Journal: PLoS Pathogens

Article Title: Nuclear PYHIN proteins target the host transcription factor Sp1 thereby restricting HIV-1 in human macrophages and CD4+ T cells

doi: 10.1371/journal.ppat.1008752

Figure Lengend Snippet: Endogenous IFI16 inhibits HIV-1 in primary CD4 + T lymphocytes. Cells from three healthy donors were isolated and activated with IL-2 and anti-CD3/CD28 beads. 72 hours post-activation, cells were transfected with Cas9 in complex with either a non-targeting (nt) or an IFI16-specific gRNA. At 96 hours post-transfection, cells were transduced with the indicated VSV-G pseudotyped HIV-1 strains. (A-D) The reduction of IFI16 protein levels in infected cell cultures (A), the infectious virus yield (B), p24 antigen production (C) and levels of viral RNA transcripts (D) were determined by Western blot, TZM-bl infection assay, ELISA and qRT-PCR, respectively, three days post infection. Bar diagrams in panel A and D show mean values (±SD) of the three different donors; those in panel B and C from triplicate measurements. Numbers above bars indicate n-fold change between cells treated with control or IFI16 specific gRNA. * p <0.05, ** p <0.01, *** p <0.001. (E) Association of Sp1 and IFI16 by in situ PLA. (F) Sp1 co-precipitates with IFI16 and PYHIN in CD4 + T lymphocytes. Cells from three healthy donors were isolated and activated with IL-2 and anti-CD3/CD28 beads. 72 hours post activation, cells were lysed and endogenous Sp1 was immunoprecipitated using magnetic beads coated with either an Sp1 antibody or control IgG. Co-IP eluates and input controls were subsequently analysed by Western Blotting. Shown is the blot of one representative experiment. On the right-hand panel, the IFI16 signal intensity from three independent experiment (±SEM) is shown.

Article Snippet: Alternatively, 1*10 6 cells were transfected with the HiFi Cas9 Nuclease V3 (IDT)/gRNA complex (80 pmol/300 pml) (Lonza) using a non-targeting (IDT (ACGGAGGCTAAGCGTCGCAA)) or an IFI16-specific (IDT (GACCAGCCCTATCAAGAAAG)) sgRNAs, using the Amaxa 4D-Nucleofector Human Activated T Cell P3 Lonza Kit (Lonza), pulse code EO115.

Techniques: Isolation, Activation Assay, Transfection, Transduction, Infection, Virus, Western Blot, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR, Control, In Situ, Immunoprecipitation, Magnetic Beads, Co-Immunoprecipitation Assay

Journal: Science Advances

Article Title: Senataxin and DNA-PKcs redundantly promote non-homologous end joining repair of DNA double strand breaks during V(D)J recombination

doi: 10.1126/sciadv.ads5272

Figure Lengend Snippet: ( A ) Schematic of the retroviral V(D)J recombination substrate pMG-INV. The open and filled triangles represent the RSSs. The retroviral LTRs, CEs, and SEs upon RAG cleavage and CJs and SJs after NHEJ-mediated repair are indicated. The anti-sense GFP cDNA is inverted to the sense orientation upon completion of the recombination and its expression driven by the retroviral LTR (green). ( B ) Schematic diagram of a genome-wide CRISPR-Cas9 screen in WT abl pre-B cells for identifying genes important for V(D)J recombination upon DNA-PKcs inhibition with NU7441. ( C ) Fold enrichments of selected gRNAs from screens conducted in DMSO and NU7441-treated WT abl pre-B cells (both also treated with imatinib). The fold enrichment is calculated as the ratio of the normalized read counts of a gRNA from GFP − cells over that from GFP + cells. Asterisk denotes (*) five gRNAs to each gene. ( D ) Flow cytometric analysis for GFP expression in WT and three independently isolated Setx −/− abl pre-B cell lines with pMG-INV and treated with imatinib (imat.) in the presence or absence of the DNA-PKcs kinase inhibitor NU7441 for the indicated times. The percentages of GFP + cells are indicated in the top left corners of the histograms.

Article Snippet: For each screen, ~180 × 10 6 cells were transduced with a lentiviral gRNA library containing 90,230 gRNAs targeting 18,424 mouse genes (Addgene, #67988) at a 40 to 50% transduction efficiency, as determined by the percentage of blue fluorescent protein (BFP)–positive cells after transduction.

Techniques: Retroviral, Expressing, Genome Wide, CRISPR, Inhibition, Isolation