACGC) were designed by the laboratory of Feng Zhang at the Broad Institute in order to efficiently target the IP 3 R3 gene with minimal risk of off-target Cas9 binding elsewhere in the genome , .

Techniques: Knock-Out, CRISPR, Immunofluorescence, Western Blot, Injection, Expressing, TUNEL Assay, Staining, Negative Control

Journal: Cell Death & Disease

Article Title: Type 3 inositol 1,4,5-trisphosphate receptor has antiapoptotic and proliferative role in cancer cells

doi: 10.1038/s41419-019-1433-4

Figure Lengend Snippet: Apoptosis induction in DLD1 and DLD1/IP 3 R3_del cells after silencing of the IP 3 R1 and subsequent induction of apoptosis by AIK ( a ). Silencing of the IP 3 R1 decreased the basal apoptosis compared to cells treated with scrRNA in both, DLD1 and DLD1/IP 3 R3_del cells. After treatment with AIK, apoptosis was significantly higher in DLD1/IP 3 R3_del than in DLD1 cells. In DLD1 cells, we observed co-localization of IP 3 R1 and IP 3 R3 by proximity ligation assay ( b ). Scale bar represents 25 μm. Silencing of the IP 3 R1 and/or IP 3 R3 revealed a decrease in levels of cytosolic calcium in RCC4, A2780 and DLD1 cells ( c ). Interestingly, the increase in cytosolic calcium after AIK treatment was not as high as in cells treated with scrambled RNA ( c ). Double knockout of IP 3 R1/IP 3 R3 completely abolished apoptosis induction ( d ). Further, we compared apoptosis induction ( e ) in DLD1 and DLD1/IP 3 R3_del cells after 24 and 48 h hypoxia induced by DMOG. Depletion of the IP 3 R3 resulted in rapid increase of apoptosis both, in normoxia and hypoxia. On contrary to DLD1 cells, this increase was not dependent on duration of hypoxia ( e ) in DLD1/IP 3 R3_del cells, but the level of the apoptosis was higher in normoxic and 24 h hypoxia group compared to DLD1 cells. Scale bar represents 300 μm. Results are displayed as mean ± SEM, n = 3–6. Statistical significance * p < 0.05, ** p < 0.001, and *** p < 0.0001

Article Snippet: The IP 3 R3 CRISPR guide RNA sequences (GTGCCCCATGAACCGCTACT and TACGAGCTCAGCGACAACGC) were designed by the laboratory of Feng Zhang at the Broad Institute in order to efficiently target the IP 3 R3 gene with minimal risk of off-target Cas9 binding elsewhere in the genome , .

Techniques: Proximity Ligation Assay, Double Knockout