crispr control vector Search Results


93
Addgene inc murine zfp36
(A) Forest plots depicting RNA and IHC-based for <t>ZFP36</t> /TTP expression related to clinical outcomes (biochemical recurrence and disease-free survival) and risk of lethal prostate cancer (case-control cohorts). (B) (left) Upregulated and downregulated genes were identified by differential expression analysis of TCGA PRAD cases divided by lower quartile expression of ZFP36 ; (right). (C) Representative images of IF staining in human PCa used for expression analysis. Benign glands (arrowheads) stain for pan-cytokeratin (yellow) and basal (red) cocktails; tumor cells (arrows) demonstrate absent basal expression (panels ii & iv). Corresponding sections (i & iii) demonstrate intact epithelial staining for TTP (green). Panels v-vi: Diffuse prostate tumor with absent TTP expression. (D) Kaplan Meier survival analysis demonstrating that TTP deficiency, measured by protein expression (DFCI ( , )) and ZFP36 mRNA expression (TCGA PRAD ; Taylor et al ), results in shorter disease-free-survival, and even shorter disease-free-survival in combination with PTEN deficiency.
Murine Zfp36, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+control+vector/ZFP36+(TTP)+(Plasmid+%23156147)/bio_rxiv__2022__08__05__500896-85-15-27
Average 93 stars, based on 1 article reviews
murine zfp36 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

92
ATCC zikv preparation zikv human
(A) Representative immunostaining for <t>ZIKV</t> envelope protein (ZIKV-E, green) and DAPI (blue) of GSCs and forebrain-specific NPCs 48 h post-infection (p.i.) with ZIKV. Scale bar, 50 μm. (B) Quantification of infection efficiency in four GSC and NPC lines 48 h p.i. with ZIKV. (C) Quantification of ZIKV+ cells in a panel of human GSCs and NPCs. (D) Kinetics of viral RNA copies p.i. with ZIKV by measuring viral RNA copies by qRT-PCR in NPC C4–7 and GSC3565. (E) ZIKV infection efficiency of GSCs and NPCs was measured by direct measurement of viral RNA copies. (F) Representative bright-field images 5 days p.i. with ZIKV for GSCs, NPCs, and primary astrocytes. Scale bars, 50 μm. (G) Cell viability normalized to day 5 mock, as measured 5 days p.i. with ZIKV for GSCs, NPCs, and primary astrocytes. (H) GSCs (GSC3565), differentiated GSCs, NPCs (NPC C4–7), and differentiated NPCs were assayed for cell viability 72 h p.i. with ZIKV. (I) Apoptosis of GSCs (387, 3565) and primary (NPC194, fetal human [fh] NPC) or iPSC-derived NPCs (WT83, C4–7) p.i. with ZIKV was measured by cleaved caspase-3 <t>(CC3)</t> <t>staining.</t> (J) Representative immunostaining for ZIKV-E (green), CC3 (red), and DAPI (blue) of GSCs and forebrain-specific NPCs 48 h p.i. with ZIKV. Scale bar, 50 μm. (K) Representative immunostaining for ZIKV-E (green), CC3 (red), and DAPI (blue) of GSCs and forebrain-specific NPCs 72 h p.i. with ZIKV. Scale bars, 50 μm. (L) Quantification of the percentage of CC3+ cells in DAPI+ cells for GSCs and NPCs 72 h p.i. with ZIKV. (M) Cell viability of patient-derived cultures from GBM (387 and 3565), pontine glioma (3752 and 007), meningioma (CH-157MN, IOMM-LEE), ependymoma (EP1), and medulloblastoma cell lines (DAOY, D283, HDMB03, D341) 72 h after ZIKV infection. Experiments were performed in two biological replicates with three technical repeats. Values represent mean ± SEM. NS, no significance. ****p < 0.0001 by one-way ANOVA.
Zikv Preparation Zikv Human, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+control+vector/Monocercomonas+sp/pmc09628766-737-34-57
Average 92 stars, based on 1 article reviews
zikv preparation zikv human - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

94
Genecopoeia human wt syt11 promoter gluc seap vector
( a ) The mRNA levels of <t>SYT11</t> and GAPDH in Control and ATP13A2-knockdown HeLa cells were measured by real-time PCR. The experiment (with triplicates) was repeated an additional two times and all were similarly significant. ( b ) Primary cultures of mouse neurons transduced with Control or ATP13A2 lentiviral shRNAs for 5 days were used to measure the mRNA levels of SYT11 and GAPDH by real-time PCR. The graph shows the mean±s.d. of four independent experiments. * P <0.05 (two-tailed paired Student's t -test). ( c ) Primary cultures of mouse neurons transduced with Control or ATP13A2 lentiviral shRNAs (#A and #B) were lysed and blotted against SYT11 and actin. A representative experiment with triplicates is shown. ( d ) The mRNA levels of SYT11 and GAPDH in HeLa cells transfected with empty pcDNA3.1 or ATP13A2 WT were measured by real-time PCR. A representative experiment (with triplicates) of three similarly significant independent experiments is shown. ( e ) HeLa cells transfected with empty pcDNA3.1, ATP13A2 WT, ATP13A2 delC or ATP13A2 i16 mutants were used to measure the mRNA levels of SYT11 and GAPDH by real-time PCR. The experiment was repeated and both experiments were similarly significant. ( f ) HeLa cells transfected with V5-tagged ATP13A2 WT, ATP13A2 delC or ATP13A2 i16 constructs were immunostained against V5 and LAMP1 and imaged using confocal microscopy (scale bar 10 μM). Unless otherwise stated, all the graphs represent mean±s.d. and statistical significance was determined using two-tailed unpaired Student's t -test. ** P <0.01; *** P <0.001; NS, not significant.
Human Wt Syt11 Promoter Gluc Seap Vector, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+control+vector/Promoter+reporter+clone+for+Human+SYT11/pmc04906231-144-3-8
Average 94 stars, based on 1 article reviews
human wt syt11 promoter gluc seap vector - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

93
Sino Biological pcmv3 sp flag mmp2 vector
Identification of candidates involved in the trafficking of <t>MMP2.</t> (A) Scheme of the MMP2 RUSH construct. SS-Flag-MMP2-HA-SBP-eGFP was used as a reporter. Fluorescence images show HeLa cells expressing MMP2-SBP-eGFP counterstained against TGN46 (red). Without biotin, MMP2 is retained in the ER (0 min). It reaches the Golgi 15 min after biotin addition and is sorted into vesicles (arrowheads) at 30 and 45 min, respectively. Scale bars, 5 µm. (B) MS strategy to identify MMP2 interacting partners in the Golgi. HeLa cells expressing MMP2-SBP-eGFP or SS-SBP-eGFP were incubated for 20 min with biotin to enrich reporter proteins at the Golgi. After GFP IP, samples were analyzed using MS ( n = 3). (C) Volcano plot highlights significantly enriched MMP2 interactors in pink. 42 sorting-related candidates were found, among them TIMP2, a known inhibitor of MMP2, and NUCB1. Two-sample t test, false discovery rate = 0.3, minimum fold change = 0.5. (D) Fluorescence images of HeLa cells labeled with endogenous NUCB1 (green) and GM130 or TGN46 (red). Scale bars, 5 µm; zoom, 2 µm. (E) HEK 293T cells expressing SS-MMP2-SBP-eGFP or SS-SBP-eGFP were processed for GFP IP and WB analysis. (F) Semiquantitative analysis of the normalized NUCB1 to GFP signal from two independent experiments. Significance: one-sample t test. (G) His-tag coIP of recombinant rNUCB1-His. Endogenous MMP2 from HeLa Golgi membranes coimmunoprecipitated with rNUCB1-His but not rGFP-His. (H) Semiquantitative analysis of the MMP2 signal from three independent experiments. Bars, mean ± SD. Paired t test: *, P < 0.05; ***, P < 0.001.
Pcmv3 Sp Flag Mmp2 Vector, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+control+vector/pCMV3-SP-N-FLAG+Negative+Control+Vector/pmc07401813-219-8-10
Average 93 stars, based on 1 article reviews
pcmv3 sp flag mmp2 vector - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Sino Biological human serpinb3
( A ) Normalized <t>SERPINB3</t> transcript in cervical tumor biopsies from RNAseq was distributed by reads per kilobase of transcript per million mapped reads (RPKM). ( B ) Boxplots along with individual data points show xCell immune scores in recurrent (R)/non-recurrent (NR) SERPINB3-low (B3/L) and SERPINB3-high (B3/H) tumors. * P < 0.05, one-way ANOVA test. ( C ) Heatmap of enriched immune cell subpopulation was generated through xCell immune infiltrate prediction. Color intensity is proportional to average xCell score for each population across samples. ( D-G ) Spearman’s correlation of SERPINB3 with the expression of ( D ) CXCL1, ( E ) CXCL8, ( F ) S100A8, ( G ) S100A9 was performed using RNAseq from 66 cervical tumor biopsies collected prior to (chemo)- RT. ( H ) SERPINB3 expression correlated with CXCL1, CXCL8, S100A8, S100A9 expression in multiple cancer types. Analysis was performed using TCGA PanCancer Atlas and numeric values indicate Spearman’s correlation coefficient. BLCA, bladder urothelial carcinoma; BRCA, breast invasive carcinoma; CESC, cervical squamous cell carcinoma and endocervical adenocarcinoma; HNSC, head and neck squamous cell carcinoma; LUSC, lung squamous cell carcinoma; PRAD, prostate adenocarcinoma; UCEC, uterine corpus endometrial carcinoma
Human Serpinb3, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+control+vector/Human+SERPINB3+%2F+SCCA-1+Gene+ORF+cDNA+clone+in+cloning+vector/bio_rxiv__2023__02__01__526675-175-13-18
Average 93 stars, based on 1 article reviews
human serpinb3 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

99
New England Biolabs msk1 noti myc reverse
(A) <t>Msk1</t> mRNA expression levels (qPCR) in cortex and striatum at different postnatal ages (P5, P10, P15 and P30). * P <0.05, ** P <0,01, *** P <0.001 (mean ± SEM; n=3 animal/age group; Ordinary one-way ANOVA). (B) MSK1 expression levels (WB) in cortex and striatum at different postnatal ages using specific antibodies against the C-terminal domain of MSK1. * P <0.05 (mean ± SEM; n=3 animals/age group; Ordinary one-way ANOVA). (C and F) Representative single plane confocal images of MSK1 expression pattern (green) in the somatosensory cortex and striatum of 5- and 30-day-old Vgat-IRES-CRE; Ai9-RLC tdTomato mice. Endogenous tdTomato fluorescence (red) reveals GABAergic neurons. Arrows point to cells co-expressing MSK1 and tdTomato. (D and E) Quantification of MSK1 + /tdTomato + cells and tdTomato + /MSK1 + cells in the somatosensory cortex at different postnatal ages. * P <0.05, ** P <0.01, *** P <0.001 (mean ± SEM; n=3 mice/age group, 6-8 images per animal; Ordinary one-way ANOVA). (G and H) Quantification of MSK1 + cells and tdTomato + MSK1 + cells in the striatum at different postnatal ages. **P<0.01 (mean ± SEM; n=3 mice, 6-8 images per animal; Ordinary one-way ANOVA). Scale bars = 100µm.
Msk1 Noti Myc Reverse, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+control+vector/NotI/bio_rxiv__2024__01__23__576945-281-25-46
Average 99 stars, based on 1 article reviews
msk1 noti myc reverse - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

97
New England Biolabs lgals1 luciferase reporter gene
( a ) BTSCs were subjected to immunoblotting analysis using the antibodies indicated on the blots. wtEGFR and EGFRvIII bands are marked with * and **, respectively. ( b ) Densitometric quantification of galectin1 protein level normalized to tubulin in different BTSC lines is shown. ( c-d ) EGFR / EGFRvIII KD (si EGFR ) and control BTSCs (siCTL) were analyzed by immunoblotting as described in a. ( e-h ) BTSCs were treated with 1 or 5 µM lapatinib and galectin1 expression was assessed by immunoblotting (e-f) and immunostaining (g-h). Nuclei were stained with DAPI. Scale bar = 10 μm. ( i ) BTSCs were subjected to immunoblotting analysis using the antibodies indicated on the blots. ( j ) Pearson correlation analysis of pSTAT3-Y705 and galectin1 protein expression in different BTSCs is shown. ( k-l ) STAT3 KD (si STAT3 ) and siCTL BTSCs were analyzed by immunoblotting as described above. ( m-p ) BTSCs were subjected to immunoblotting or immunostaining following treatment with 25 or 50 µM of the STAT3 inhibitor, S3I-201. Scale bar = 10 μm. ( q-s ) EGFRvIII-expressing BTSCs were subjected to ChIP using an antibody to STAT3 or IgG control followed by qPCR using two different pairs of primers ( <t>LGALS1</t> -a and LGALS1 -b). OSMR , and HPRT loci were used as positive and negative controls, respectively. ( t-u ) Luciferase reporter assay was performed in BTSC73 following KD of STAT3 using siRNA (t) or treatment with STAT3 inhibitors, 5 µM WP1066 or 50 μM S3I-201 (u). Data are presented as the mean□±□SEM, n ≥ 3. Unpaired two-tailed t -test (q, r and s); one-way ANOVA followed by Dunnett’s test (b) or Tukey’s test (t and u),*p < 0.05, **p < 0.01, ***p < 0.001. See also Figures S1 and S2.
Lgals1 Luciferase Reporter Gene, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+control+vector/EcoRV/bio_rxiv__2021__04__14__439704-365-22-40
Average 97 stars, based on 1 article reviews
lgals1 luciferase reporter gene - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

90
OriGene klf13 expression vector
Circadian rhythmicity in Dbp mRna was abolished in Klf9 and <t>Klf13</t> double knockout ht22 cells. We created single and double knockout cells using CRisPR/Cas9 genome editing. We plated cells at equal densities, treated with 1 μM CORt for 1 h at 6-h intervals through 60 h to synchronize circadian gene expression, and then all cells were harvested together at 66 h for analysis of Dbp mRna by real-time quantitative polymerase chain reaction. We analyzed circadian rhythmicity using CircWave software. the ht22 parent cell line (wild type) showed statistically significant circadian oscillation in Dbp mRna. Mutation of Klf9 or Klf13 alone did not affect the Dbp mRna rhythm. By contrast, regular oscillations in Dbp mRna were abolished in the double knockout cells. each point represents the mean ± seM (n = 4/treatment).
Klf13 Expression Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+control+vector/Klf13+(NM_021366)+Mouse+Tagged+ORF+Clone/pmc09199006-91-4-12
Average 90 stars, based on 1 article reviews
klf13 expression vector - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

96
OriGene sh rna scramble

Sh Rna Scramble, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+control+vector/Scrambled+shRNA+control+in+pGFP-C-shLenti+shRNA+Vector/pmc06890458-6-7-11
Average 96 stars, based on 1 article reviews
sh rna scramble - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

99
Danaher Inc factor ix human simplestep elisa kit
a , Eight-week-old C57BL/6J mice were injected with 5×10 11 GC of AAV-CRISPR and 1×10 11 GC of an AAV-Donor containing the promoterless coding sequences of human FAH (selectable marker) and FIX or 6×10 11 GC of AAV-GFP as control. Mice were injected with Fah -siRNA (3 mg/kg or saline as control) every 4 weeks until 12 weeks post-AAV injection. Blood was collected at time 0 and every two to four weeks and mice were sacrificed at 52 weeks post AAV-injection. Created with BioRender.com. b , Human FIX <t>ELISA</t> in plasma samples. c , Representative immunohistochemistry staining of 2A-tagged FAH (FAH-2A), hematoxylin and eosin (H&E) and Fah in the liver. Scale bar is 100 µm. Data are expressed as mean ± s.d. (n= 3 Control and 9 Unselected and Repair Drive mice) with significance determined by two-way ANOVA followed by Tukey test. **** p<0.0001 Repair Drive vs. Control and Unselected mice.
Factor Ix Human Simplestep Elisa Kit, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+control+vector/Human+MER+ELISA+Kit/bio_rxiv__2023__07__26__550728-239-10-17
Average 99 stars, based on 1 article reviews
factor ix human simplestep elisa kit - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

96
Addgene inc lentiviral vector lenticrispr v2
(A) Ter119 negative cells and Ter119 positive erythroid cells were purified from wild-type mouse bone marrow cells. G4 levels were tested by flow cytometry using the BG4 antibody that specifically recognizes G4. Quantification is on the right. (B) Bone marrow lineage-negative cells were cultured in Epo medium for 2 days. G4 levels were tested on different days using flow cytometry by the BG4 antibody. Quantification is on the right. (C) CD34+ human HSPCs were cultured in Epo medium for 21 days. The levels of G4 were measured by flow cytometry as in B at the indicated time. Cells at day 7, 14, and 21 represent proerythroblasts, polychromatic to orthochromatic erythroblasts, and orthochromatic to mature red blood cells, respectively. (D) Flow cytometric assays of G4 levels in the indicated bone marrow lineage cells purified from wild-type mice. (E) Quantification of D. (F) Gating strategy of various erythroblasts. Populations I to VI represent proerythroblasts, basophilic erythroblasts, polychromatic erythroblasts, orthochromatic erythroblasts, late orthochromatic to reticulocytes, and mature red blood cells, respectively. (G-H) Flow cytometric assay of G4 level in bone marrow erythroid populations I (G) and V (H) from the indicated mice. Quantification is on the right. (I) Bone marrow lineage negative cells from the indicated mice were cultured in Epo medium for 2 days. G4 levels on different days were measured by flow cytometry using BG4 antibody. Quantification is below the histogram. (J) CD34+ cells were transduced with <t>lentiviral</t> vectors expressing indicated sgRNAs and <t>Cas9.</t> Cells were then harvested for Western blotting of the indicated proteins at day 9 in culture. (K) Quantitative analyses of G4 levels in cells from J using flow cytometric assays. (L) Quantitative analyses of cell death in cells from J using flow cytometric assays. The dead cells are defined as propidium iodide and annexin V double positive. (M) Quantitative analyses of G4 levels in bone marrow mononuclear cells from the patient with DDX41 mutated MDS. All the error bars represent the SEM of the mean. The comparison between two groups was evaluated with 2 tailed t tests, and the comparison among multiple groups was evaluated with 1-way ANOVA tests. * p<0.05, **p<0.01, ***p<0.001, and ****p<0.0001. ns: not significant.
Lentiviral Vector Lenticrispr V2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+control+vector/lentiCRISPR+v2+(Plasmid+%2352961)/bio_rxiv__2024__10__14__617891-265-11-15
Average 96 stars, based on 1 article reviews
lentiviral vector lenticrispr v2 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
Addgene inc taok1 sgrnas
( A ) Schematic outline of the kinome shRNA and whole genome CRISPR-Cas9 screens. ( B ) Volcano plot representing gene summary of MAGeCK analysis of the kinome shRNA screens in KB2P-1.21 cells treated with olaparib. ( C ) Volcano plot representing gene summary of MAGeCK analysis of the whole genome CRISPR-Cas9 screens in RPE1-hTERT BRCA1 -/- ;p53 -/- cells treated with 2 Gy IR. ( D, E ) Growth assays in KB2P-3.4 (D) or KB1P-G3 (E) <t>Taok1</t> -/- cell lines treated with the indicated doses of olaparib (D) or IR (E). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( F ) Representative images of growth assays in KB1P-G3 NT, Taok1 -/- with empty rescue construct (pOZ-empty) or Taok1 full cDNA rescue construct (pOZ-Taok1) treated with the indicated doses of olaparib. ( G ) Kaplan-Meier survival curve of mice transplanted with KB1P-4S organoids with NT or Taok1 sgRNAs and treated with olaparib. Statistical analysis was performed with the log-rank test. ( H, I ) Growth assays in KB1P-G3 Taok1 -/- cell lines complemented with indicated rescue construct. Cells were treated with indicated doses of olaparib (H) or IR (I). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test.
Taok1 Sgrnas, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+control+vector/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/bio_rxiv__2025__10__14__682031-216-11-18
Average 96 stars, based on 1 article reviews
taok1 sgrnas - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

Image Search Results


(A) Forest plots depicting RNA and IHC-based for ZFP36 /TTP expression related to clinical outcomes (biochemical recurrence and disease-free survival) and risk of lethal prostate cancer (case-control cohorts). (B) (left) Upregulated and downregulated genes were identified by differential expression analysis of TCGA PRAD cases divided by lower quartile expression of ZFP36 ; (right). (C) Representative images of IF staining in human PCa used for expression analysis. Benign glands (arrowheads) stain for pan-cytokeratin (yellow) and basal (red) cocktails; tumor cells (arrows) demonstrate absent basal expression (panels ii & iv). Corresponding sections (i & iii) demonstrate intact epithelial staining for TTP (green). Panels v-vi: Diffuse prostate tumor with absent TTP expression. (D) Kaplan Meier survival analysis demonstrating that TTP deficiency, measured by protein expression (DFCI ( , )) and ZFP36 mRNA expression (TCGA PRAD ; Taylor et al ), results in shorter disease-free-survival, and even shorter disease-free-survival in combination with PTEN deficiency.

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) Forest plots depicting RNA and IHC-based for ZFP36 /TTP expression related to clinical outcomes (biochemical recurrence and disease-free survival) and risk of lethal prostate cancer (case-control cohorts). (B) (left) Upregulated and downregulated genes were identified by differential expression analysis of TCGA PRAD cases divided by lower quartile expression of ZFP36 ; (right). (C) Representative images of IF staining in human PCa used for expression analysis. Benign glands (arrowheads) stain for pan-cytokeratin (yellow) and basal (red) cocktails; tumor cells (arrows) demonstrate absent basal expression (panels ii & iv). Corresponding sections (i & iii) demonstrate intact epithelial staining for TTP (green). Panels v-vi: Diffuse prostate tumor with absent TTP expression. (D) Kaplan Meier survival analysis demonstrating that TTP deficiency, measured by protein expression (DFCI ( , )) and ZFP36 mRNA expression (TCGA PRAD ; Taylor et al ), results in shorter disease-free-survival, and even shorter disease-free-survival in combination with PTEN deficiency.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Expressing, Control, Quantitative Proteomics, Staining

(A) hematoxylin and eosin staining of murine tumors highlighting morphological progression of wild-type (WT), Pten f/f / Zfp36 +/+ ( Pten -/-), Pten f/f / Zfp36 f/+ ( Pten -/- Zfp36 +/-) and Pten f/f / Zfp36 f/+ ( Pten -/- Zfp36 -/-) dorsolateral prostate tissue at 8 18, and 38 weeks. Scale bar 100 μm. (B) Comparative weight of dorsolateral and ventral prostate tissue in GEMMs at 18 and 38 weeks. (C) Kaplan Meier graphs from GEMM aging studies show that prostate-specific deletion of Zfp36 significantly reduces time-to-ethical endpoint in PCa driven by loss of Pten. *p<0.05, **p<0.005.

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) hematoxylin and eosin staining of murine tumors highlighting morphological progression of wild-type (WT), Pten f/f / Zfp36 +/+ ( Pten -/-), Pten f/f / Zfp36 f/+ ( Pten -/- Zfp36 +/-) and Pten f/f / Zfp36 f/+ ( Pten -/- Zfp36 -/-) dorsolateral prostate tissue at 8 18, and 38 weeks. Scale bar 100 μm. (B) Comparative weight of dorsolateral and ventral prostate tissue in GEMMs at 18 and 38 weeks. (C) Kaplan Meier graphs from GEMM aging studies show that prostate-specific deletion of Zfp36 significantly reduces time-to-ethical endpoint in PCa driven by loss of Pten. *p<0.05, **p<0.005.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Staining

(A) GSEA from RNA-seq of endpoint GEMM PCa tumors comparing Pten -/-, and Pten -/- Zfp36 -/- GEMMs, highlighting positively and negatively enriched Hallmark pathways. (B) Phos-p65 IF and Masson’s Trichrome staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Scale bar 100 μm. *p<0.05, **p<0.005.

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) GSEA from RNA-seq of endpoint GEMM PCa tumors comparing Pten -/-, and Pten -/- Zfp36 -/- GEMMs, highlighting positively and negatively enriched Hallmark pathways. (B) Phos-p65 IF and Masson’s Trichrome staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Scale bar 100 μm. *p<0.05, **p<0.005.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: RNA Sequencing, Staining

(A) GSEA from RNA-seq of endpoint GEMM PCa tumors comparing Pten -/-, and Pten -/- Zfp36 -/- GEMMs, highlighting significant positively and negatively enriched GOBP pathways. (B) Ki-67 IHC, and Krt18 and αSMA IF staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Increased tumor cell proliferation and basement membrane breakdown is observed with loss of Zfp36 . (C) Number of mice that displayed PCa cells in distant organs by recombination PCR in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMMs. (D) Representative androgen receptor (AR) IF staining in pelvic lymph nodes of Pten -/- and Pten -/- Zfp36 -/- GEMMs highlighting local dissemination of prostate cells. Scale bar 100 μm. AR staining was over exposed during imaging to assist with prostate cell identification. (E) Representative images and quantification of budding in GEMM-derived organoids highlighting increased invasive and metastatic potential of Pten -/- Zfp36 -/-organoids. (F) Scratch assay in GEMM-derived 2D cells, comparing Pten -/- and Pten -/- Zfp36 -/- wound healing with that of Pten -/- Rb1 -/-, a previously described metastatic, neuroendocrine PCa murine cell line . *p<0.05, **p<0.005, ***p<0.001, ****p<0.0001.

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) GSEA from RNA-seq of endpoint GEMM PCa tumors comparing Pten -/-, and Pten -/- Zfp36 -/- GEMMs, highlighting significant positively and negatively enriched GOBP pathways. (B) Ki-67 IHC, and Krt18 and αSMA IF staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Increased tumor cell proliferation and basement membrane breakdown is observed with loss of Zfp36 . (C) Number of mice that displayed PCa cells in distant organs by recombination PCR in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMMs. (D) Representative androgen receptor (AR) IF staining in pelvic lymph nodes of Pten -/- and Pten -/- Zfp36 -/- GEMMs highlighting local dissemination of prostate cells. Scale bar 100 μm. AR staining was over exposed during imaging to assist with prostate cell identification. (E) Representative images and quantification of budding in GEMM-derived organoids highlighting increased invasive and metastatic potential of Pten -/- Zfp36 -/-organoids. (F) Scratch assay in GEMM-derived 2D cells, comparing Pten -/- and Pten -/- Zfp36 -/- wound healing with that of Pten -/- Rb1 -/-, a previously described metastatic, neuroendocrine PCa murine cell line . *p<0.05, **p<0.005, ***p<0.001, ****p<0.0001.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: RNA Sequencing, Staining, Membrane, Imaging, Derivative Assay, Wound Healing Assay

(A) AR, synaptophysin (Syp) and CD45 IF staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Scale bar 100 μm. *p<0.05, **p<0.005. (B) Dual Krt8 and CD45 IF staining in Pten -/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks. Scale bar 50 μm.

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) AR, synaptophysin (Syp) and CD45 IF staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Scale bar 100 μm. *p<0.05, **p<0.005. (B) Dual Krt8 and CD45 IF staining in Pten -/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks. Scale bar 50 μm.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Staining

(A) Kaplan Meier graph from GEMM aging studies where mice were surgically castrated at 38 weeks comparing Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- mice, and whole prostate weights and representative images from mice 12 weeks post-castration. (B) Quantification of GEMM-derived Pten -/- and Pten -/- Zfp36 -/- organoid growth in the presence and absence of enzalutamide (10 μM). (C) Allograft tumor growth in mice treated with DMAPT (100 mg/kg/day) or water vehicle ± surgical castration, n=5 mice per treatment group. (D) End-point tumor volumes from allograft therapy studies. (E) Representative images and (F) quantification of cell death (green) in GEMM-derived PCa organoids treated with DMAPT (5 μM), enzalutamide (10 μM) or the combination of both for 72 hours, n=10 organoids per treatment group. (G) Representative images and flow cytometry quantification for CD45, synaptophysin, and AR expression in GEMM-derived PCa organoids treated with DMAPT (5 μM) or DMSO vehicle for 72 hours. (H) Fold-change in expression of the AR response gene – Fkbp5 in GEMM-derived 2D cell lines treated with DMAPT (5 μM) or DMSO vehicle for 72 hours, R1881 (10nM was used to stimulate AR activity. *p<0.05, **p<0.005, ***p<0.001. (I) Schematic overview: i) when ZFP36 is intact epithelial cells present with a luminal lineage phenotype and sensitivity to AR inhibition. ii) loss of ZFP36 results in an alternative epithelial cell lineage phenotype with reduced AR expression, increased SYP and CD45 expression, and increased NF-κB activation and inflammation, leading to lack of response to AR inhibition. iii) DMAPT treatment inhibits NF-κB and inflammation signaling and restores a more luminal epithelial cell type and responsiveness to AR inhibition.

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) Kaplan Meier graph from GEMM aging studies where mice were surgically castrated at 38 weeks comparing Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- mice, and whole prostate weights and representative images from mice 12 weeks post-castration. (B) Quantification of GEMM-derived Pten -/- and Pten -/- Zfp36 -/- organoid growth in the presence and absence of enzalutamide (10 μM). (C) Allograft tumor growth in mice treated with DMAPT (100 mg/kg/day) or water vehicle ± surgical castration, n=5 mice per treatment group. (D) End-point tumor volumes from allograft therapy studies. (E) Representative images and (F) quantification of cell death (green) in GEMM-derived PCa organoids treated with DMAPT (5 μM), enzalutamide (10 μM) or the combination of both for 72 hours, n=10 organoids per treatment group. (G) Representative images and flow cytometry quantification for CD45, synaptophysin, and AR expression in GEMM-derived PCa organoids treated with DMAPT (5 μM) or DMSO vehicle for 72 hours. (H) Fold-change in expression of the AR response gene – Fkbp5 in GEMM-derived 2D cell lines treated with DMAPT (5 μM) or DMSO vehicle for 72 hours, R1881 (10nM was used to stimulate AR activity. *p<0.05, **p<0.005, ***p<0.001. (I) Schematic overview: i) when ZFP36 is intact epithelial cells present with a luminal lineage phenotype and sensitivity to AR inhibition. ii) loss of ZFP36 results in an alternative epithelial cell lineage phenotype with reduced AR expression, increased SYP and CD45 expression, and increased NF-κB activation and inflammation, leading to lack of response to AR inhibition. iii) DMAPT treatment inhibits NF-κB and inflammation signaling and restores a more luminal epithelial cell type and responsiveness to AR inhibition.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Derivative Assay, Flow Cytometry, Expressing, Activity Assay, Inhibition, Activation Assay

(A) Representative immunostaining for ZIKV envelope protein (ZIKV-E, green) and DAPI (blue) of GSCs and forebrain-specific NPCs 48 h post-infection (p.i.) with ZIKV. Scale bar, 50 μm. (B) Quantification of infection efficiency in four GSC and NPC lines 48 h p.i. with ZIKV. (C) Quantification of ZIKV+ cells in a panel of human GSCs and NPCs. (D) Kinetics of viral RNA copies p.i. with ZIKV by measuring viral RNA copies by qRT-PCR in NPC C4–7 and GSC3565. (E) ZIKV infection efficiency of GSCs and NPCs was measured by direct measurement of viral RNA copies. (F) Representative bright-field images 5 days p.i. with ZIKV for GSCs, NPCs, and primary astrocytes. Scale bars, 50 μm. (G) Cell viability normalized to day 5 mock, as measured 5 days p.i. with ZIKV for GSCs, NPCs, and primary astrocytes. (H) GSCs (GSC3565), differentiated GSCs, NPCs (NPC C4–7), and differentiated NPCs were assayed for cell viability 72 h p.i. with ZIKV. (I) Apoptosis of GSCs (387, 3565) and primary (NPC194, fetal human [fh] NPC) or iPSC-derived NPCs (WT83, C4–7) p.i. with ZIKV was measured by cleaved caspase-3 (CC3) staining. (J) Representative immunostaining for ZIKV-E (green), CC3 (red), and DAPI (blue) of GSCs and forebrain-specific NPCs 48 h p.i. with ZIKV. Scale bar, 50 μm. (K) Representative immunostaining for ZIKV-E (green), CC3 (red), and DAPI (blue) of GSCs and forebrain-specific NPCs 72 h p.i. with ZIKV. Scale bars, 50 μm. (L) Quantification of the percentage of CC3+ cells in DAPI+ cells for GSCs and NPCs 72 h p.i. with ZIKV. (M) Cell viability of patient-derived cultures from GBM (387 and 3565), pontine glioma (3752 and 007), meningioma (CH-157MN, IOMM-LEE), ependymoma (EP1), and medulloblastoma cell lines (DAOY, D283, HDMB03, D341) 72 h after ZIKV infection. Experiments were performed in two biological replicates with three technical repeats. Values represent mean ± SEM. NS, no significance. ****p < 0.0001 by one-way ANOVA.

Journal: Cell stem cell

Article Title: Zika Virus Targets Glioblastoma Stem Cells through a SOX2-Integrin α v β 5 Axis

doi: 10.1016/j.stem.2019.11.016

Figure Lengend Snippet: (A) Representative immunostaining for ZIKV envelope protein (ZIKV-E, green) and DAPI (blue) of GSCs and forebrain-specific NPCs 48 h post-infection (p.i.) with ZIKV. Scale bar, 50 μm. (B) Quantification of infection efficiency in four GSC and NPC lines 48 h p.i. with ZIKV. (C) Quantification of ZIKV+ cells in a panel of human GSCs and NPCs. (D) Kinetics of viral RNA copies p.i. with ZIKV by measuring viral RNA copies by qRT-PCR in NPC C4–7 and GSC3565. (E) ZIKV infection efficiency of GSCs and NPCs was measured by direct measurement of viral RNA copies. (F) Representative bright-field images 5 days p.i. with ZIKV for GSCs, NPCs, and primary astrocytes. Scale bars, 50 μm. (G) Cell viability normalized to day 5 mock, as measured 5 days p.i. with ZIKV for GSCs, NPCs, and primary astrocytes. (H) GSCs (GSC3565), differentiated GSCs, NPCs (NPC C4–7), and differentiated NPCs were assayed for cell viability 72 h p.i. with ZIKV. (I) Apoptosis of GSCs (387, 3565) and primary (NPC194, fetal human [fh] NPC) or iPSC-derived NPCs (WT83, C4–7) p.i. with ZIKV was measured by cleaved caspase-3 (CC3) staining. (J) Representative immunostaining for ZIKV-E (green), CC3 (red), and DAPI (blue) of GSCs and forebrain-specific NPCs 48 h p.i. with ZIKV. Scale bar, 50 μm. (K) Representative immunostaining for ZIKV-E (green), CC3 (red), and DAPI (blue) of GSCs and forebrain-specific NPCs 72 h p.i. with ZIKV. Scale bars, 50 μm. (L) Quantification of the percentage of CC3+ cells in DAPI+ cells for GSCs and NPCs 72 h p.i. with ZIKV. (M) Cell viability of patient-derived cultures from GBM (387 and 3565), pontine glioma (3752 and 007), meningioma (CH-157MN, IOMM-LEE), ependymoma (EP1), and medulloblastoma cell lines (DAOY, D283, HDMB03, D341) 72 h after ZIKV infection. Experiments were performed in two biological replicates with three technical repeats. Values represent mean ± SEM. NS, no significance. ****p < 0.0001 by one-way ANOVA.

Article Snippet: After 30 minutes, the reaction cocktail was removed, cells were washed once with 1 mL of 3% BSA in PBS before proceeding to DNA staining (DAPI, Vector Laboratories H-1200) and imaging (Zeiss Apotome). . ZIKV preparation ZIKV human isolates H/PAN/2016/BEI-259634 and PRVABC59 (BEI Resources, NR-50210 and NR-50240) from Panama and Puerto Rico, respectively, were acquired from the ATCC and distributed by BEI.

Techniques: Immunostaining, Infection, Quantitative RT-PCR, Derivative Assay, Staining

(A) Representative immunostaining for ZIKV-E (green), SOX2 (red), and DAPI (blue) of GSCs and forebrain-specific hiPSC-derived NPCs 48 h p.i. with ZIKV. Scale bar, 50 μm. (B) Quantification of the percentage of SOX2+ cells in DAPI+ cells for GSCs and NPCs 48 h p.i. with ZIKV. (C) Representative immunostaining for ZIKV-E (green), SOX2 or AXL (red), and DAPI (blue) of GSCs (GSC3565) without transduction (shRNA) or transduced with control shRNA (shCONT), AXL shRNA (shAXL.2), or SOX2 shRNA (shSOX2.53) for 72 h and then 48 h with ZIKV infection. Scale bars, 100 μm. (D) Quantification of the percentage of ZIKV+ cells in DAPI+ cells in GSCs 1517 and 3565 under conditions for (C), with a range of ZIKV infection. (E) Viral copy number by qRT-PCR of GSCs (GSC3565 or GSC1517) or NPC C4–7 transduced with either shCONT or SOX2 shRNA (shSOX2.52 or shSOX2.53) for 72 h and then either exposed to mock conditions or infected with ZIKV for another 72 h. All comparisons are versus shCONT. (F) Gene set enrichment (GSE) bubble plots showing pathways positively (top, r > 0.4) or negatively (bottom, r < −0.4) correlated with SOX2 expression in the TCGA GBM HG-U133A microarray dataset. Each circle represents an enriched pathway, with the border color indicating the false discovery rate (FDR)-corrected p value. (G) GSE graph showing the top pathway enrichments positively or negatively correlated with SOX2 as described in (F). (H) Correlation of mRNA levels of SOX2 with IFNAR1, IRF1, promyelocytic leukemia (PML), and IFITIM1 from the TCGA GBM HG-U133A microarray dataset. (I) Correlation between SOX2 with ISGs from the TCGA GBM HG-U133A microarray dataset. The size and color of the dots indicate the degree of correlation (p < 0.001). Blank cells indicate a non-significant correlation. (J) qPCR of ISGs (IFNAR-1, ISH20, IRF1, IFITM1, TLR3, and OAS2) in GSCs (GSC3565) transduced with either shCONT or SOX2 shRNA (shSOX2.52 or shSOX2.53). Experiments were performed in two biological replicates with three technical repeats. Values represent mean ± SEM. **p < 0.001, ****p < 0.0001 by one-way ANOVA.

Journal: Cell stem cell

Article Title: Zika Virus Targets Glioblastoma Stem Cells through a SOX2-Integrin α v β 5 Axis

doi: 10.1016/j.stem.2019.11.016

Figure Lengend Snippet: (A) Representative immunostaining for ZIKV-E (green), SOX2 (red), and DAPI (blue) of GSCs and forebrain-specific hiPSC-derived NPCs 48 h p.i. with ZIKV. Scale bar, 50 μm. (B) Quantification of the percentage of SOX2+ cells in DAPI+ cells for GSCs and NPCs 48 h p.i. with ZIKV. (C) Representative immunostaining for ZIKV-E (green), SOX2 or AXL (red), and DAPI (blue) of GSCs (GSC3565) without transduction (shRNA) or transduced with control shRNA (shCONT), AXL shRNA (shAXL.2), or SOX2 shRNA (shSOX2.53) for 72 h and then 48 h with ZIKV infection. Scale bars, 100 μm. (D) Quantification of the percentage of ZIKV+ cells in DAPI+ cells in GSCs 1517 and 3565 under conditions for (C), with a range of ZIKV infection. (E) Viral copy number by qRT-PCR of GSCs (GSC3565 or GSC1517) or NPC C4–7 transduced with either shCONT or SOX2 shRNA (shSOX2.52 or shSOX2.53) for 72 h and then either exposed to mock conditions or infected with ZIKV for another 72 h. All comparisons are versus shCONT. (F) Gene set enrichment (GSE) bubble plots showing pathways positively (top, r > 0.4) or negatively (bottom, r < −0.4) correlated with SOX2 expression in the TCGA GBM HG-U133A microarray dataset. Each circle represents an enriched pathway, with the border color indicating the false discovery rate (FDR)-corrected p value. (G) GSE graph showing the top pathway enrichments positively or negatively correlated with SOX2 as described in (F). (H) Correlation of mRNA levels of SOX2 with IFNAR1, IRF1, promyelocytic leukemia (PML), and IFITIM1 from the TCGA GBM HG-U133A microarray dataset. (I) Correlation between SOX2 with ISGs from the TCGA GBM HG-U133A microarray dataset. The size and color of the dots indicate the degree of correlation (p < 0.001). Blank cells indicate a non-significant correlation. (J) qPCR of ISGs (IFNAR-1, ISH20, IRF1, IFITM1, TLR3, and OAS2) in GSCs (GSC3565) transduced with either shCONT or SOX2 shRNA (shSOX2.52 or shSOX2.53). Experiments were performed in two biological replicates with three technical repeats. Values represent mean ± SEM. **p < 0.001, ****p < 0.0001 by one-way ANOVA.

Article Snippet: After 30 minutes, the reaction cocktail was removed, cells were washed once with 1 mL of 3% BSA in PBS before proceeding to DNA staining (DAPI, Vector Laboratories H-1200) and imaging (Zeiss Apotome). . ZIKV preparation ZIKV human isolates H/PAN/2016/BEI-259634 and PRVABC59 (BEI Resources, NR-50210 and NR-50240) from Panama and Puerto Rico, respectively, were acquired from the ATCC and distributed by BEI.

Techniques: Immunostaining, Derivative Assay, Transduction, shRNA, Control, Infection, Quantitative RT-PCR, Expressing, Microarray

(A) Representative images of mock- or ZIKV-infected BCOs stained with neuronal markers (CTIP2 and NeuN), a neural progenitor cell marker (SOX2), and DAPI. Scale bars, 100 μm. (B) Quantification of BCO size p.i. with ZIKV. Significance was assessed by two-tailed Student’s t test, and experiments were performed in two batches with 12 organoids per group per batch. (C) BCO size fold change of ZIKV- and mock-treated groups over a period of 1 month. (D) Quantification of SOX2+ cells in ZIKV- versus mock-infected groups. *p < 0.05 by two-tailed Student’s t test. (E) Quantification of CC3+ cells in ZIKV- versus mock-infected groups. *p < 0.05 by two-tailed Student’s t test. (F) Quantification of SATB2+ cells within MAP2+ cells in ZIKV- versus mock-infected groups. **p < 0.01 by two-tailed Student’s t test. (G) Quantification of GFAP+ cells in ZIKV- versus mock-infected groups. N.S., not significant by two-tailed Student’s t test. (H) Quantification of NeuN+ cells in ZIKV- versus mock-infected groups. N.S., not significant by two-tailed Student’s t test. (I) Quantification of CTIP2+ cells in ZIKV- versus mock-infected groups. N.S., not significant by two-tailed Student’s t test. (J) Bright-field images of engraftment of two patient-derived GSCs (387 and 3565) transduced with GFP into human BCOs over a time course. Scale bars, 1 mm. (K) Engrafted GSCs (GFP+) with normal BCO immunostained for integrin αvβ5 (red), GFP (green), and DAPI (blue). Scale bars, 200 μm. (L) Quantification of integrin αvβ5+ cells in normal BCOs or GSC-BCOs. Values represent mean ± SEM. n = 6. ****p < 0.0001 by two-tailed Student’s t test. (M) Representative images of GFP-labeled GSC-BCOs immunostained for integrin αvβ5 (red), GFP (green), and DAPI (blue). Scale bars, 100 μm. (N) Representative images of GFP-labeled GSC-BCOs immunostained for SOX2 (red), GFP (green), and DAPI (blue). Scale bars, 100 μm. (O) Images of GFP-labeled GSC-GFP BCOs 13 days p.i. with ZIKV. Scale bars, 1 mm. (P) Representative images of residual GSCs (green) and DAPI staining (blue) of GFP-labeled GSC-GFP BCOs cultured under mock conditions or with ZIKV for 2–4 weeks. Scale bars, 200 μm. The percentage of GFP+ cells among DAPI+ cells was quantified. Values represent mean ± SEM. n = 6. ****p < 0.0001 by two-way ANOVA. (Q) Representative immunostaining for integrin αvβ5 (red), GFP (green), ZIKV-E (white), and DAPI (blue) of GFP-labeled GSC-GFP BCOs mock- or ZIKV-infected for 2–4 weeks. Scale bars, 200 μm (left) and 100 μm (center). The percentage of ZIKV-E+ cells among integrin αvβ5 cells was quantified. Values represent mean ± SEM. n = 6. ****p < 0.0001 by two-tailed Student’s t test. (R) Representative images of 387 and 3565 GSC-BCOs with or without ZIKV, respectively, stained with SOX2, ZIKV-E, and DAPI. GFP shows the presence of GSCs (scale bars, 50 μm). ZIKV-E+, GFP+, and ZIKV-E+ cells among GFP+ cells were quantified by counting (two GSCs cell lines, two repeats, n = 12 organoids/group); *p < 0.05 by two-tailed Student’s t test. (S) Schematic of the experiment design. (T) Volcano plot showing differences between GSC-BCO ZIKV versus GSC-BCO mock. 113 genes were differentially expressed (greater than 1.5-fold) between these two groups (*p < 0.05). (U) Network analysis of genes differentially expressed upon ZIKV infection, represented as a bubble plot.

Journal: Cell stem cell

Article Title: Zika Virus Targets Glioblastoma Stem Cells through a SOX2-Integrin α v β 5 Axis

doi: 10.1016/j.stem.2019.11.016

Figure Lengend Snippet: (A) Representative images of mock- or ZIKV-infected BCOs stained with neuronal markers (CTIP2 and NeuN), a neural progenitor cell marker (SOX2), and DAPI. Scale bars, 100 μm. (B) Quantification of BCO size p.i. with ZIKV. Significance was assessed by two-tailed Student’s t test, and experiments were performed in two batches with 12 organoids per group per batch. (C) BCO size fold change of ZIKV- and mock-treated groups over a period of 1 month. (D) Quantification of SOX2+ cells in ZIKV- versus mock-infected groups. *p < 0.05 by two-tailed Student’s t test. (E) Quantification of CC3+ cells in ZIKV- versus mock-infected groups. *p < 0.05 by two-tailed Student’s t test. (F) Quantification of SATB2+ cells within MAP2+ cells in ZIKV- versus mock-infected groups. **p < 0.01 by two-tailed Student’s t test. (G) Quantification of GFAP+ cells in ZIKV- versus mock-infected groups. N.S., not significant by two-tailed Student’s t test. (H) Quantification of NeuN+ cells in ZIKV- versus mock-infected groups. N.S., not significant by two-tailed Student’s t test. (I) Quantification of CTIP2+ cells in ZIKV- versus mock-infected groups. N.S., not significant by two-tailed Student’s t test. (J) Bright-field images of engraftment of two patient-derived GSCs (387 and 3565) transduced with GFP into human BCOs over a time course. Scale bars, 1 mm. (K) Engrafted GSCs (GFP+) with normal BCO immunostained for integrin αvβ5 (red), GFP (green), and DAPI (blue). Scale bars, 200 μm. (L) Quantification of integrin αvβ5+ cells in normal BCOs or GSC-BCOs. Values represent mean ± SEM. n = 6. ****p < 0.0001 by two-tailed Student’s t test. (M) Representative images of GFP-labeled GSC-BCOs immunostained for integrin αvβ5 (red), GFP (green), and DAPI (blue). Scale bars, 100 μm. (N) Representative images of GFP-labeled GSC-BCOs immunostained for SOX2 (red), GFP (green), and DAPI (blue). Scale bars, 100 μm. (O) Images of GFP-labeled GSC-GFP BCOs 13 days p.i. with ZIKV. Scale bars, 1 mm. (P) Representative images of residual GSCs (green) and DAPI staining (blue) of GFP-labeled GSC-GFP BCOs cultured under mock conditions or with ZIKV for 2–4 weeks. Scale bars, 200 μm. The percentage of GFP+ cells among DAPI+ cells was quantified. Values represent mean ± SEM. n = 6. ****p < 0.0001 by two-way ANOVA. (Q) Representative immunostaining for integrin αvβ5 (red), GFP (green), ZIKV-E (white), and DAPI (blue) of GFP-labeled GSC-GFP BCOs mock- or ZIKV-infected for 2–4 weeks. Scale bars, 200 μm (left) and 100 μm (center). The percentage of ZIKV-E+ cells among integrin αvβ5 cells was quantified. Values represent mean ± SEM. n = 6. ****p < 0.0001 by two-tailed Student’s t test. (R) Representative images of 387 and 3565 GSC-BCOs with or without ZIKV, respectively, stained with SOX2, ZIKV-E, and DAPI. GFP shows the presence of GSCs (scale bars, 50 μm). ZIKV-E+, GFP+, and ZIKV-E+ cells among GFP+ cells were quantified by counting (two GSCs cell lines, two repeats, n = 12 organoids/group); *p < 0.05 by two-tailed Student’s t test. (S) Schematic of the experiment design. (T) Volcano plot showing differences between GSC-BCO ZIKV versus GSC-BCO mock. 113 genes were differentially expressed (greater than 1.5-fold) between these two groups (*p < 0.05). (U) Network analysis of genes differentially expressed upon ZIKV infection, represented as a bubble plot.

Article Snippet: After 30 minutes, the reaction cocktail was removed, cells were washed once with 1 mL of 3% BSA in PBS before proceeding to DNA staining (DAPI, Vector Laboratories H-1200) and imaging (Zeiss Apotome). . ZIKV preparation ZIKV human isolates H/PAN/2016/BEI-259634 and PRVABC59 (BEI Resources, NR-50210 and NR-50240) from Panama and Puerto Rico, respectively, were acquired from the ATCC and distributed by BEI.

Techniques: Infection, Staining, Marker, Two Tailed Test, Derivative Assay, Transduction, Labeling, Cell Culture, Immunostaining

(A) Immunostaining of the subventricular zone (SVZ) of mice 72 h following ZIKV infection ZIKV-E (green), SOX2 (red, top panels), and integrin αvβ5 (red, bottom panels). Scale bars, 50 μm. (B) Higher magnification of images from (A), demonstrating ZIKV infection of SOX2+ (top panels) and integrin αvβ5+ cells. Scale bars, 10 μm. (C) Survival of ZIKV-infected NSG mice from (A) was plotted by the Kaplan-Meier method. (D) ZIKV-infected brains from the mice in (A) were collected upon death, and histology was assessed by H&E staining. Scale bars, 20 μm. (E) Survival of NSG mice following implantation of GSCs treated with isotype control, P1F6 antibody, ZIKV, combined P1F6 and ZIKV, combined CRISPR knockout (KO) of integrin β5 (sgRNA1 sgRNA2) with ZIKV inoculation, analyzed by log rank test; p < 0.01. (F) H&E staining of tumor-bearing brains from (E). Scale bars, 50 μm. (G) Intraoperative brain slices from GBM patients were pre-incubated with an IgG control antibody or an integrin-blocking antibody under mock conditions or upon ZIKV infection (10e3 FFU). Slices then underwent immunofluorescence staining for ZIKV-E (green), integrin αvβ5 (red), and DAPI (blue). Scale bars, 10 μm. (H) Intraoperative brain slices from GBM patients were pre-incubated with an IgG control antibody or an integrin-blocking antibody under mock conditions or upon ZIKV infection. Slices then underwent a viral RNA copy assay by qRT-PCR. Experiments were performed in two biological replicates with three technical repeats. Values represent mean ± SEM. ****p < 0.0001 by one-way ANOVA.

Journal: Cell stem cell

Article Title: Zika Virus Targets Glioblastoma Stem Cells through a SOX2-Integrin α v β 5 Axis

doi: 10.1016/j.stem.2019.11.016

Figure Lengend Snippet: (A) Immunostaining of the subventricular zone (SVZ) of mice 72 h following ZIKV infection ZIKV-E (green), SOX2 (red, top panels), and integrin αvβ5 (red, bottom panels). Scale bars, 50 μm. (B) Higher magnification of images from (A), demonstrating ZIKV infection of SOX2+ (top panels) and integrin αvβ5+ cells. Scale bars, 10 μm. (C) Survival of ZIKV-infected NSG mice from (A) was plotted by the Kaplan-Meier method. (D) ZIKV-infected brains from the mice in (A) were collected upon death, and histology was assessed by H&E staining. Scale bars, 20 μm. (E) Survival of NSG mice following implantation of GSCs treated with isotype control, P1F6 antibody, ZIKV, combined P1F6 and ZIKV, combined CRISPR knockout (KO) of integrin β5 (sgRNA1 sgRNA2) with ZIKV inoculation, analyzed by log rank test; p < 0.01. (F) H&E staining of tumor-bearing brains from (E). Scale bars, 50 μm. (G) Intraoperative brain slices from GBM patients were pre-incubated with an IgG control antibody or an integrin-blocking antibody under mock conditions or upon ZIKV infection (10e3 FFU). Slices then underwent immunofluorescence staining for ZIKV-E (green), integrin αvβ5 (red), and DAPI (blue). Scale bars, 10 μm. (H) Intraoperative brain slices from GBM patients were pre-incubated with an IgG control antibody or an integrin-blocking antibody under mock conditions or upon ZIKV infection. Slices then underwent a viral RNA copy assay by qRT-PCR. Experiments were performed in two biological replicates with three technical repeats. Values represent mean ± SEM. ****p < 0.0001 by one-way ANOVA.

Article Snippet: After 30 minutes, the reaction cocktail was removed, cells were washed once with 1 mL of 3% BSA in PBS before proceeding to DNA staining (DAPI, Vector Laboratories H-1200) and imaging (Zeiss Apotome). . ZIKV preparation ZIKV human isolates H/PAN/2016/BEI-259634 and PRVABC59 (BEI Resources, NR-50210 and NR-50240) from Panama and Puerto Rico, respectively, were acquired from the ATCC and distributed by BEI.

Techniques: Immunostaining, Infection, Staining, Control, CRISPR, Knock-Out, Incubation, Blocking Assay, Immunofluorescence, Quantitative RT-PCR

( a ) The mRNA levels of SYT11 and GAPDH in Control and ATP13A2-knockdown HeLa cells were measured by real-time PCR. The experiment (with triplicates) was repeated an additional two times and all were similarly significant. ( b ) Primary cultures of mouse neurons transduced with Control or ATP13A2 lentiviral shRNAs for 5 days were used to measure the mRNA levels of SYT11 and GAPDH by real-time PCR. The graph shows the mean±s.d. of four independent experiments. * P <0.05 (two-tailed paired Student's t -test). ( c ) Primary cultures of mouse neurons transduced with Control or ATP13A2 lentiviral shRNAs (#A and #B) were lysed and blotted against SYT11 and actin. A representative experiment with triplicates is shown. ( d ) The mRNA levels of SYT11 and GAPDH in HeLa cells transfected with empty pcDNA3.1 or ATP13A2 WT were measured by real-time PCR. A representative experiment (with triplicates) of three similarly significant independent experiments is shown. ( e ) HeLa cells transfected with empty pcDNA3.1, ATP13A2 WT, ATP13A2 delC or ATP13A2 i16 mutants were used to measure the mRNA levels of SYT11 and GAPDH by real-time PCR. The experiment was repeated and both experiments were similarly significant. ( f ) HeLa cells transfected with V5-tagged ATP13A2 WT, ATP13A2 delC or ATP13A2 i16 constructs were immunostained against V5 and LAMP1 and imaged using confocal microscopy (scale bar 10 μM). Unless otherwise stated, all the graphs represent mean±s.d. and statistical significance was determined using two-tailed unpaired Student's t -test. ** P <0.01; *** P <0.001; NS, not significant.

Journal: Nature Communications

Article Title: The Parkinson's disease-associated genes ATP13A2 and SYT11 regulate autophagy via a common pathway

doi: 10.1038/ncomms11803

Figure Lengend Snippet: ( a ) The mRNA levels of SYT11 and GAPDH in Control and ATP13A2-knockdown HeLa cells were measured by real-time PCR. The experiment (with triplicates) was repeated an additional two times and all were similarly significant. ( b ) Primary cultures of mouse neurons transduced with Control or ATP13A2 lentiviral shRNAs for 5 days were used to measure the mRNA levels of SYT11 and GAPDH by real-time PCR. The graph shows the mean±s.d. of four independent experiments. * P <0.05 (two-tailed paired Student's t -test). ( c ) Primary cultures of mouse neurons transduced with Control or ATP13A2 lentiviral shRNAs (#A and #B) were lysed and blotted against SYT11 and actin. A representative experiment with triplicates is shown. ( d ) The mRNA levels of SYT11 and GAPDH in HeLa cells transfected with empty pcDNA3.1 or ATP13A2 WT were measured by real-time PCR. A representative experiment (with triplicates) of three similarly significant independent experiments is shown. ( e ) HeLa cells transfected with empty pcDNA3.1, ATP13A2 WT, ATP13A2 delC or ATP13A2 i16 mutants were used to measure the mRNA levels of SYT11 and GAPDH by real-time PCR. The experiment was repeated and both experiments were similarly significant. ( f ) HeLa cells transfected with V5-tagged ATP13A2 WT, ATP13A2 delC or ATP13A2 i16 constructs were immunostained against V5 and LAMP1 and imaged using confocal microscopy (scale bar 10 μM). Unless otherwise stated, all the graphs represent mean±s.d. and statistical significance was determined using two-tailed unpaired Student's t -test. ** P <0.01; *** P <0.001; NS, not significant.

Article Snippet: Mutagenesis of the human WT SYT11 promoter-GLuc-SEAP vector (GeneCopoeia) (CLEAR-Site 2 in SYT11 promoter; CTCAAGTGAT>CAAAAGAAAT) was generated with QuikChange Multi Site-Directed Mutagenesis Kit (Agilent Stratagene), according to manufacturer's instructions, using the set of primers listed in .

Techniques: Control, Knockdown, Real-time Polymerase Chain Reaction, Transduction, Two Tailed Test, Transfection, Construct, Confocal Microscopy

( a , b ) Control and ATP13A2-knockdown HeLa cells, treated with 300 nM torin-1 (or DMSO) for 4 h ( a ), and HeLa cells transfected with empty vector or ATP13A2 WT ( b ) were used for cytosolic and nuclear fractionation. The different fractions were blotted for TFEB, Lamin-B and GAPDH. ( c ) ATP13A2-knockdown cells or ATP13A2-overexpressing cells (and respective controls) growing in coverslips were fixed with cold methanol and immunostained against TFEB. TFEB translocation to the nucleus was assessed by DAPI co-localization. Cells were imaged by confocal microscopy (scale bar, 15 μM). ( d , e ) Primary cultures of mouse neurons were transduced with Control or ATP13A2 lentiviral shRNAs for 5 days and subsequently used for cytosolic/nuclear fractionation where the different fractions were blotted for TFEB, Lamin-B and GAPDH ( d ). Cells seeded in coverslips were also used for TFEB immunostaining ( e ) (scale bar, 10 μM). ( f , g ) Control and TFEB-knockdown (transfected with pool or deconvoluted oligos) HeLa cells, transfected with empty vector or ATP13A2 WT for the last 24 h ( f ), or Control and ATP13A2-knockdown HeLa cells transfected with empty pCMV, TFEB WT or TFEB S142A for the last 24 h ( g ), were used to measure the mRNA levels of SYT11 and GAPDH by real-time PCR. Representative experiments of two independent experiments with triplicates are shown. ( h ) Control and ATP13A2 WT-overexpressing HeLa cells were used to perform chromatin immunoprecipiation (ChIP). Two different antibodies were tested for TFEB-immunoprecipitation and two pairs of primers designed against the putative TFEB-binding site 2 on the promoter of SYT11 were used for qPCR. The TFEB binding to SYT11 promoter is represented. The experiment (with triplicates) was repeated and both experiments were similarly significant. ( i ) HeLa cells were transfected with empty pcDNA3.1 or ATP13A2 WT simultaneously with WT or CLEAR-site 2 mutant SYT11 promoter-GLuc/SEAP. Medium was collected 48 h later. Secreted Gaussia luciferase and SEAP were measured. A representative experiment (with triplicates) of two independent experiments is shown. All the graphs represent mean±s.d. and statistical significance was determined using two-tailed unpaired Student's t -test. * P <0.05, ** P <0.01; # P <0.05, ## P <0.01. CF, cytosolic fraction; NF, nuclear fraction.

Journal: Nature Communications

Article Title: The Parkinson's disease-associated genes ATP13A2 and SYT11 regulate autophagy via a common pathway

doi: 10.1038/ncomms11803

Figure Lengend Snippet: ( a , b ) Control and ATP13A2-knockdown HeLa cells, treated with 300 nM torin-1 (or DMSO) for 4 h ( a ), and HeLa cells transfected with empty vector or ATP13A2 WT ( b ) were used for cytosolic and nuclear fractionation. The different fractions were blotted for TFEB, Lamin-B and GAPDH. ( c ) ATP13A2-knockdown cells or ATP13A2-overexpressing cells (and respective controls) growing in coverslips were fixed with cold methanol and immunostained against TFEB. TFEB translocation to the nucleus was assessed by DAPI co-localization. Cells were imaged by confocal microscopy (scale bar, 15 μM). ( d , e ) Primary cultures of mouse neurons were transduced with Control or ATP13A2 lentiviral shRNAs for 5 days and subsequently used for cytosolic/nuclear fractionation where the different fractions were blotted for TFEB, Lamin-B and GAPDH ( d ). Cells seeded in coverslips were also used for TFEB immunostaining ( e ) (scale bar, 10 μM). ( f , g ) Control and TFEB-knockdown (transfected with pool or deconvoluted oligos) HeLa cells, transfected with empty vector or ATP13A2 WT for the last 24 h ( f ), or Control and ATP13A2-knockdown HeLa cells transfected with empty pCMV, TFEB WT or TFEB S142A for the last 24 h ( g ), were used to measure the mRNA levels of SYT11 and GAPDH by real-time PCR. Representative experiments of two independent experiments with triplicates are shown. ( h ) Control and ATP13A2 WT-overexpressing HeLa cells were used to perform chromatin immunoprecipiation (ChIP). Two different antibodies were tested for TFEB-immunoprecipitation and two pairs of primers designed against the putative TFEB-binding site 2 on the promoter of SYT11 were used for qPCR. The TFEB binding to SYT11 promoter is represented. The experiment (with triplicates) was repeated and both experiments were similarly significant. ( i ) HeLa cells were transfected with empty pcDNA3.1 or ATP13A2 WT simultaneously with WT or CLEAR-site 2 mutant SYT11 promoter-GLuc/SEAP. Medium was collected 48 h later. Secreted Gaussia luciferase and SEAP were measured. A representative experiment (with triplicates) of two independent experiments is shown. All the graphs represent mean±s.d. and statistical significance was determined using two-tailed unpaired Student's t -test. * P <0.05, ** P <0.01; # P <0.05, ## P <0.01. CF, cytosolic fraction; NF, nuclear fraction.

Article Snippet: Mutagenesis of the human WT SYT11 promoter-GLuc-SEAP vector (GeneCopoeia) (CLEAR-Site 2 in SYT11 promoter; CTCAAGTGAT>CAAAAGAAAT) was generated with QuikChange Multi Site-Directed Mutagenesis Kit (Agilent Stratagene), according to manufacturer's instructions, using the set of primers listed in .

Techniques: Control, Knockdown, Transfection, Plasmid Preparation, Fractionation, Translocation Assay, Confocal Microscopy, Transduction, Immunostaining, Real-time Polymerase Chain Reaction, Immunoprecipitation, Binding Assay, Mutagenesis, Luciferase, Two Tailed Test

( a ) Control and ATP13A2-knockdown HeLa cells growing in coverslips were fixed and immunostained against LAMP1 and phospho-mTOR. Cells were imaged by confocal microscopy (scale bar, 15 μM). Pearson's co-localization coefficient and fraction of phospho-mTOR-positive lysosomes were determined using ImageJ. The plotted data are means±s.d. n =20 cells. * P <0.05; ## P <0.01 (two-tailed unpaired Student's t -test). The experiment was repeated an additional two times. ( b ) ATP13A2-knockdown and ATP13A2-overexpressing HeLa cells (for 96 and 24 h, respectively) were lysed and blotted for phospho-p70S6K, total-p70S6K and actin. ( c ) Primary cultures of mouse neurons were transduced with Control or ATP13A2 lentiviral shRNAs for 5 days and used for western blotting against phospho-p70S6K, total-p70S6K and actin. ( d ) HeLa cells transfected with empty vector, ATP13A2 WT, ATP13A2 delC mutant or ATP13A2 i16 mutant for 24 h were lysed and blotted against phospho-p70S6K, total-p70S6K and actin. ( e ) Control and ATP13A2-knockdown HeLa cells were treated with 100 nM rapamycin for 20 h. The mRNA levels of SYT11 and GAPDH were measured by real-time PCR. A representative experiment (with triplicates) of two independent experiments is shown. The graph represents mean±s.d. ** P <0.01; # P <0.05 (two-tailed unpaired Student's t -test).

Journal: Nature Communications

Article Title: The Parkinson's disease-associated genes ATP13A2 and SYT11 regulate autophagy via a common pathway

doi: 10.1038/ncomms11803

Figure Lengend Snippet: ( a ) Control and ATP13A2-knockdown HeLa cells growing in coverslips were fixed and immunostained against LAMP1 and phospho-mTOR. Cells were imaged by confocal microscopy (scale bar, 15 μM). Pearson's co-localization coefficient and fraction of phospho-mTOR-positive lysosomes were determined using ImageJ. The plotted data are means±s.d. n =20 cells. * P <0.05; ## P <0.01 (two-tailed unpaired Student's t -test). The experiment was repeated an additional two times. ( b ) ATP13A2-knockdown and ATP13A2-overexpressing HeLa cells (for 96 and 24 h, respectively) were lysed and blotted for phospho-p70S6K, total-p70S6K and actin. ( c ) Primary cultures of mouse neurons were transduced with Control or ATP13A2 lentiviral shRNAs for 5 days and used for western blotting against phospho-p70S6K, total-p70S6K and actin. ( d ) HeLa cells transfected with empty vector, ATP13A2 WT, ATP13A2 delC mutant or ATP13A2 i16 mutant for 24 h were lysed and blotted against phospho-p70S6K, total-p70S6K and actin. ( e ) Control and ATP13A2-knockdown HeLa cells were treated with 100 nM rapamycin for 20 h. The mRNA levels of SYT11 and GAPDH were measured by real-time PCR. A representative experiment (with triplicates) of two independent experiments is shown. The graph represents mean±s.d. ** P <0.01; # P <0.05 (two-tailed unpaired Student's t -test).

Article Snippet: Mutagenesis of the human WT SYT11 promoter-GLuc-SEAP vector (GeneCopoeia) (CLEAR-Site 2 in SYT11 promoter; CTCAAGTGAT>CAAAAGAAAT) was generated with QuikChange Multi Site-Directed Mutagenesis Kit (Agilent Stratagene), according to manufacturer's instructions, using the set of primers listed in .

Techniques: Control, Knockdown, Confocal Microscopy, Two Tailed Test, Transduction, Western Blot, Transfection, Plasmid Preparation, Mutagenesis, Real-time Polymerase Chain Reaction

( a ) Control and SYT11-knockdown HeLa cells were transfected with GFP-LC3 vector. Cells in coverslips were imaged by fluorescence microscopy (scale bar, 10 μM) and GFP-LC3 dots were quantified using ImageJ. The quantification shows the mean±s.d. of a minimum of 200 cells per replicate (in a total of three replicates). * P <0.05 (two-tailed unpaired Student's t -test). ( b , c ) Control and SYT11-knockdown (transfected with pool or deconvoluted oligos) HeLa cells were treated with 200 nM bafilomycin A1 (BAF A1) for the last 12 h in full medium ( b ) or with 400 nM BAF A1 for the last 4 h in HBSS medium ( c ). Cells were lysed and blotted for LC3 and actin. ( d , e ) Control and SYT11-knockdown SK-N-SH cells ( d ) or primary cultures of mouse neurons transduced with Control or SYT11 lentiviral shRNAs ( e ) were treated with 200 nM bafilomycin A1 (BAF A1) for the last 12 h. Lysates were blotted for LC3 and actin. ( f ) GFP-P62 HEK293 Flp-In T-REx cells were transfected with two rounds of Control or SYT11 siRNA. After the second round of transfection, GFP-P62 expression was induced by tetracycline (1 μg ml −1 ) for 24 h. Cells were then rinsed twice with PBS and incubated with normal cell culture medium (to stop transgene expression) for 18 h. Lysates were blotted for GFP and actin. The graph shows mean±s.d. of five independent experiments. * P <0.05 (two-tailed paired Student's t -test). ( g , h ) Control and SYT11-knockdown HeLa cells stably expressing tandem fluorescent-tagged LC3 (mRFP-EGFP-LC3) were fixed with 2% paraformaldehyde for 4 min and imaged by confocal microscopy (scale bar, 15 μM) ( g ) or analysed on an automated ArrayScan system ( h ). Means±s.e.m. of number of autophagosomes (AP) and autolysosomes (AL) per cell and area of green and red vesicles are shown in the graphs. BAF A1-treated cells (400 nM for 4 h) were used as a control. Approximately 2,000 cells were analysed per condition in each Cellomics experiment and the experiment was repeated three additional times. * P <0.05; *** P <0.001 (two-tailed paired Student's t -test).

Journal: Nature Communications

Article Title: The Parkinson's disease-associated genes ATP13A2 and SYT11 regulate autophagy via a common pathway

doi: 10.1038/ncomms11803

Figure Lengend Snippet: ( a ) Control and SYT11-knockdown HeLa cells were transfected with GFP-LC3 vector. Cells in coverslips were imaged by fluorescence microscopy (scale bar, 10 μM) and GFP-LC3 dots were quantified using ImageJ. The quantification shows the mean±s.d. of a minimum of 200 cells per replicate (in a total of three replicates). * P <0.05 (two-tailed unpaired Student's t -test). ( b , c ) Control and SYT11-knockdown (transfected with pool or deconvoluted oligos) HeLa cells were treated with 200 nM bafilomycin A1 (BAF A1) for the last 12 h in full medium ( b ) or with 400 nM BAF A1 for the last 4 h in HBSS medium ( c ). Cells were lysed and blotted for LC3 and actin. ( d , e ) Control and SYT11-knockdown SK-N-SH cells ( d ) or primary cultures of mouse neurons transduced with Control or SYT11 lentiviral shRNAs ( e ) were treated with 200 nM bafilomycin A1 (BAF A1) for the last 12 h. Lysates were blotted for LC3 and actin. ( f ) GFP-P62 HEK293 Flp-In T-REx cells were transfected with two rounds of Control or SYT11 siRNA. After the second round of transfection, GFP-P62 expression was induced by tetracycline (1 μg ml −1 ) for 24 h. Cells were then rinsed twice with PBS and incubated with normal cell culture medium (to stop transgene expression) for 18 h. Lysates were blotted for GFP and actin. The graph shows mean±s.d. of five independent experiments. * P <0.05 (two-tailed paired Student's t -test). ( g , h ) Control and SYT11-knockdown HeLa cells stably expressing tandem fluorescent-tagged LC3 (mRFP-EGFP-LC3) were fixed with 2% paraformaldehyde for 4 min and imaged by confocal microscopy (scale bar, 15 μM) ( g ) or analysed on an automated ArrayScan system ( h ). Means±s.e.m. of number of autophagosomes (AP) and autolysosomes (AL) per cell and area of green and red vesicles are shown in the graphs. BAF A1-treated cells (400 nM for 4 h) were used as a control. Approximately 2,000 cells were analysed per condition in each Cellomics experiment and the experiment was repeated three additional times. * P <0.05; *** P <0.001 (two-tailed paired Student's t -test).

Article Snippet: Mutagenesis of the human WT SYT11 promoter-GLuc-SEAP vector (GeneCopoeia) (CLEAR-Site 2 in SYT11 promoter; CTCAAGTGAT>CAAAAGAAAT) was generated with QuikChange Multi Site-Directed Mutagenesis Kit (Agilent Stratagene), according to manufacturer's instructions, using the set of primers listed in .

Techniques: Control, Knockdown, Transfection, Plasmid Preparation, Fluorescence, Microscopy, Two Tailed Test, Transduction, Expressing, Incubation, Cell Culture, Stable Transfection, Confocal Microscopy

( a , b ) Control and SYT11-knockdown HeLa cells growing in coverslips were immunostained for LAMP1 and LC3 ( a ) or only LAMP1 ( b ) and imaged by confocal microscopy (scale bar, 15 μM ( a ) or 10 μM ( b )). Pearson's co-localization coefficient and the fraction of LAMP1-positive LC3 vesicles were determined using ImageJ. The plotted data are means±s.d. of at least 20 cells ( a ). The experiments were repeated an additional two times. ( c ) Control and SYT11-knockdown HeLa cells were loaded with LysoSensor yellow/blue and analysed by live imaging (scale bar, 5 μM). The graph shows the mean±s.e.m. of the yellow/blue intensity ratio of images obtained from 10 fields. A representative experiment of two independent experiments is shown. ( d ) Control and SYT11-knockdown HeLa cells were used to measure cathepsin-L activity in vitro by incubating cell lysates with 200 μM Ac-FR-AFC for 2 h at 37 °C. The graph represents fluorescence means±s.d. of three independent experiments with triplicates each condition. *** P <0.001 (two-tailed paired Student's t -test). ( e ) Lysates of control and SYT11-knockdown HeLa cells were blotted against Cathepsin-L and actin. The Cathepsin-L antibody detects the pro-form, the intermediate and the mature/processed forms of the protein. ( f , g ) Control and ATP13A2-knockdown HeLa cells ( f ) or primary cultures of mouse neurons transduced with Control or ATP13A2 lentiviral shRNAs ( g ) were treated with 200 nM BAF A1 for the last 12 h. Cells were lysed and blotted against LC3 and actin. ( h ) Fixed control and ATP13A2-knockdown HeLa cells were immunostained for LAMP1 and imaged by confocal microscopy (scale bar, 15 μM). ( i ) Control and ATP13A2-knockdown HeLa cells were loaded with LysoSensor yellow/blue and analysed by live imaging (scale bar, 5 μM). The graph shows the mean±s.e.m. of the yellow/blue intensity ratio of images obtained from 10 fields. A representative experiment of two independent experiments is shown. Unless otherwise stated, all the graphs represent mean±s.d. and statistical significance was determined using two-tailed unpaired Student's t -test. * P <0.05; ** P <0.01; *** P <0.001.

Journal: Nature Communications

Article Title: The Parkinson's disease-associated genes ATP13A2 and SYT11 regulate autophagy via a common pathway

doi: 10.1038/ncomms11803

Figure Lengend Snippet: ( a , b ) Control and SYT11-knockdown HeLa cells growing in coverslips were immunostained for LAMP1 and LC3 ( a ) or only LAMP1 ( b ) and imaged by confocal microscopy (scale bar, 15 μM ( a ) or 10 μM ( b )). Pearson's co-localization coefficient and the fraction of LAMP1-positive LC3 vesicles were determined using ImageJ. The plotted data are means±s.d. of at least 20 cells ( a ). The experiments were repeated an additional two times. ( c ) Control and SYT11-knockdown HeLa cells were loaded with LysoSensor yellow/blue and analysed by live imaging (scale bar, 5 μM). The graph shows the mean±s.e.m. of the yellow/blue intensity ratio of images obtained from 10 fields. A representative experiment of two independent experiments is shown. ( d ) Control and SYT11-knockdown HeLa cells were used to measure cathepsin-L activity in vitro by incubating cell lysates with 200 μM Ac-FR-AFC for 2 h at 37 °C. The graph represents fluorescence means±s.d. of three independent experiments with triplicates each condition. *** P <0.001 (two-tailed paired Student's t -test). ( e ) Lysates of control and SYT11-knockdown HeLa cells were blotted against Cathepsin-L and actin. The Cathepsin-L antibody detects the pro-form, the intermediate and the mature/processed forms of the protein. ( f , g ) Control and ATP13A2-knockdown HeLa cells ( f ) or primary cultures of mouse neurons transduced with Control or ATP13A2 lentiviral shRNAs ( g ) were treated with 200 nM BAF A1 for the last 12 h. Cells were lysed and blotted against LC3 and actin. ( h ) Fixed control and ATP13A2-knockdown HeLa cells were immunostained for LAMP1 and imaged by confocal microscopy (scale bar, 15 μM). ( i ) Control and ATP13A2-knockdown HeLa cells were loaded with LysoSensor yellow/blue and analysed by live imaging (scale bar, 5 μM). The graph shows the mean±s.e.m. of the yellow/blue intensity ratio of images obtained from 10 fields. A representative experiment of two independent experiments is shown. Unless otherwise stated, all the graphs represent mean±s.d. and statistical significance was determined using two-tailed unpaired Student's t -test. * P <0.05; ** P <0.01; *** P <0.001.

Article Snippet: Mutagenesis of the human WT SYT11 promoter-GLuc-SEAP vector (GeneCopoeia) (CLEAR-Site 2 in SYT11 promoter; CTCAAGTGAT>CAAAAGAAAT) was generated with QuikChange Multi Site-Directed Mutagenesis Kit (Agilent Stratagene), according to manufacturer's instructions, using the set of primers listed in .

Techniques: Control, Knockdown, Confocal Microscopy, Imaging, Activity Assay, In Vitro, Fluorescence, Two Tailed Test, Transduction

( a ) HeLa cells were transfected with Control, SYT11 siRNA, ATP13A2 siRNA or SYT11 siRNA in combination with ATP13A2 siRNA. Cells were treated with 200 nM bafilomycin A1 (BAF A1) for the last 12 h and lysates were blotted for LC3 and actin. ( b , c ) Control and ATP13A2-knockdown HeLa cells were transfected with empty pEGFP or pEGFP-SYT11 in the last 30 h of the experiment ( b , c ). Cells were treated with 200 nM BAF A1 for the last 12 h ( c ). Cell lysates were blotted for LC3, GFP (SYT11) and actin. ( d , e ) HeLa WT ( d ) or ATG16L CRISPR ( e ) cells were transfected with Control or ATP13A2 siRNA for 5 days. In the last 48 h, cells were transfected with empty vector and pEGFP-SYT11 for 5 h, followed by transfection with empty pEGFP+GFP-α-synuclein A53T. Cells were lysed and blotted for GFP. Representative experiments with triplicates of three independent experiments are shown. Levels of α-synuclein A53T are expressed as a ratio to GFP. ( f ) Lysates obtained from ATG16L-knockout cells produced by CRISPR/Cas9 editing and control HeLa cells were blotted against ATG16L, LC3 and actin in order to validate the knockout efficiency and autophagy competence. ( g ) Control and ATP13A2-knockdown HeLa cells were transfected with empty pcDNA3.1- myc /His or pcDNA3.1-SYT11- myc /His in the last 30 h of the experiment. Cells were subsequently loaded with LysoSensor Yellow/Blue and analysed by live imaging (scale bar, 10 μM). The graph shows the mean±s.e.m. of the yellow/blue intensity ratio of images obtained from 10 fields. ( h ) HeLa cells were transfected with Control or ATP13A2 siRNA for 5 days. In the last 48 h, cells were transfected with empty pCMV, pCMV TFEB WT or TFEB S142A for 5 h, followed by transfection with empty pEGFP+GFP-α-synuclein A53T. Cells were lysed and blotted for GFP. A representative experiment with triplicates of two independent experiments is shown. Levels of α-synuclein A53T are expressed as a ratio to GFP. All the graphs represent mean±s.d. and statistical significance was determined using two-tailed unpaired Student's t -test. * P <0.05; ** P <0.01; *** P <0.001; # P <0.05; ### P <0.001; NS, not significant.

Journal: Nature Communications

Article Title: The Parkinson's disease-associated genes ATP13A2 and SYT11 regulate autophagy via a common pathway

doi: 10.1038/ncomms11803

Figure Lengend Snippet: ( a ) HeLa cells were transfected with Control, SYT11 siRNA, ATP13A2 siRNA or SYT11 siRNA in combination with ATP13A2 siRNA. Cells were treated with 200 nM bafilomycin A1 (BAF A1) for the last 12 h and lysates were blotted for LC3 and actin. ( b , c ) Control and ATP13A2-knockdown HeLa cells were transfected with empty pEGFP or pEGFP-SYT11 in the last 30 h of the experiment ( b , c ). Cells were treated with 200 nM BAF A1 for the last 12 h ( c ). Cell lysates were blotted for LC3, GFP (SYT11) and actin. ( d , e ) HeLa WT ( d ) or ATG16L CRISPR ( e ) cells were transfected with Control or ATP13A2 siRNA for 5 days. In the last 48 h, cells were transfected with empty vector and pEGFP-SYT11 for 5 h, followed by transfection with empty pEGFP+GFP-α-synuclein A53T. Cells were lysed and blotted for GFP. Representative experiments with triplicates of three independent experiments are shown. Levels of α-synuclein A53T are expressed as a ratio to GFP. ( f ) Lysates obtained from ATG16L-knockout cells produced by CRISPR/Cas9 editing and control HeLa cells were blotted against ATG16L, LC3 and actin in order to validate the knockout efficiency and autophagy competence. ( g ) Control and ATP13A2-knockdown HeLa cells were transfected with empty pcDNA3.1- myc /His or pcDNA3.1-SYT11- myc /His in the last 30 h of the experiment. Cells were subsequently loaded with LysoSensor Yellow/Blue and analysed by live imaging (scale bar, 10 μM). The graph shows the mean±s.e.m. of the yellow/blue intensity ratio of images obtained from 10 fields. ( h ) HeLa cells were transfected with Control or ATP13A2 siRNA for 5 days. In the last 48 h, cells were transfected with empty pCMV, pCMV TFEB WT or TFEB S142A for 5 h, followed by transfection with empty pEGFP+GFP-α-synuclein A53T. Cells were lysed and blotted for GFP. A representative experiment with triplicates of two independent experiments is shown. Levels of α-synuclein A53T are expressed as a ratio to GFP. All the graphs represent mean±s.d. and statistical significance was determined using two-tailed unpaired Student's t -test. * P <0.05; ** P <0.01; *** P <0.001; # P <0.05; ### P <0.001; NS, not significant.

Article Snippet: Mutagenesis of the human WT SYT11 promoter-GLuc-SEAP vector (GeneCopoeia) (CLEAR-Site 2 in SYT11 promoter; CTCAAGTGAT>CAAAAGAAAT) was generated with QuikChange Multi Site-Directed Mutagenesis Kit (Agilent Stratagene), according to manufacturer's instructions, using the set of primers listed in .

Techniques: Transfection, Control, Knockdown, CRISPR, Plasmid Preparation, Knock-Out, Produced, Imaging, Two Tailed Test

( a ) Control and ATP13A2-knockdown HeLa cells were transfected with pEGFP-SYT11 for the last 24 h. Cell lysates were blotted against GFP and actin. ( b ) HeLa cells were transfected with empty vector or ATP13A2 WT simultaneously with pEGFP-SYT11 for 24 h. Cell lysates were blotted against GFP and actin. ( c ) Control and ATP13A2-knockdown HeLa cells were transfected with GFP-SYT11 for the last 24 h. In the last 4 h of the experiment, cells were treated with 50 μg ml −1 cycloheximide for the indicated time points. Cell lysates were blotted against GFP and actin. Densitometric quantification of the bands was performed and the normalized data (GFP-SYT11 levels to actin levels) of three independent experiments is plotted in the graph. ( d ) HeLa cells were transfected with empty vector or ATP13A2 WT simultaneously with HA-Ubiquitin and GFP-SYT11 for 24 h. Cell lysates were subsequently used for GFP-SYT11 immunoprecipitation and western blotting against GFP, ubiquitin and actin. ( e ) Control and ATP13A2-knockdown HeLa cells were transfected with HA-Ubiquitin and GFP-SYT11 for the last 24 h. Lysates were used for GFP-SYT11 immunoprecipitation and subsequent western blotting against ubiquitin (P4D1 antibody), K48-linkage-specific polyubiquitin conjugates, GFP and actin. ( f ) Control and ATP13A2-knockdown HeLa cells were transfected with GFP-SYT11 for the last 24 h. In the last 5 h, cells were pre-incubated with 10 μM MG132 (or DMSO) and further treated with 50 μg ml −1 cycloheximide for the indicated time points. Cell lysates were blotted against GFP and actin. Densitometric quantification of the bands was performed and the normalized data (GFP-SYT11 levels to actin levels) of three independent experiments is plotted in the graph. All the graphs represent mean±s.d. and statistical significance was determined using two-tailed paired Student's t -test. * P <0.05; ** P <0.01.

Journal: Nature Communications

Article Title: The Parkinson's disease-associated genes ATP13A2 and SYT11 regulate autophagy via a common pathway

doi: 10.1038/ncomms11803

Figure Lengend Snippet: ( a ) Control and ATP13A2-knockdown HeLa cells were transfected with pEGFP-SYT11 for the last 24 h. Cell lysates were blotted against GFP and actin. ( b ) HeLa cells were transfected with empty vector or ATP13A2 WT simultaneously with pEGFP-SYT11 for 24 h. Cell lysates were blotted against GFP and actin. ( c ) Control and ATP13A2-knockdown HeLa cells were transfected with GFP-SYT11 for the last 24 h. In the last 4 h of the experiment, cells were treated with 50 μg ml −1 cycloheximide for the indicated time points. Cell lysates were blotted against GFP and actin. Densitometric quantification of the bands was performed and the normalized data (GFP-SYT11 levels to actin levels) of three independent experiments is plotted in the graph. ( d ) HeLa cells were transfected with empty vector or ATP13A2 WT simultaneously with HA-Ubiquitin and GFP-SYT11 for 24 h. Cell lysates were subsequently used for GFP-SYT11 immunoprecipitation and western blotting against GFP, ubiquitin and actin. ( e ) Control and ATP13A2-knockdown HeLa cells were transfected with HA-Ubiquitin and GFP-SYT11 for the last 24 h. Lysates were used for GFP-SYT11 immunoprecipitation and subsequent western blotting against ubiquitin (P4D1 antibody), K48-linkage-specific polyubiquitin conjugates, GFP and actin. ( f ) Control and ATP13A2-knockdown HeLa cells were transfected with GFP-SYT11 for the last 24 h. In the last 5 h, cells were pre-incubated with 10 μM MG132 (or DMSO) and further treated with 50 μg ml −1 cycloheximide for the indicated time points. Cell lysates were blotted against GFP and actin. Densitometric quantification of the bands was performed and the normalized data (GFP-SYT11 levels to actin levels) of three independent experiments is plotted in the graph. All the graphs represent mean±s.d. and statistical significance was determined using two-tailed paired Student's t -test. * P <0.05; ** P <0.01.

Article Snippet: Mutagenesis of the human WT SYT11 promoter-GLuc-SEAP vector (GeneCopoeia) (CLEAR-Site 2 in SYT11 promoter; CTCAAGTGAT>CAAAAGAAAT) was generated with QuikChange Multi Site-Directed Mutagenesis Kit (Agilent Stratagene), according to manufacturer's instructions, using the set of primers listed in .

Techniques: Control, Knockdown, Transfection, Plasmid Preparation, Ubiquitin Proteomics, Immunoprecipitation, Western Blot, Incubation, Two Tailed Test

Orange arrows identify the sequence of events that occur when ATP13A2 is depleted from cells, which in turn leads to depletion of SYT11, while green edges identify the sequence of events when ATP13A2 and SYT11 remain under steady-state conditions. Overall, we propose that ATP13A2 depletion decreases TSC2 levels, by a mechanism dependent on MYCBP2-induced ubiquitination, which in turn induces activation of mTORC1 and decreased TFEB-mediated transcription of SYT11 . In parallel, ATP13A2 depletion induces SYT11 ubiquitination and degradation. Both events contribute to a decrease of SYT11 levels, which induces lysosomal dysfunction, autophagy blockage and increased accumulation of α-synuclein A53T.

Journal: Nature Communications

Article Title: The Parkinson's disease-associated genes ATP13A2 and SYT11 regulate autophagy via a common pathway

doi: 10.1038/ncomms11803

Figure Lengend Snippet: Orange arrows identify the sequence of events that occur when ATP13A2 is depleted from cells, which in turn leads to depletion of SYT11, while green edges identify the sequence of events when ATP13A2 and SYT11 remain under steady-state conditions. Overall, we propose that ATP13A2 depletion decreases TSC2 levels, by a mechanism dependent on MYCBP2-induced ubiquitination, which in turn induces activation of mTORC1 and decreased TFEB-mediated transcription of SYT11 . In parallel, ATP13A2 depletion induces SYT11 ubiquitination and degradation. Both events contribute to a decrease of SYT11 levels, which induces lysosomal dysfunction, autophagy blockage and increased accumulation of α-synuclein A53T.

Article Snippet: Mutagenesis of the human WT SYT11 promoter-GLuc-SEAP vector (GeneCopoeia) (CLEAR-Site 2 in SYT11 promoter; CTCAAGTGAT>CAAAAGAAAT) was generated with QuikChange Multi Site-Directed Mutagenesis Kit (Agilent Stratagene), according to manufacturer's instructions, using the set of primers listed in .

Techniques: Sequencing, Ubiquitin Proteomics, Activation Assay

Identification of candidates involved in the trafficking of MMP2. (A) Scheme of the MMP2 RUSH construct. SS-Flag-MMP2-HA-SBP-eGFP was used as a reporter. Fluorescence images show HeLa cells expressing MMP2-SBP-eGFP counterstained against TGN46 (red). Without biotin, MMP2 is retained in the ER (0 min). It reaches the Golgi 15 min after biotin addition and is sorted into vesicles (arrowheads) at 30 and 45 min, respectively. Scale bars, 5 µm. (B) MS strategy to identify MMP2 interacting partners in the Golgi. HeLa cells expressing MMP2-SBP-eGFP or SS-SBP-eGFP were incubated for 20 min with biotin to enrich reporter proteins at the Golgi. After GFP IP, samples were analyzed using MS ( n = 3). (C) Volcano plot highlights significantly enriched MMP2 interactors in pink. 42 sorting-related candidates were found, among them TIMP2, a known inhibitor of MMP2, and NUCB1. Two-sample t test, false discovery rate = 0.3, minimum fold change = 0.5. (D) Fluorescence images of HeLa cells labeled with endogenous NUCB1 (green) and GM130 or TGN46 (red). Scale bars, 5 µm; zoom, 2 µm. (E) HEK 293T cells expressing SS-MMP2-SBP-eGFP or SS-SBP-eGFP were processed for GFP IP and WB analysis. (F) Semiquantitative analysis of the normalized NUCB1 to GFP signal from two independent experiments. Significance: one-sample t test. (G) His-tag coIP of recombinant rNUCB1-His. Endogenous MMP2 from HeLa Golgi membranes coimmunoprecipitated with rNUCB1-His but not rGFP-His. (H) Semiquantitative analysis of the MMP2 signal from three independent experiments. Bars, mean ± SD. Paired t test: *, P < 0.05; ***, P < 0.001.

Journal: The Journal of Cell Biology

Article Title: Nucleobindin-1 regulates ECM degradation by promoting intra-Golgi trafficking of MMPs

doi: 10.1083/jcb.201907058

Figure Lengend Snippet: Identification of candidates involved in the trafficking of MMP2. (A) Scheme of the MMP2 RUSH construct. SS-Flag-MMP2-HA-SBP-eGFP was used as a reporter. Fluorescence images show HeLa cells expressing MMP2-SBP-eGFP counterstained against TGN46 (red). Without biotin, MMP2 is retained in the ER (0 min). It reaches the Golgi 15 min after biotin addition and is sorted into vesicles (arrowheads) at 30 and 45 min, respectively. Scale bars, 5 µm. (B) MS strategy to identify MMP2 interacting partners in the Golgi. HeLa cells expressing MMP2-SBP-eGFP or SS-SBP-eGFP were incubated for 20 min with biotin to enrich reporter proteins at the Golgi. After GFP IP, samples were analyzed using MS ( n = 3). (C) Volcano plot highlights significantly enriched MMP2 interactors in pink. 42 sorting-related candidates were found, among them TIMP2, a known inhibitor of MMP2, and NUCB1. Two-sample t test, false discovery rate = 0.3, minimum fold change = 0.5. (D) Fluorescence images of HeLa cells labeled with endogenous NUCB1 (green) and GM130 or TGN46 (red). Scale bars, 5 µm; zoom, 2 µm. (E) HEK 293T cells expressing SS-MMP2-SBP-eGFP or SS-SBP-eGFP were processed for GFP IP and WB analysis. (F) Semiquantitative analysis of the normalized NUCB1 to GFP signal from two independent experiments. Significance: one-sample t test. (G) His-tag coIP of recombinant rNUCB1-His. Endogenous MMP2 from HeLa Golgi membranes coimmunoprecipitated with rNUCB1-His but not rGFP-His. (H) Semiquantitative analysis of the MMP2 signal from three independent experiments. Bars, mean ± SD. Paired t test: *, P < 0.05; ***, P < 0.001.

Article Snippet: The human MMP2 gene was amplified from a pCMV3-SP-Flag-MMP2 vector (Sino Biological) using 5′-CCC​AAG​CTT​ATG​CCA​CTG​CTG​CTC​TTG​CT-3′ as a forward (Fw) primer and 5′-TTT​TCC​TTT​TGC​GGC​CGC​TCA​AGC​GTA​ATC​TGG​AAC​ATC​GTA​TGG​GTA​GCA​GCC​TAG​CCA​GTC​GGA​TTT-3′ as a reverse (Rv) primer.

Techniques: Construct, Fluorescence, Expressing, Incubation, Labeling, Recombinant

MMP2-eGFP secretion and evaluation of CRISPR NUCB1-KO clones . (A) HeLa cells stably expressing SS-MMP2-eGFP were seeded on glass slides and incubated at 37°C for 3 d to evaluate MMP2-eGFP secretion. After fixation, cells were incubated with GFP antibody and Alexa Fluor 594. Confocal fluorescence images show colocalization of MMP2-eGFP and GFP antibody of nonpermeabilized cells, evidencing secretion of MMP2-eGFP to the extracellular space. Scale bars, 10 µm; zoom bar, 2 µm. (B and C) NUCB1-KO cells were generated using the CRISPR-Cas9 system with three different gRNAs and selection of single colonies. After puromycin selection, three NUCB1-KO clones were identified by WB (B) and later confirmed by immunofluorescence (C). *, unspecific band; KO, HeLa NUCB1-KO cells; CN, HeLa control. Semiquantitative analysis shows normalized NUCB1-to-β-actin signal.

Journal: The Journal of Cell Biology

Article Title: Nucleobindin-1 regulates ECM degradation by promoting intra-Golgi trafficking of MMPs

doi: 10.1083/jcb.201907058

Figure Lengend Snippet: MMP2-eGFP secretion and evaluation of CRISPR NUCB1-KO clones . (A) HeLa cells stably expressing SS-MMP2-eGFP were seeded on glass slides and incubated at 37°C for 3 d to evaluate MMP2-eGFP secretion. After fixation, cells were incubated with GFP antibody and Alexa Fluor 594. Confocal fluorescence images show colocalization of MMP2-eGFP and GFP antibody of nonpermeabilized cells, evidencing secretion of MMP2-eGFP to the extracellular space. Scale bars, 10 µm; zoom bar, 2 µm. (B and C) NUCB1-KO cells were generated using the CRISPR-Cas9 system with three different gRNAs and selection of single colonies. After puromycin selection, three NUCB1-KO clones were identified by WB (B) and later confirmed by immunofluorescence (C). *, unspecific band; KO, HeLa NUCB1-KO cells; CN, HeLa control. Semiquantitative analysis shows normalized NUCB1-to-β-actin signal.

Article Snippet: The human MMP2 gene was amplified from a pCMV3-SP-Flag-MMP2 vector (Sino Biological) using 5′-CCC​AAG​CTT​ATG​CCA​CTG​CTG​CTC​TTG​CT-3′ as a forward (Fw) primer and 5′-TTT​TCC​TTT​TGC​GGC​CGC​TCA​AGC​GTA​ATC​TGG​AAC​ATC​GTA​TGG​GTA​GCA​GCC​TAG​CCA​GTC​GGA​TTT-3′ as a reverse (Rv) primer.

Techniques: CRISPR, Clone Assay, Stable Transfection, Expressing, Incubation, Fluorescence, Generated, Selection, Immunofluorescence

MMP2 is partially sorted in LyzC-positive secretory vesicles. HeLa cells expressing MMP2-eGFP were immunolabeled with a-Rab5, a-Rab7, or Rab11 antibodies (red). MMP2-eGFP–expressing cells were cotransfected with mCherry (mCh)-lysosomes or LyzC-mCherry to label lysosomes or LyzC-positive secretory vesicles, respectively. Rab6-GFP or Rab8-GFP constructs were cotransfected with MMP2-tagRFP. Images were acquired by confocal microscopy. White arrowheads point to distinct vesicles; magenta arrowheads point to colocalizing vesicles. Bars, 10 µm; zoom, 2 µm.

Journal: The Journal of Cell Biology

Article Title: Nucleobindin-1 regulates ECM degradation by promoting intra-Golgi trafficking of MMPs

doi: 10.1083/jcb.201907058

Figure Lengend Snippet: MMP2 is partially sorted in LyzC-positive secretory vesicles. HeLa cells expressing MMP2-eGFP were immunolabeled with a-Rab5, a-Rab7, or Rab11 antibodies (red). MMP2-eGFP–expressing cells were cotransfected with mCherry (mCh)-lysosomes or LyzC-mCherry to label lysosomes or LyzC-positive secretory vesicles, respectively. Rab6-GFP or Rab8-GFP constructs were cotransfected with MMP2-tagRFP. Images were acquired by confocal microscopy. White arrowheads point to distinct vesicles; magenta arrowheads point to colocalizing vesicles. Bars, 10 µm; zoom, 2 µm.

Article Snippet: The human MMP2 gene was amplified from a pCMV3-SP-Flag-MMP2 vector (Sino Biological) using 5′-CCC​AAG​CTT​ATG​CCA​CTG​CTG​CTC​TTG​CT-3′ as a forward (Fw) primer and 5′-TTT​TCC​TTT​TGC​GGC​CGC​TCA​AGC​GTA​ATC​TGG​AAC​ATC​GTA​TGG​GTA​GCA​GCC​TAG​CCA​GTC​GGA​TTT-3′ as a reverse (Rv) primer.

Techniques: Expressing, Immunolabeling, Construct, Confocal Microscopy

Protein purification and evaluation of the direct interaction between MMP2 and NUCB1. (A) Coomassie-stained SDS-PAGE for the evaluation of His-tag purified recombinant NUCB1-His (rNUCB1-His). (B) Anti-NUCB1 WB analysis of the elution fraction shown in line 4 from A. (C) WB analysis of purified His-SUMO-MMP2 using MMP2 antibody. (D) Recombinant His-SUMO-MMP2 (rHS-MMP2) was bioconjugated with Cy3 via maleimide labeling and subsequently analyzed by AUC. The lowest panel shows peak of sedimentation of rHS-MMP2 at 4.705 S. (E) AUC profile of rHis-SUMO-MMP2-Cy3 and NUCB1-His. The lowest panel shows a peak at 3.189 S, indicating a change in the sedimentation velocity associated to a direct interaction of NUCB1 and MMP2. (F) Coomassie-stained SDS-PAGE of purified His-tagged NUCB1 Ca 2+ binding mutant (rNUCB1mEFh1+2). (G) WB analysis of the elution fraction shown in line 4 of F using NUCB1 antibody. (H) CD measurement of rNUCB1-His and rNUCB1mEFh1+2-His under presence or absence of 1 mM Ca 2+ . rNUCB1-mEF1+2 molar ellipticity is lower compared with rNUCB1-His. Evaluation of the CD spectra using CONTIN showed an increase in rNUCB1-His α-helicity upon Ca 2+ addition (from 0.385 to 0.413) that was not observed in rNUCB1-mEFh1+2 (from 0.256 to 0.147). Instead, an increase in β-sheet content (from 0.151 to 0.322) was observed. These findings are in accordance with the results described by .

Journal: The Journal of Cell Biology

Article Title: Nucleobindin-1 regulates ECM degradation by promoting intra-Golgi trafficking of MMPs

doi: 10.1083/jcb.201907058

Figure Lengend Snippet: Protein purification and evaluation of the direct interaction between MMP2 and NUCB1. (A) Coomassie-stained SDS-PAGE for the evaluation of His-tag purified recombinant NUCB1-His (rNUCB1-His). (B) Anti-NUCB1 WB analysis of the elution fraction shown in line 4 from A. (C) WB analysis of purified His-SUMO-MMP2 using MMP2 antibody. (D) Recombinant His-SUMO-MMP2 (rHS-MMP2) was bioconjugated with Cy3 via maleimide labeling and subsequently analyzed by AUC. The lowest panel shows peak of sedimentation of rHS-MMP2 at 4.705 S. (E) AUC profile of rHis-SUMO-MMP2-Cy3 and NUCB1-His. The lowest panel shows a peak at 3.189 S, indicating a change in the sedimentation velocity associated to a direct interaction of NUCB1 and MMP2. (F) Coomassie-stained SDS-PAGE of purified His-tagged NUCB1 Ca 2+ binding mutant (rNUCB1mEFh1+2). (G) WB analysis of the elution fraction shown in line 4 of F using NUCB1 antibody. (H) CD measurement of rNUCB1-His and rNUCB1mEFh1+2-His under presence or absence of 1 mM Ca 2+ . rNUCB1-mEF1+2 molar ellipticity is lower compared with rNUCB1-His. Evaluation of the CD spectra using CONTIN showed an increase in rNUCB1-His α-helicity upon Ca 2+ addition (from 0.385 to 0.413) that was not observed in rNUCB1-mEFh1+2 (from 0.256 to 0.147). Instead, an increase in β-sheet content (from 0.151 to 0.322) was observed. These findings are in accordance with the results described by .

Article Snippet: The human MMP2 gene was amplified from a pCMV3-SP-Flag-MMP2 vector (Sino Biological) using 5′-CCC​AAG​CTT​ATG​CCA​CTG​CTG​CTC​TTG​CT-3′ as a forward (Fw) primer and 5′-TTT​TCC​TTT​TGC​GGC​CGC​TCA​AGC​GTA​ATC​TGG​AAC​ATC​GTA​TGG​GTA​GCA​GCC​TAG​CCA​GTC​GGA​TTT-3′ as a reverse (Rv) primer.

Techniques: Protein Purification, Staining, SDS Page, Purification, Recombinant, Labeling, Sedimentation, Binding Assay, Mutagenesis

NUCB1-KO impairs the trafficking of MMP2. (A) Fluorescent images of HeLa or NUCB1-KO cells expressing SS-MMP2-SBP-eGFP with or without NUCB1-WT, counterstained against NUCB1 (red) and captured after 0, 15, 30, and 45 min of biotin incubation. Arrowheads, cytoplasmic vesicles. Scale bars, 5 µm. (B) Cytoplasmic vesicle counts as described in A are plotted as number of vesicles per cell ( n ≥ 90 cells, median ± IQR of two independent experiments; ***, P < 0.001; n.s., not significant). (C) Confocal microscopy images of HeLa or NUCB1-KO cells expressing LyzC-SBP-eGFP and counterstained against NUCB1 (red) after 0, 20, 40, and 60 min of biotin incubation. Arrowheads, cytoplasmic vesicles. Scale bars, 5 µm. (D) Cytoplasmic vesicle counts from C of two independent experiments ( n ≥ 42 cells, median ± IQR). (E) Secretion assay of HeLa or NUCB1-KO cells expressing SS-MMP2-SBP-eGFP or LyzC-SBP-EGFP and incubated with biotin for 45 or 60 min, respectively. WCL, whole-cell lysates. [SNs], 10×-concentrated supernatants. (F) Semiquantitative analysis from three independent experiments, one-sample t test. Bars, mean ± SD. (G) GFP-coIP of HeLa or NUCB1-KO cells expressing LyzC-eGFP, with or without NUCB1-WT. GFP-HA, negative control; CN, HeLa control; KO, NUCB1-KO. (H) Semiquantitative analysis of NUCB1 to GFP signal from three independent experiments. Bars, mean ± SD; paired t test.

Journal: The Journal of Cell Biology

Article Title: Nucleobindin-1 regulates ECM degradation by promoting intra-Golgi trafficking of MMPs

doi: 10.1083/jcb.201907058

Figure Lengend Snippet: NUCB1-KO impairs the trafficking of MMP2. (A) Fluorescent images of HeLa or NUCB1-KO cells expressing SS-MMP2-SBP-eGFP with or without NUCB1-WT, counterstained against NUCB1 (red) and captured after 0, 15, 30, and 45 min of biotin incubation. Arrowheads, cytoplasmic vesicles. Scale bars, 5 µm. (B) Cytoplasmic vesicle counts as described in A are plotted as number of vesicles per cell ( n ≥ 90 cells, median ± IQR of two independent experiments; ***, P < 0.001; n.s., not significant). (C) Confocal microscopy images of HeLa or NUCB1-KO cells expressing LyzC-SBP-eGFP and counterstained against NUCB1 (red) after 0, 20, 40, and 60 min of biotin incubation. Arrowheads, cytoplasmic vesicles. Scale bars, 5 µm. (D) Cytoplasmic vesicle counts from C of two independent experiments ( n ≥ 42 cells, median ± IQR). (E) Secretion assay of HeLa or NUCB1-KO cells expressing SS-MMP2-SBP-eGFP or LyzC-SBP-EGFP and incubated with biotin for 45 or 60 min, respectively. WCL, whole-cell lysates. [SNs], 10×-concentrated supernatants. (F) Semiquantitative analysis from three independent experiments, one-sample t test. Bars, mean ± SD. (G) GFP-coIP of HeLa or NUCB1-KO cells expressing LyzC-eGFP, with or without NUCB1-WT. GFP-HA, negative control; CN, HeLa control; KO, NUCB1-KO. (H) Semiquantitative analysis of NUCB1 to GFP signal from three independent experiments. Bars, mean ± SD; paired t test.

Article Snippet: The human MMP2 gene was amplified from a pCMV3-SP-Flag-MMP2 vector (Sino Biological) using 5′-CCC​AAG​CTT​ATG​CCA​CTG​CTG​CTC​TTG​CT-3′ as a forward (Fw) primer and 5′-TTT​TCC​TTT​TGC​GGC​CGC​TCA​AGC​GTA​ATC​TGG​AAC​ATC​GTA​TGG​GTA​GCA​GCC​TAG​CCA​GTC​GGA​TTT-3′ as a reverse (Rv) primer.

Techniques: Expressing, Incubation, Confocal Microscopy, Negative Control

MMP2 IG trafficking is exclusively dependent on Golgi-localized NUCB1, which also impairs IG trafficking of MT1-MMP. (A) HeLa or NUCB1-KO cells expressing SS-SBP-MMP2-eGFP alone or with a cytosolic variant of NUCB1 lacking its SS (NUCB1-cyto) were fixed after 0, 15, 30, and 45 min of biotin incubation. Maximal Z-projection analysis of confocal microscopy images shows no differences in MMP2 trafficking of NUCB1-cyto transfected cells compared with NUCB1-KO cells (arrowheads). Scale bars, 10 µm. (B) Quantification of cytoplasmic MMP2 vesicles from cells in A. n > 18 cells; mean ± SD; two independent experiments. Significant differences with P < 0.05 were analyzed via nonparametric Kruskal–Wallis test with Dunn’s multiple comparison, **, P < 0.01. (C) mCherry-tagged MT1-MMP RUSH construct (SS-MT1-MMP-SBP-mCh). Cyto, cytosolic domain. (D) Confocal fluorescence images of HeLa or NUCB1-KO cells transfected with or without NUCB1-WT and fixed after 30, 60, and 90 min of biotin incubation. Arrowheads, cytoplasmic vesicles. Scale bars, 5 µm. (E) Quantification of cytoplasmic vesicles observed in A. n = 24 cells; two independent experiments; median ± IQR; ***, P < 0.001; n.s., non-significant. (F) Cell surface biotinylation assay coupled with streptavidin pull-down. HeLa or NUCB1-KO cells were untreated (time 0) or incubated with sulfo-NHS-Biotin for 90 min to label cell surface proteins, and then pulled down with Neutravidin beads. WB analysis shows a reduction in the amount of endogenous active MT1-MMP at the surface of NUCB1-KO cells compared with HeLa control. β-1 integrin was used as loading control. (G) Semiquantitative analysis of surface labeled active MT1-MMP from F represented as % of normalized MT1-MMP intensity to β-1 integrin in comparison to control (100%). n = 3 independent experiments; one-sample t test, **, P < 0.01. Bars, mean ± SD.

Journal: The Journal of Cell Biology

Article Title: Nucleobindin-1 regulates ECM degradation by promoting intra-Golgi trafficking of MMPs

doi: 10.1083/jcb.201907058

Figure Lengend Snippet: MMP2 IG trafficking is exclusively dependent on Golgi-localized NUCB1, which also impairs IG trafficking of MT1-MMP. (A) HeLa or NUCB1-KO cells expressing SS-SBP-MMP2-eGFP alone or with a cytosolic variant of NUCB1 lacking its SS (NUCB1-cyto) were fixed after 0, 15, 30, and 45 min of biotin incubation. Maximal Z-projection analysis of confocal microscopy images shows no differences in MMP2 trafficking of NUCB1-cyto transfected cells compared with NUCB1-KO cells (arrowheads). Scale bars, 10 µm. (B) Quantification of cytoplasmic MMP2 vesicles from cells in A. n > 18 cells; mean ± SD; two independent experiments. Significant differences with P < 0.05 were analyzed via nonparametric Kruskal–Wallis test with Dunn’s multiple comparison, **, P < 0.01. (C) mCherry-tagged MT1-MMP RUSH construct (SS-MT1-MMP-SBP-mCh). Cyto, cytosolic domain. (D) Confocal fluorescence images of HeLa or NUCB1-KO cells transfected with or without NUCB1-WT and fixed after 30, 60, and 90 min of biotin incubation. Arrowheads, cytoplasmic vesicles. Scale bars, 5 µm. (E) Quantification of cytoplasmic vesicles observed in A. n = 24 cells; two independent experiments; median ± IQR; ***, P < 0.001; n.s., non-significant. (F) Cell surface biotinylation assay coupled with streptavidin pull-down. HeLa or NUCB1-KO cells were untreated (time 0) or incubated with sulfo-NHS-Biotin for 90 min to label cell surface proteins, and then pulled down with Neutravidin beads. WB analysis shows a reduction in the amount of endogenous active MT1-MMP at the surface of NUCB1-KO cells compared with HeLa control. β-1 integrin was used as loading control. (G) Semiquantitative analysis of surface labeled active MT1-MMP from F represented as % of normalized MT1-MMP intensity to β-1 integrin in comparison to control (100%). n = 3 independent experiments; one-sample t test, **, P < 0.01. Bars, mean ± SD.

Article Snippet: The human MMP2 gene was amplified from a pCMV3-SP-Flag-MMP2 vector (Sino Biological) using 5′-CCC​AAG​CTT​ATG​CCA​CTG​CTG​CTC​TTG​CT-3′ as a forward (Fw) primer and 5′-TTT​TCC​TTT​TGC​GGC​CGC​TCA​AGC​GTA​ATC​TGG​AAC​ATC​GTA​TGG​GTA​GCA​GCC​TAG​CCA​GTC​GGA​TTT-3′ as a reverse (Rv) primer.

Techniques: Expressing, Variant Assay, Incubation, Confocal Microscopy, Transfection, Construct, Fluorescence, Cell Surface Biotinylation Assay, Labeling

NUCB1 does not affect MMP2 activation nor trafficking of other cargoes such as HRP and Cathepsin D. (A) Zymography assay of HeLa cells expressing SS-MMP2-SBP-eGFP. Untsf HeLa, Hela without transfection; [SN], 10×-concentrated supernatants; CN, HeLa control; KO, NUCB1-KO. (B) Semiquantitative analysis of experiment shown in A. n = 3 independent experiments; one-sample t test; n.s., nonsignificant. (C) Whole-cell lysates of HeLa and NUCB1-KO cells stably expressing SS-HRP-FLAG were analyzed by anti-FLAG, anti-NUCB1, and anti-β-actin WB. SS-HRP-FLAG is expressed in HeLa and NUCB1-KO cells to similar levels. (D) Cell culture supernatants of cells described in C were analyzed for HRP activity by chemiluminescence after 4-h secretion. BFA served as a positive control for perturbed secretion and was added for 1 h before HRP secretion analysis. No significant differences were observed between NUCB1-KO and HeLa control cells. *, P < 0.05. (E) HeLa or NUCB1-KO cells expressing SS-SBP-eGFP-Cathepsin D were fixed 20, 40, and 60 min after biotin addition. Representative maximum Z-projection images show Cathepsin D trafficking from Golgi to cytoplasmic vesicles (arrowheads). Scale bars, 10 µm. (F) Quantification of cytoplasmic Cathepsin D vesicles from cells shown in E. n > 30 HeLa and NUCB1-KO cells per time point; two independent experiments; mean ± SD. Statistical analysis was performed using a nonparametric Kruskal–Wallis test with Dunn’s multiple comparison test. No significant differences with P < 0.05 were detected.

Journal: The Journal of Cell Biology

Article Title: Nucleobindin-1 regulates ECM degradation by promoting intra-Golgi trafficking of MMPs

doi: 10.1083/jcb.201907058

Figure Lengend Snippet: NUCB1 does not affect MMP2 activation nor trafficking of other cargoes such as HRP and Cathepsin D. (A) Zymography assay of HeLa cells expressing SS-MMP2-SBP-eGFP. Untsf HeLa, Hela without transfection; [SN], 10×-concentrated supernatants; CN, HeLa control; KO, NUCB1-KO. (B) Semiquantitative analysis of experiment shown in A. n = 3 independent experiments; one-sample t test; n.s., nonsignificant. (C) Whole-cell lysates of HeLa and NUCB1-KO cells stably expressing SS-HRP-FLAG were analyzed by anti-FLAG, anti-NUCB1, and anti-β-actin WB. SS-HRP-FLAG is expressed in HeLa and NUCB1-KO cells to similar levels. (D) Cell culture supernatants of cells described in C were analyzed for HRP activity by chemiluminescence after 4-h secretion. BFA served as a positive control for perturbed secretion and was added for 1 h before HRP secretion analysis. No significant differences were observed between NUCB1-KO and HeLa control cells. *, P < 0.05. (E) HeLa or NUCB1-KO cells expressing SS-SBP-eGFP-Cathepsin D were fixed 20, 40, and 60 min after biotin addition. Representative maximum Z-projection images show Cathepsin D trafficking from Golgi to cytoplasmic vesicles (arrowheads). Scale bars, 10 µm. (F) Quantification of cytoplasmic Cathepsin D vesicles from cells shown in E. n > 30 HeLa and NUCB1-KO cells per time point; two independent experiments; mean ± SD. Statistical analysis was performed using a nonparametric Kruskal–Wallis test with Dunn’s multiple comparison test. No significant differences with P < 0.05 were detected.

Article Snippet: The human MMP2 gene was amplified from a pCMV3-SP-Flag-MMP2 vector (Sino Biological) using 5′-CCC​AAG​CTT​ATG​CCA​CTG​CTG​CTC​TTG​CT-3′ as a forward (Fw) primer and 5′-TTT​TCC​TTT​TGC​GGC​CGC​TCA​AGC​GTA​ATC​TGG​AAC​ATC​GTA​TGG​GTA​GCA​GCC​TAG​CCA​GTC​GGA​TTT-3′ as a reverse (Rv) primer.

Techniques: Activation Assay, Zymography, Expressing, Transfection, Stable Transfection, Cell Culture, Activity Assay, Positive Control

MMP2 trafficking delay occurs at the cis-Golgi. (A) Fluorescence images of HeLa or NUCB1-KO cells transiently expressing SS-MMP2-SBP-eGFP, fixed at 2.5, 5, and 7.5 min after biotin addition, and counterstained against ERGIC53 (red). Scale bars, 5 µm. (B) Average PC per time point. (C) Colocalization of HeLa or NUCB1-KO cells expressing SS-MMP2-SBP-eGFP with GM130 (red) after 10, 15, 20, and 25 min of biotin incubation. Scale bars, 5 µm. (D) Average PC illustrates decreased colocalization at 10, 15, and 20 min after biotin addition. (E) Colocalization of SS-MMP2-SBP-eGFP with TGN46 (red) expressed in HeLa or NUCB1-KO cells at 20, 25, 30, 35, and 40 min after biotin addition. Scale bars, 5 µm. (F) Average PC shows that MMP2 is equally colocalizing with TGN46 in HeLa and NUCB1-KO cells upon arrival at the TGN. Error bars represent SD; *, P < 0.05; **, P < 0.01; ***, P < 0.001; n.s., not significant.

Journal: The Journal of Cell Biology

Article Title: Nucleobindin-1 regulates ECM degradation by promoting intra-Golgi trafficking of MMPs

doi: 10.1083/jcb.201907058

Figure Lengend Snippet: MMP2 trafficking delay occurs at the cis-Golgi. (A) Fluorescence images of HeLa or NUCB1-KO cells transiently expressing SS-MMP2-SBP-eGFP, fixed at 2.5, 5, and 7.5 min after biotin addition, and counterstained against ERGIC53 (red). Scale bars, 5 µm. (B) Average PC per time point. (C) Colocalization of HeLa or NUCB1-KO cells expressing SS-MMP2-SBP-eGFP with GM130 (red) after 10, 15, 20, and 25 min of biotin incubation. Scale bars, 5 µm. (D) Average PC illustrates decreased colocalization at 10, 15, and 20 min after biotin addition. (E) Colocalization of SS-MMP2-SBP-eGFP with TGN46 (red) expressed in HeLa or NUCB1-KO cells at 20, 25, 30, 35, and 40 min after biotin addition. Scale bars, 5 µm. (F) Average PC shows that MMP2 is equally colocalizing with TGN46 in HeLa and NUCB1-KO cells upon arrival at the TGN. Error bars represent SD; *, P < 0.05; **, P < 0.01; ***, P < 0.001; n.s., not significant.

Article Snippet: The human MMP2 gene was amplified from a pCMV3-SP-Flag-MMP2 vector (Sino Biological) using 5′-CCC​AAG​CTT​ATG​CCA​CTG​CTG​CTC​TTG​CT-3′ as a forward (Fw) primer and 5′-TTT​TCC​TTT​TGC​GGC​CGC​TCA​AGC​GTA​ATC​TGG​AAC​ATC​GTA​TGG​GTA​GCA​GCC​TAG​CCA​GTC​GGA​TTT-3′ as a reverse (Rv) primer.

Techniques: Fluorescence, Expressing, Incubation

MMP2 trafficking is exclusively delayed at the Golgi in living cells. (A) HeLa or NUCB1-KO cells expressing SS-SBP-MMP2-eGFP were analyzed by live-cell wide-field microscopy. Representative images of MMP2 trafficking after 0, 30, 35, and 40 min of biotin incubation. Images were acquired in 1-min frames for each analyzed cell. Arrowheads, cytoplasmic MMP2 vesicles. Scale bars, 10 µm. (B) Quantification of cytoplasmic MMP2 vesicles per frame from cells shown in A. n.s., nonsignificant. *, P < 0.05; **, P < 0.01. (C) Schematic representation of ER–Golgi cargo transport analysis, measured as normalized Golgi area over time in cells shown in A. (D) Normalized Golgi area for each time point (median ± IQR). A reduced Golgi compaction was observed in the time range 15–23 min in NUCB1-KO cells compared with HeLa control. *, P < 0.05. (E and F) HeLa or NUCB1-KO cells ( n = 11) expressing SS-SBP-MMP2-eGFP fixed without biotin addition and immunostained for ER exit site marker Sec16 (red). Scale bar, 10 µm; zoom, 2 µm. Retained MMP2 in the ER partially colocalized with Sec16 in both control and NUCB1-KO cells to the same extent (F). Magenta arrowheads, MMP2 structures that colocalized with ER exit sites; white arrowheads, ER exit sites. t test: P < 0.05.

Journal: The Journal of Cell Biology

Article Title: Nucleobindin-1 regulates ECM degradation by promoting intra-Golgi trafficking of MMPs

doi: 10.1083/jcb.201907058

Figure Lengend Snippet: MMP2 trafficking is exclusively delayed at the Golgi in living cells. (A) HeLa or NUCB1-KO cells expressing SS-SBP-MMP2-eGFP were analyzed by live-cell wide-field microscopy. Representative images of MMP2 trafficking after 0, 30, 35, and 40 min of biotin incubation. Images were acquired in 1-min frames for each analyzed cell. Arrowheads, cytoplasmic MMP2 vesicles. Scale bars, 10 µm. (B) Quantification of cytoplasmic MMP2 vesicles per frame from cells shown in A. n.s., nonsignificant. *, P < 0.05; **, P < 0.01. (C) Schematic representation of ER–Golgi cargo transport analysis, measured as normalized Golgi area over time in cells shown in A. (D) Normalized Golgi area for each time point (median ± IQR). A reduced Golgi compaction was observed in the time range 15–23 min in NUCB1-KO cells compared with HeLa control. *, P < 0.05. (E and F) HeLa or NUCB1-KO cells ( n = 11) expressing SS-SBP-MMP2-eGFP fixed without biotin addition and immunostained for ER exit site marker Sec16 (red). Scale bar, 10 µm; zoom, 2 µm. Retained MMP2 in the ER partially colocalized with Sec16 in both control and NUCB1-KO cells to the same extent (F). Magenta arrowheads, MMP2 structures that colocalized with ER exit sites; white arrowheads, ER exit sites. t test: P < 0.05.

Article Snippet: The human MMP2 gene was amplified from a pCMV3-SP-Flag-MMP2 vector (Sino Biological) using 5′-CCC​AAG​CTT​ATG​CCA​CTG​CTG​CTC​TTG​CT-3′ as a forward (Fw) primer and 5′-TTT​TCC​TTT​TGC​GGC​CGC​TCA​AGC​GTA​ATC​TGG​AAC​ATC​GTA​TGG​GTA​GCA​GCC​TAG​CCA​GTC​GGA​TTT-3′ as a reverse (Rv) primer.

Techniques: Expressing, Microscopy, Incubation, Marker

NUCB1 EFhs are essential for Golgi trafficking of MMP2. (A) Protein alignment of human NUCB1 (Q02818, aa 241–400), CaM (P0DP23), Calumenin (O43852), and Cab45 (Q9BRK5). Pink boxes, NUCB1 EFhs. (B) NUCB1 adapted PDB protein model (accession no. 1SNL ); NUCB1 EFhs, cyan; NUCB1-WT, EFhs with first and last amino acid of the domain in dark blue; NUCB1-mEFh1+2, amino acid substitutions E264Q and E316Q in pink. (C) CoIP of MMP2-eGFP transiently expressed in NUCB1-KO cells transfected with NUCB1-WT or NUCB1-mEFh1+2. n = 4 biological replicates. (D) Semiquantitative analysis of NUCB1 signal per sample normalized to the one of NUCB1-KO cells reexpressing NUCB1-WT. Bars, mean ± SD; one-sample t test. (E) Confocal fluorescence images of HeLa or NUCB1-KO cells expressing SS-MMP2-SBP-eGFP and cotransfected with or without NUCB1-WT or NUCB1-mEFh1+2. After 15, 30, and 45 min of biotin incubation, cells were fixed and costained with NUCB1 antibody (red). Scale bars, 5 µm. Arrowheads, cytoplasmic vesicles. (F) Quantification of cytoplasmic vesicles as in E from two independent experiments (median ± IQR), n ≥ 19 cells. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

Journal: The Journal of Cell Biology

Article Title: Nucleobindin-1 regulates ECM degradation by promoting intra-Golgi trafficking of MMPs

doi: 10.1083/jcb.201907058

Figure Lengend Snippet: NUCB1 EFhs are essential for Golgi trafficking of MMP2. (A) Protein alignment of human NUCB1 (Q02818, aa 241–400), CaM (P0DP23), Calumenin (O43852), and Cab45 (Q9BRK5). Pink boxes, NUCB1 EFhs. (B) NUCB1 adapted PDB protein model (accession no. 1SNL ); NUCB1 EFhs, cyan; NUCB1-WT, EFhs with first and last amino acid of the domain in dark blue; NUCB1-mEFh1+2, amino acid substitutions E264Q and E316Q in pink. (C) CoIP of MMP2-eGFP transiently expressed in NUCB1-KO cells transfected with NUCB1-WT or NUCB1-mEFh1+2. n = 4 biological replicates. (D) Semiquantitative analysis of NUCB1 signal per sample normalized to the one of NUCB1-KO cells reexpressing NUCB1-WT. Bars, mean ± SD; one-sample t test. (E) Confocal fluorescence images of HeLa or NUCB1-KO cells expressing SS-MMP2-SBP-eGFP and cotransfected with or without NUCB1-WT or NUCB1-mEFh1+2. After 15, 30, and 45 min of biotin incubation, cells were fixed and costained with NUCB1 antibody (red). Scale bars, 5 µm. Arrowheads, cytoplasmic vesicles. (F) Quantification of cytoplasmic vesicles as in E from two independent experiments (median ± IQR), n ≥ 19 cells. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

Article Snippet: The human MMP2 gene was amplified from a pCMV3-SP-Flag-MMP2 vector (Sino Biological) using 5′-CCC​AAG​CTT​ATG​CCA​CTG​CTG​CTC​TTG​CT-3′ as a forward (Fw) primer and 5′-TTT​TCC​TTT​TGC​GGC​CGC​TCA​AGC​GTA​ATC​TGG​AAC​ATC​GTA​TGG​GTA​GCA​GCC​TAG​CCA​GTC​GGA​TTT-3′ as a reverse (Rv) primer.

Techniques: Transfection, Fluorescence, Expressing, Incubation

NUCB1 depletion impairs ECM invasion and degradation in MDA-MB-231 cells. (A) Expression levels of NUCB1 after siRNA-mediated silencing ( n = 3 independent experiments: R1, R2, and R3). *, unspecific band. (B) Semiquantitative analysis of normalized NUCB1 signal from A in silenced cells compared with control. Bars, mean ± SD. (C) Quantitative PCR analysis of relative MMP2 expression in siRNA-treated MDA-MB-231 cells ( n = 3 independent experiments, one-sample t test). (D) Secretion assay of endogenous MMP2 in MDA-MB-231 cells. [SN], 20×-concentrated supernatant; WCL, whole cell lysates. (E) Semiquantitative analysis of three independent experiments. Bars, mean ± SD. Significance, one-sample t test. (F and G) Representative pictures of Matrigel-coated Transwell invasion (F) or gelatin degradation (G) experiments. Scale bars, 150 µm. (H and I) Quantification of the number of migrating cells (H) and degraded gelatin area (I). Both invasion and degradation were reduced in siNUCB1 cells. Data: median ± IQR; n = 3 independent experiments. Paired t test: *, P < 0.05; **, P < 0.01; n.s., not significant.

Journal: The Journal of Cell Biology

Article Title: Nucleobindin-1 regulates ECM degradation by promoting intra-Golgi trafficking of MMPs

doi: 10.1083/jcb.201907058

Figure Lengend Snippet: NUCB1 depletion impairs ECM invasion and degradation in MDA-MB-231 cells. (A) Expression levels of NUCB1 after siRNA-mediated silencing ( n = 3 independent experiments: R1, R2, and R3). *, unspecific band. (B) Semiquantitative analysis of normalized NUCB1 signal from A in silenced cells compared with control. Bars, mean ± SD. (C) Quantitative PCR analysis of relative MMP2 expression in siRNA-treated MDA-MB-231 cells ( n = 3 independent experiments, one-sample t test). (D) Secretion assay of endogenous MMP2 in MDA-MB-231 cells. [SN], 20×-concentrated supernatant; WCL, whole cell lysates. (E) Semiquantitative analysis of three independent experiments. Bars, mean ± SD. Significance, one-sample t test. (F and G) Representative pictures of Matrigel-coated Transwell invasion (F) or gelatin degradation (G) experiments. Scale bars, 150 µm. (H and I) Quantification of the number of migrating cells (H) and degraded gelatin area (I). Both invasion and degradation were reduced in siNUCB1 cells. Data: median ± IQR; n = 3 independent experiments. Paired t test: *, P < 0.05; **, P < 0.01; n.s., not significant.

Article Snippet: The human MMP2 gene was amplified from a pCMV3-SP-Flag-MMP2 vector (Sino Biological) using 5′-CCC​AAG​CTT​ATG​CCA​CTG​CTG​CTC​TTG​CT-3′ as a forward (Fw) primer and 5′-TTT​TCC​TTT​TGC​GGC​CGC​TCA​AGC​GTA​ATC​TGG​AAC​ATC​GTA​TGG​GTA​GCA​GCC​TAG​CCA​GTC​GGA​TTT-3′ as a reverse (Rv) primer.

Techniques: Expressing, Real-time Polymerase Chain Reaction

( A ) Normalized SERPINB3 transcript in cervical tumor biopsies from RNAseq was distributed by reads per kilobase of transcript per million mapped reads (RPKM). ( B ) Boxplots along with individual data points show xCell immune scores in recurrent (R)/non-recurrent (NR) SERPINB3-low (B3/L) and SERPINB3-high (B3/H) tumors. * P < 0.05, one-way ANOVA test. ( C ) Heatmap of enriched immune cell subpopulation was generated through xCell immune infiltrate prediction. Color intensity is proportional to average xCell score for each population across samples. ( D-G ) Spearman’s correlation of SERPINB3 with the expression of ( D ) CXCL1, ( E ) CXCL8, ( F ) S100A8, ( G ) S100A9 was performed using RNAseq from 66 cervical tumor biopsies collected prior to (chemo)- RT. ( H ) SERPINB3 expression correlated with CXCL1, CXCL8, S100A8, S100A9 expression in multiple cancer types. Analysis was performed using TCGA PanCancer Atlas and numeric values indicate Spearman’s correlation coefficient. BLCA, bladder urothelial carcinoma; BRCA, breast invasive carcinoma; CESC, cervical squamous cell carcinoma and endocervical adenocarcinoma; HNSC, head and neck squamous cell carcinoma; LUSC, lung squamous cell carcinoma; PRAD, prostate adenocarcinoma; UCEC, uterine corpus endometrial carcinoma

Journal: bioRxiv

Article Title: SCCA1/SERPINB3 promotes suppressive immune environment via STAT-dependent chemokine production, blunting the therapy-induced T cell responses

doi: 10.1101/2023.02.01.526675

Figure Lengend Snippet: ( A ) Normalized SERPINB3 transcript in cervical tumor biopsies from RNAseq was distributed by reads per kilobase of transcript per million mapped reads (RPKM). ( B ) Boxplots along with individual data points show xCell immune scores in recurrent (R)/non-recurrent (NR) SERPINB3-low (B3/L) and SERPINB3-high (B3/H) tumors. * P < 0.05, one-way ANOVA test. ( C ) Heatmap of enriched immune cell subpopulation was generated through xCell immune infiltrate prediction. Color intensity is proportional to average xCell score for each population across samples. ( D-G ) Spearman’s correlation of SERPINB3 with the expression of ( D ) CXCL1, ( E ) CXCL8, ( F ) S100A8, ( G ) S100A9 was performed using RNAseq from 66 cervical tumor biopsies collected prior to (chemo)- RT. ( H ) SERPINB3 expression correlated with CXCL1, CXCL8, S100A8, S100A9 expression in multiple cancer types. Analysis was performed using TCGA PanCancer Atlas and numeric values indicate Spearman’s correlation coefficient. BLCA, bladder urothelial carcinoma; BRCA, breast invasive carcinoma; CESC, cervical squamous cell carcinoma and endocervical adenocarcinoma; HNSC, head and neck squamous cell carcinoma; LUSC, lung squamous cell carcinoma; PRAD, prostate adenocarcinoma; UCEC, uterine corpus endometrial carcinoma

Article Snippet: SERPINB3 stable expression cells were generated using pULTRA lentiviral vector (Addgene #24129) containing human SERPINB3 or pLV-C-GFPSpark vector (Sino Biological LVCV-35) containing mouse Serpinb3a GFP-tagged fusion proteins.

Techniques: Generated, Expressing

( A ) Caski and SW756 cells were transduced with pUltra vector (Caski/Ctrl, SW756/Ctrl) or pUltra-SERPINB3 (Caski/B3, SW756/B3) and CXCL1/8 and S100A8/A9 mRNA expression was examined by qPCR. ( B ) Caski cells were transfected with scrambled negative control shRNA (Caski/shCtrl) or shRNAs specific SERPINB3 (Caski/shB3); SW756 cells were transduced with CRISPR control vector (SW756/CRISPR-Ctrl) or CRISPR-Cas9 for SERPINB3 knockdown (SW756/CRISPR-B3KO). The expression of CXCL1/8 and S100A8/A9 was examined by qPCR. Gene expression were normalized to GAPDH and fold changes were calculated by comparing to the expression levels in parental cells (Caski WT or SW756 WT). ( C ) Intracellular chemokine proteinexpressionin cell lysateswas measured by ELISA. The chemokine levels were normalized to total protein concentration. ( D ) Supernatant was collected from adherent cells in monolayer and chemokine secretion was measured by ELISA. Data in A-D are presentedas mean ± SEMof n = 4 independent experiments, * P < 0.05, ** P < 0.01, *** P < 0.001 using unpaired two-tailed Student’s t-test. ( E-G ) PBMC migration towards supernatant collected from cancer cells was examined by Transwell assays and the migrated PMBC populations were analyzed by flow cytometry. Fold changes were calculated as the percentage of migrated ( E ) T and myeloid cells, ( F ) T cell subsets and ( G ) myeloid cell subsets in Caski/B3 or SW756/B3 relative to Caski/Ctrl or SW756/Ctrl supernatant. Data are shown as mean ± SEM, ns, no significance; * P < 0.05, ** P < 0.01, *** P < 0.001 using two-tailed one sample T test against 1. Each dot representsthe mean of duplicate values for a single donor sample (n=7).

Journal: bioRxiv

Article Title: SCCA1/SERPINB3 promotes suppressive immune environment via STAT-dependent chemokine production, blunting the therapy-induced T cell responses

doi: 10.1101/2023.02.01.526675

Figure Lengend Snippet: ( A ) Caski and SW756 cells were transduced with pUltra vector (Caski/Ctrl, SW756/Ctrl) or pUltra-SERPINB3 (Caski/B3, SW756/B3) and CXCL1/8 and S100A8/A9 mRNA expression was examined by qPCR. ( B ) Caski cells were transfected with scrambled negative control shRNA (Caski/shCtrl) or shRNAs specific SERPINB3 (Caski/shB3); SW756 cells were transduced with CRISPR control vector (SW756/CRISPR-Ctrl) or CRISPR-Cas9 for SERPINB3 knockdown (SW756/CRISPR-B3KO). The expression of CXCL1/8 and S100A8/A9 was examined by qPCR. Gene expression were normalized to GAPDH and fold changes were calculated by comparing to the expression levels in parental cells (Caski WT or SW756 WT). ( C ) Intracellular chemokine proteinexpressionin cell lysateswas measured by ELISA. The chemokine levels were normalized to total protein concentration. ( D ) Supernatant was collected from adherent cells in monolayer and chemokine secretion was measured by ELISA. Data in A-D are presentedas mean ± SEMof n = 4 independent experiments, * P < 0.05, ** P < 0.01, *** P < 0.001 using unpaired two-tailed Student’s t-test. ( E-G ) PBMC migration towards supernatant collected from cancer cells was examined by Transwell assays and the migrated PMBC populations were analyzed by flow cytometry. Fold changes were calculated as the percentage of migrated ( E ) T and myeloid cells, ( F ) T cell subsets and ( G ) myeloid cell subsets in Caski/B3 or SW756/B3 relative to Caski/Ctrl or SW756/Ctrl supernatant. Data are shown as mean ± SEM, ns, no significance; * P < 0.05, ** P < 0.01, *** P < 0.001 using two-tailed one sample T test against 1. Each dot representsthe mean of duplicate values for a single donor sample (n=7).

Article Snippet: SERPINB3 stable expression cells were generated using pULTRA lentiviral vector (Addgene #24129) containing human SERPINB3 or pLV-C-GFPSpark vector (Sino Biological LVCV-35) containing mouse Serpinb3a GFP-tagged fusion proteins.

Techniques: Transduction, Plasmid Preparation, Expressing, Transfection, Negative Control, shRNA, CRISPR, Enzyme-linked Immunosorbent Assay, Protein Concentration, Two Tailed Test, Migration, Flow Cytometry

( A-B ) Chemokine ( A ) CXCL1 and ( B ) S100A8/A9 levels in tumor homogenates was examined by ELISA. Data was normalized to the protein concentration for each tumor homogenate and shown as mean ± SEM; n=7 for 7-day sham-LL2/mB3a and n=6 for all other groups. ( C-H ) Cumulative data from FACSanalysis show alteration of immune cell infiltration by SERPINB3 expression and radiation in LL2 tumors. The graphs represent the frequencies of ( C ) CD11b+Ly6G-Ly6Chigh Mo-MDSCs, ( D ) CD11b+Ly6G+ PMN-MDSCs, ( E ) CD11b+Ly6G-F4/80+ TAMs, ( F ) CD11b+Ly6G-F4/80+CD163+ M2 macrophages, ( G ) CD3+CD4+ T cells, and ( H ) CD3+CD8+ T cells in total tumor infiltrating leukocytes (TILs). ( I ) The ratioof CD8/Treg represented the infiltrating percentage of CD8+ T cells relative to CD4+CD25+FoxP3+ regulatory T (Treg) cells. Data are shown as mean ± SEM and each dot represents a biologically independent animal; * indicates comparisons between LL2/Ctrl and LL2/mB3a; ✝ indicates comparisons between sham-treated and RT; * P < 0.05, ** P < 0.01, *** P < 0.001 using one-way ANOVA with Tukey’s post-test for multiple comparisons.

Journal: bioRxiv

Article Title: SCCA1/SERPINB3 promotes suppressive immune environment via STAT-dependent chemokine production, blunting the therapy-induced T cell responses

doi: 10.1101/2023.02.01.526675

Figure Lengend Snippet: ( A-B ) Chemokine ( A ) CXCL1 and ( B ) S100A8/A9 levels in tumor homogenates was examined by ELISA. Data was normalized to the protein concentration for each tumor homogenate and shown as mean ± SEM; n=7 for 7-day sham-LL2/mB3a and n=6 for all other groups. ( C-H ) Cumulative data from FACSanalysis show alteration of immune cell infiltration by SERPINB3 expression and radiation in LL2 tumors. The graphs represent the frequencies of ( C ) CD11b+Ly6G-Ly6Chigh Mo-MDSCs, ( D ) CD11b+Ly6G+ PMN-MDSCs, ( E ) CD11b+Ly6G-F4/80+ TAMs, ( F ) CD11b+Ly6G-F4/80+CD163+ M2 macrophages, ( G ) CD3+CD4+ T cells, and ( H ) CD3+CD8+ T cells in total tumor infiltrating leukocytes (TILs). ( I ) The ratioof CD8/Treg represented the infiltrating percentage of CD8+ T cells relative to CD4+CD25+FoxP3+ regulatory T (Treg) cells. Data are shown as mean ± SEM and each dot represents a biologically independent animal; * indicates comparisons between LL2/Ctrl and LL2/mB3a; ✝ indicates comparisons between sham-treated and RT; * P < 0.05, ** P < 0.01, *** P < 0.001 using one-way ANOVA with Tukey’s post-test for multiple comparisons.

Article Snippet: SERPINB3 stable expression cells were generated using pULTRA lentiviral vector (Addgene #24129) containing human SERPINB3 or pLV-C-GFPSpark vector (Sino Biological LVCV-35) containing mouse Serpinb3a GFP-tagged fusion proteins.

Techniques: Enzyme-linked Immunosorbent Assay, Protein Concentration, Expressing

(A) Msk1 mRNA expression levels (qPCR) in cortex and striatum at different postnatal ages (P5, P10, P15 and P30). * P <0.05, ** P <0,01, *** P <0.001 (mean ± SEM; n=3 animal/age group; Ordinary one-way ANOVA). (B) MSK1 expression levels (WB) in cortex and striatum at different postnatal ages using specific antibodies against the C-terminal domain of MSK1. * P <0.05 (mean ± SEM; n=3 animals/age group; Ordinary one-way ANOVA). (C and F) Representative single plane confocal images of MSK1 expression pattern (green) in the somatosensory cortex and striatum of 5- and 30-day-old Vgat-IRES-CRE; Ai9-RLC tdTomato mice. Endogenous tdTomato fluorescence (red) reveals GABAergic neurons. Arrows point to cells co-expressing MSK1 and tdTomato. (D and E) Quantification of MSK1 + /tdTomato + cells and tdTomato + /MSK1 + cells in the somatosensory cortex at different postnatal ages. * P <0.05, ** P <0.01, *** P <0.001 (mean ± SEM; n=3 mice/age group, 6-8 images per animal; Ordinary one-way ANOVA). (G and H) Quantification of MSK1 + cells and tdTomato + MSK1 + cells in the striatum at different postnatal ages. **P<0.01 (mean ± SEM; n=3 mice, 6-8 images per animal; Ordinary one-way ANOVA). Scale bars = 100µm.

Journal: bioRxiv

Article Title: MSK1 expression in the GABAergic network and its relationship with striatal growth, BDNF-mediated MeCP2 phosphorylation and schizophrenia

doi: 10.1101/2024.01.23.576945

Figure Lengend Snippet: (A) Msk1 mRNA expression levels (qPCR) in cortex and striatum at different postnatal ages (P5, P10, P15 and P30). * P <0.05, ** P <0,01, *** P <0.001 (mean ± SEM; n=3 animal/age group; Ordinary one-way ANOVA). (B) MSK1 expression levels (WB) in cortex and striatum at different postnatal ages using specific antibodies against the C-terminal domain of MSK1. * P <0.05 (mean ± SEM; n=3 animals/age group; Ordinary one-way ANOVA). (C and F) Representative single plane confocal images of MSK1 expression pattern (green) in the somatosensory cortex and striatum of 5- and 30-day-old Vgat-IRES-CRE; Ai9-RLC tdTomato mice. Endogenous tdTomato fluorescence (red) reveals GABAergic neurons. Arrows point to cells co-expressing MSK1 and tdTomato. (D and E) Quantification of MSK1 + /tdTomato + cells and tdTomato + /MSK1 + cells in the somatosensory cortex at different postnatal ages. * P <0.05, ** P <0.01, *** P <0.001 (mean ± SEM; n=3 mice/age group, 6-8 images per animal; Ordinary one-way ANOVA). (G and H) Quantification of MSK1 + cells and tdTomato + MSK1 + cells in the striatum at different postnatal ages. **P<0.01 (mean ± SEM; n=3 mice, 6-8 images per animal; Ordinary one-way ANOVA). Scale bars = 100µm.

Article Snippet: The open reading frame for MSK1 was amplified by PCR from cDNA obtained from C57BL/6J WT mouse brain using the primers MSK1 BamHI-Forward, MSK1 NotI-Reverse, MSK1 NotI-myc-Reverse ( ) The PCR product was purified using an agarose gel and co-digested with BamHI and NotI restriction enzymes (New England Biolab) and directly cloned into the pLL-hSYN-hSYN-GFP vector at the BamHI and NotI restriction sites located downstream of the first hSYN promoter.

Techniques: Expressing, Fluorescence

Representative single plane confocal images of P5 to P30 barrel field area of the somatosensory cortex (SSp-bfd) of the Vgat-IRES-CRE; Ai9-RLC tdTomato mice stained with specific anti-MSK1 antibodies. Note that endogenous expression of the fluorescent reporter tdTomato labels the soma and neurites of all interneurons in the area. Note the intense staining of the MSK1 + cells at P5 and how it decreases during development as well as the number of MSK1 + cells. Arrows point to tdTomato + cells that are expressing MSK1.

Journal: bioRxiv

Article Title: MSK1 expression in the GABAergic network and its relationship with striatal growth, BDNF-mediated MeCP2 phosphorylation and schizophrenia

doi: 10.1101/2024.01.23.576945

Figure Lengend Snippet: Representative single plane confocal images of P5 to P30 barrel field area of the somatosensory cortex (SSp-bfd) of the Vgat-IRES-CRE; Ai9-RLC tdTomato mice stained with specific anti-MSK1 antibodies. Note that endogenous expression of the fluorescent reporter tdTomato labels the soma and neurites of all interneurons in the area. Note the intense staining of the MSK1 + cells at P5 and how it decreases during development as well as the number of MSK1 + cells. Arrows point to tdTomato + cells that are expressing MSK1.

Article Snippet: The open reading frame for MSK1 was amplified by PCR from cDNA obtained from C57BL/6J WT mouse brain using the primers MSK1 BamHI-Forward, MSK1 NotI-Reverse, MSK1 NotI-myc-Reverse ( ) The PCR product was purified using an agarose gel and co-digested with BamHI and NotI restriction enzymes (New England Biolab) and directly cloned into the pLL-hSYN-hSYN-GFP vector at the BamHI and NotI restriction sites located downstream of the first hSYN promoter.

Techniques: Staining, Expressing

Representative single plane confocal images of MSK1 expression in the striatum from P5 to P30 in mice expressing the reporter fluorescence protein tdTomato in GABAergic neurons. Note the dense neuronal network in the striatum during all the developmental stages and how the density of nuclei decreases with development but not MSK1 intensity. Arrows point to tdTomato + cells that are expressing MSK1.

Journal: bioRxiv

Article Title: MSK1 expression in the GABAergic network and its relationship with striatal growth, BDNF-mediated MeCP2 phosphorylation and schizophrenia

doi: 10.1101/2024.01.23.576945

Figure Lengend Snippet: Representative single plane confocal images of MSK1 expression in the striatum from P5 to P30 in mice expressing the reporter fluorescence protein tdTomato in GABAergic neurons. Note the dense neuronal network in the striatum during all the developmental stages and how the density of nuclei decreases with development but not MSK1 intensity. Arrows point to tdTomato + cells that are expressing MSK1.

Article Snippet: The open reading frame for MSK1 was amplified by PCR from cDNA obtained from C57BL/6J WT mouse brain using the primers MSK1 BamHI-Forward, MSK1 NotI-Reverse, MSK1 NotI-myc-Reverse ( ) The PCR product was purified using an agarose gel and co-digested with BamHI and NotI restriction enzymes (New England Biolab) and directly cloned into the pLL-hSYN-hSYN-GFP vector at the BamHI and NotI restriction sites located downstream of the first hSYN promoter.

Techniques: Expressing, Fluorescence

(A) IHC/DAB images showing MSK1 + cells in the brain at different stages of development (P5, P10, P15 and P30). (B) MATLAB maps showing the distribution and area of MSK1 + cells in the striatum at different postnatal ages (P5, P10, P15 and P30). Cells from the striatum have been highlighted and show variations in OD. (C) Distribution of OD values (blue – low OD, red – high OD) from striatal MSK1 + cells.

Journal: bioRxiv

Article Title: MSK1 expression in the GABAergic network and its relationship with striatal growth, BDNF-mediated MeCP2 phosphorylation and schizophrenia

doi: 10.1101/2024.01.23.576945

Figure Lengend Snippet: (A) IHC/DAB images showing MSK1 + cells in the brain at different stages of development (P5, P10, P15 and P30). (B) MATLAB maps showing the distribution and area of MSK1 + cells in the striatum at different postnatal ages (P5, P10, P15 and P30). Cells from the striatum have been highlighted and show variations in OD. (C) Distribution of OD values (blue – low OD, red – high OD) from striatal MSK1 + cells.

Article Snippet: The open reading frame for MSK1 was amplified by PCR from cDNA obtained from C57BL/6J WT mouse brain using the primers MSK1 BamHI-Forward, MSK1 NotI-Reverse, MSK1 NotI-myc-Reverse ( ) The PCR product was purified using an agarose gel and co-digested with BamHI and NotI restriction enzymes (New England Biolab) and directly cloned into the pLL-hSYN-hSYN-GFP vector at the BamHI and NotI restriction sites located downstream of the first hSYN promoter.

Techniques:

Statistical analysis of developmental changes in number, O.D. and size of MSK1 + cells in the striatum. * P <0.05, ** P <0.01, *** P <0.001. (mean ± SEM; n=3. Non-parametric Kruskal-Walli’s test followed by post hoc Bonferroni test) (A) At P30 and P15 there is a significantly higher number of MSK1 + cells than at P5 (P15 – P <0.001; P30 – P <0.000). (B) At P10 and P30, the OD of MSK1 + cells is significantly higher than at P5 (** P <0.01, *** P <0.001)). (C) The area of MSK1 + cells increases through development (** P <0.01, *** P <0.001).

Journal: bioRxiv

Article Title: MSK1 expression in the GABAergic network and its relationship with striatal growth, BDNF-mediated MeCP2 phosphorylation and schizophrenia

doi: 10.1101/2024.01.23.576945

Figure Lengend Snippet: Statistical analysis of developmental changes in number, O.D. and size of MSK1 + cells in the striatum. * P <0.05, ** P <0.01, *** P <0.001. (mean ± SEM; n=3. Non-parametric Kruskal-Walli’s test followed by post hoc Bonferroni test) (A) At P30 and P15 there is a significantly higher number of MSK1 + cells than at P5 (P15 – P <0.001; P30 – P <0.000). (B) At P10 and P30, the OD of MSK1 + cells is significantly higher than at P5 (** P <0.01, *** P <0.001)). (C) The area of MSK1 + cells increases through development (** P <0.01, *** P <0.001).

Article Snippet: The open reading frame for MSK1 was amplified by PCR from cDNA obtained from C57BL/6J WT mouse brain using the primers MSK1 BamHI-Forward, MSK1 NotI-Reverse, MSK1 NotI-myc-Reverse ( ) The PCR product was purified using an agarose gel and co-digested with BamHI and NotI restriction enzymes (New England Biolab) and directly cloned into the pLL-hSYN-hSYN-GFP vector at the BamHI and NotI restriction sites located downstream of the first hSYN promoter.

Techniques:

(A) Msk1 Exon IV KO allele removal induced by CRISPR/Cas9 (top), and genomic Sanger sequencing (bottom) of the CRISPR/Cas9 edition result. (B) Exon IV removal creates a premature stop codon in Exon V, generating Msk1 IV KO mice. (C) PCR and scheme of the genotyping of Msk1 IV KO offspring using 2 different sets of primers (102/103 and 114/115). (D) Western Blot from cortical and striatal lysates of Msk1 IV KO mice shows total absence of MSK1 when using specific monoclonal antibodies against the C-terminal domain of MSK1. (E) Quantitative PCR shows that Msk1 transcripts are significantly reduced from mRNA extracted from the striatum of P30 Msk1 IV KO mice. **P<0.01 (mean ± SEM; n=3; two tailed unpaired Student’s t test). (F and H) Representative coronal sections of wild-type and Msk1 IV KO mice immunostained for DARPP-32 at postnatal ages P30 and P60. Dashes lines indicate the boundary of the striatum, determined with the Allen Brain Atlas, considering both staining and the anatomical boundaries of the striatum. STR=Striatum, LV=Lateral Ventricle, HY=Hypothalamus, SI=Substantia Innominata, PIR=Piriform Cortex, cc=Corpus Callosum. Scale bars, 1mm. (G and I) Striatal volume estimation of Msk1 IV KO compared to wild-type mice at P30 and P60 applying Cavalierís principle. * P <0.05 (mean ± SEM; n=3 mice, 10 to 12 sections per brain; two tailed unpaired Student’s t test). (J) Representative images of 7 DIV cultured wild-type striatal neurons 5 days after transfection with a reporter plasmid for EGFP containing a control shRNA (shControl), shRNAs against MSK1 (shMSK1) or shRNAs against MSK1 plus a resistant form of MSK1 against them (shMSK1+mutMSK1). BDNF (50 ng/ml) was added 2 days after transfection. The reduced arborization caused by the shMSK1 even in the presence of BDNF is reversed by overexpression of mutMSK1. (K to N) EGFP positive neurons were analysed by fluorescence microscopy and neuronal arborization was quantified using Sholl analysis. * P <0.05, ** P <0.01, *** P <0.001. (mean ± SEM; n=14 neurons per condition. Two-way ANOVA followed by Tukeýs multiple comparisons test).

Journal: bioRxiv

Article Title: MSK1 expression in the GABAergic network and its relationship with striatal growth, BDNF-mediated MeCP2 phosphorylation and schizophrenia

doi: 10.1101/2024.01.23.576945

Figure Lengend Snippet: (A) Msk1 Exon IV KO allele removal induced by CRISPR/Cas9 (top), and genomic Sanger sequencing (bottom) of the CRISPR/Cas9 edition result. (B) Exon IV removal creates a premature stop codon in Exon V, generating Msk1 IV KO mice. (C) PCR and scheme of the genotyping of Msk1 IV KO offspring using 2 different sets of primers (102/103 and 114/115). (D) Western Blot from cortical and striatal lysates of Msk1 IV KO mice shows total absence of MSK1 when using specific monoclonal antibodies against the C-terminal domain of MSK1. (E) Quantitative PCR shows that Msk1 transcripts are significantly reduced from mRNA extracted from the striatum of P30 Msk1 IV KO mice. **P<0.01 (mean ± SEM; n=3; two tailed unpaired Student’s t test). (F and H) Representative coronal sections of wild-type and Msk1 IV KO mice immunostained for DARPP-32 at postnatal ages P30 and P60. Dashes lines indicate the boundary of the striatum, determined with the Allen Brain Atlas, considering both staining and the anatomical boundaries of the striatum. STR=Striatum, LV=Lateral Ventricle, HY=Hypothalamus, SI=Substantia Innominata, PIR=Piriform Cortex, cc=Corpus Callosum. Scale bars, 1mm. (G and I) Striatal volume estimation of Msk1 IV KO compared to wild-type mice at P30 and P60 applying Cavalierís principle. * P <0.05 (mean ± SEM; n=3 mice, 10 to 12 sections per brain; two tailed unpaired Student’s t test). (J) Representative images of 7 DIV cultured wild-type striatal neurons 5 days after transfection with a reporter plasmid for EGFP containing a control shRNA (shControl), shRNAs against MSK1 (shMSK1) or shRNAs against MSK1 plus a resistant form of MSK1 against them (shMSK1+mutMSK1). BDNF (50 ng/ml) was added 2 days after transfection. The reduced arborization caused by the shMSK1 even in the presence of BDNF is reversed by overexpression of mutMSK1. (K to N) EGFP positive neurons were analysed by fluorescence microscopy and neuronal arborization was quantified using Sholl analysis. * P <0.05, ** P <0.01, *** P <0.001. (mean ± SEM; n=14 neurons per condition. Two-way ANOVA followed by Tukeýs multiple comparisons test).

Article Snippet: The open reading frame for MSK1 was amplified by PCR from cDNA obtained from C57BL/6J WT mouse brain using the primers MSK1 BamHI-Forward, MSK1 NotI-Reverse, MSK1 NotI-myc-Reverse ( ) The PCR product was purified using an agarose gel and co-digested with BamHI and NotI restriction enzymes (New England Biolab) and directly cloned into the pLL-hSYN-hSYN-GFP vector at the BamHI and NotI restriction sites located downstream of the first hSYN promoter.

Techniques: CRISPR, Sequencing, Western Blot, Bioprocessing, Real-time Polymerase Chain Reaction, Two Tailed Test, Staining, Cell Culture, Transfection, Plasmid Preparation, Control, shRNA, Over Expression, Fluorescence, Microscopy

(A) Low power magnification of coronal sections (medial: Bregma ≈ +0.045 mm) from P60 wild type and Msk1 IV KO mice stained with anti-MSK1 antibodies (green) and DARPP-32 (red). Note the intense staining for MSK1 in the striatum in the wild type and lack of immunoreactivity in the section of the mutant mouse. (B) Examples of a brain of a wild type and a Msk1 IV KO mice at 2 months old after PFA intracardial perfusion. No differences in length and weight were found in mutant brains compared to wild type brains. (mean ± SEM; n=5 wild type mice and n=3 Msk1 IV KO mice. two tailed unpaired Student’s t test). (C) Representative images of coronal sections (rostral: Bregma ≈ +1.42 mm, medial: Bregma ≈ +0.045 mm and caudal: Bregma ≈ - 1.055 mm) of wild type and Msk1 IV KO mice immunostained for DARPP-32 and used for further striatal volume determination applying Cavalierís principle, using the Allen Brain Atlas and considering both staining and the anatomical boundaries of the striatum. (Scale bar in all images is 1mm). STR=striatum; LV=Lateral Ventricle, LS=Lateral Septum, SI=Substantia Innominata, EP=Endopiriform Cortex, HY=Hypothalamus, PIR=Piriform Cortex, cc=Corpus Callosum, int=Internal Capsule, GP=Globus Palidus, AMY=Amygdala.

Journal: bioRxiv

Article Title: MSK1 expression in the GABAergic network and its relationship with striatal growth, BDNF-mediated MeCP2 phosphorylation and schizophrenia

doi: 10.1101/2024.01.23.576945

Figure Lengend Snippet: (A) Low power magnification of coronal sections (medial: Bregma ≈ +0.045 mm) from P60 wild type and Msk1 IV KO mice stained with anti-MSK1 antibodies (green) and DARPP-32 (red). Note the intense staining for MSK1 in the striatum in the wild type and lack of immunoreactivity in the section of the mutant mouse. (B) Examples of a brain of a wild type and a Msk1 IV KO mice at 2 months old after PFA intracardial perfusion. No differences in length and weight were found in mutant brains compared to wild type brains. (mean ± SEM; n=5 wild type mice and n=3 Msk1 IV KO mice. two tailed unpaired Student’s t test). (C) Representative images of coronal sections (rostral: Bregma ≈ +1.42 mm, medial: Bregma ≈ +0.045 mm and caudal: Bregma ≈ - 1.055 mm) of wild type and Msk1 IV KO mice immunostained for DARPP-32 and used for further striatal volume determination applying Cavalierís principle, using the Allen Brain Atlas and considering both staining and the anatomical boundaries of the striatum. (Scale bar in all images is 1mm). STR=striatum; LV=Lateral Ventricle, LS=Lateral Septum, SI=Substantia Innominata, EP=Endopiriform Cortex, HY=Hypothalamus, PIR=Piriform Cortex, cc=Corpus Callosum, int=Internal Capsule, GP=Globus Palidus, AMY=Amygdala.

Article Snippet: The open reading frame for MSK1 was amplified by PCR from cDNA obtained from C57BL/6J WT mouse brain using the primers MSK1 BamHI-Forward, MSK1 NotI-Reverse, MSK1 NotI-myc-Reverse ( ) The PCR product was purified using an agarose gel and co-digested with BamHI and NotI restriction enzymes (New England Biolab) and directly cloned into the pLL-hSYN-hSYN-GFP vector at the BamHI and NotI restriction sites located downstream of the first hSYN promoter.

Techniques: Staining, Mutagenesis, Two Tailed Test

(A) Scheme of the expression vectors for individual miRNA-based shRNAs. Control miRNA-based shRNA (shControl) against β-galactosidase. pLL-shM # (shM1, shM2, shM3 and shM4) are miRNA-based shRNAs against different regions of MSK1. The plasmid pLL-shMSK1 contains a cassette with the four miRNA-based shRNAs against MSK1. The expression vector pLL-mutMSK1 ¡s a dual human synapsin-promoter vector allowing the independent expression of the fluorescent reporter protein DsRED and the protein MSK1 containing point mutations in its nucleotide sequence that confer resistant to the miRNA-based shMSK1-induced degradation. The vector pLL-shMSK1-mutMSK1 allows the expression of the cassette containing the four miRNA-based shRNAs against MSK1, the resistant form of MSK1 and the reporter fluorescent protein EGFP under the control of the promoters human synapsin. (B) Sequences of the miRNA-based shRNAs against MSK1 and the corresponding point mutations that change the nucleotide sequence but not the aminoacidic sequence to mutMSK1. (C) Western Blot showing the efficiency of each miRNA-based shRNA on HEK293-FT cells co-transfected with an expression plasmid for the murine wild-type MSK1 protein containing a myc-tag domain at the end of the 3’CDS. Note that the plasmid containing the cassette with the four miRNA-based shRNAs against MSK1 show a greater efficiency in downregulating MSK1 compared to the single miRNA-based shRNAs against MSK1. The construct expressing the shControl does not causes the reduction of the levels of MSK1myc.

Journal: bioRxiv

Article Title: MSK1 expression in the GABAergic network and its relationship with striatal growth, BDNF-mediated MeCP2 phosphorylation and schizophrenia

doi: 10.1101/2024.01.23.576945

Figure Lengend Snippet: (A) Scheme of the expression vectors for individual miRNA-based shRNAs. Control miRNA-based shRNA (shControl) against β-galactosidase. pLL-shM # (shM1, shM2, shM3 and shM4) are miRNA-based shRNAs against different regions of MSK1. The plasmid pLL-shMSK1 contains a cassette with the four miRNA-based shRNAs against MSK1. The expression vector pLL-mutMSK1 ¡s a dual human synapsin-promoter vector allowing the independent expression of the fluorescent reporter protein DsRED and the protein MSK1 containing point mutations in its nucleotide sequence that confer resistant to the miRNA-based shMSK1-induced degradation. The vector pLL-shMSK1-mutMSK1 allows the expression of the cassette containing the four miRNA-based shRNAs against MSK1, the resistant form of MSK1 and the reporter fluorescent protein EGFP under the control of the promoters human synapsin. (B) Sequences of the miRNA-based shRNAs against MSK1 and the corresponding point mutations that change the nucleotide sequence but not the aminoacidic sequence to mutMSK1. (C) Western Blot showing the efficiency of each miRNA-based shRNA on HEK293-FT cells co-transfected with an expression plasmid for the murine wild-type MSK1 protein containing a myc-tag domain at the end of the 3’CDS. Note that the plasmid containing the cassette with the four miRNA-based shRNAs against MSK1 show a greater efficiency in downregulating MSK1 compared to the single miRNA-based shRNAs against MSK1. The construct expressing the shControl does not causes the reduction of the levels of MSK1myc.

Article Snippet: The open reading frame for MSK1 was amplified by PCR from cDNA obtained from C57BL/6J WT mouse brain using the primers MSK1 BamHI-Forward, MSK1 NotI-Reverse, MSK1 NotI-myc-Reverse ( ) The PCR product was purified using an agarose gel and co-digested with BamHI and NotI restriction enzymes (New England Biolab) and directly cloned into the pLL-hSYN-hSYN-GFP vector at the BamHI and NotI restriction sites located downstream of the first hSYN promoter.

Techniques: Expressing, Control, shRNA, Plasmid Preparation, Sequencing, Western Blot, Transfection, Construct

(A and B) Quantitative Western-Blot analysis of WT and Msk1 IV KO cultured striatal neurons. (A) 1h BDNF (50 ng/mL) stimulation causes an increase in TrkB, ERK1/2 and MeCP2 S421 phosphorylation in WT cultured striatal neurons. ERK1/2 inhibition with U0126 prevents MeCP2 S421 phosphorylation. * P <0.05, ** P <0.01 (mean ± SEM; n=3; two tailed unpaired Student’s t test). (B) The absence of MSK1 prevents the BDNF-dependent MeCP2 S421 phosphorylation in cultured Msk1 IV KO striatal neurons, but not the phosphorylation of TrkB and ERK1/2. * P <0.05, ** P <0.01 (mean ± SEM; n=4; two tailed unpaired Student’s t test). (C) MSK1 and MeCP2 interact in the nucleus of HEK293-FT independently of MSK1 phosphorylation state. Lysates from HEK293-FT cells co-transfected with expression plasmids for MeCP2-HA and MSK1-myc were immunoprecipitated with anti-HA antibodies coupled to magnetic beads and western blots were performed to detect the interaction of MSK1 with MeCP2 before or after inducing MSK1 activation by PMA (200 nM; 1h). (D) Expression of MeCP2-regulated genes is also dependent of MSK1. qPCR analysis show downregulation of Gad1 , responsible of GABA production, Drd1 and Drd3 , which code for dopamine receptors, in the striatum of P60 Msk1 IV KO mice. However, transcript levels for the gene coding the GABA A receptor subunit gamma3 ( Gabrg3 ) and the dopamine receptor Drd2 are increased. * P <0.05, *** P <0.001 (mean ± SEM; n=3; two tailed unpaired Student’s t test).

Journal: bioRxiv

Article Title: MSK1 expression in the GABAergic network and its relationship with striatal growth, BDNF-mediated MeCP2 phosphorylation and schizophrenia

doi: 10.1101/2024.01.23.576945

Figure Lengend Snippet: (A and B) Quantitative Western-Blot analysis of WT and Msk1 IV KO cultured striatal neurons. (A) 1h BDNF (50 ng/mL) stimulation causes an increase in TrkB, ERK1/2 and MeCP2 S421 phosphorylation in WT cultured striatal neurons. ERK1/2 inhibition with U0126 prevents MeCP2 S421 phosphorylation. * P <0.05, ** P <0.01 (mean ± SEM; n=3; two tailed unpaired Student’s t test). (B) The absence of MSK1 prevents the BDNF-dependent MeCP2 S421 phosphorylation in cultured Msk1 IV KO striatal neurons, but not the phosphorylation of TrkB and ERK1/2. * P <0.05, ** P <0.01 (mean ± SEM; n=4; two tailed unpaired Student’s t test). (C) MSK1 and MeCP2 interact in the nucleus of HEK293-FT independently of MSK1 phosphorylation state. Lysates from HEK293-FT cells co-transfected with expression plasmids for MeCP2-HA and MSK1-myc were immunoprecipitated with anti-HA antibodies coupled to magnetic beads and western blots were performed to detect the interaction of MSK1 with MeCP2 before or after inducing MSK1 activation by PMA (200 nM; 1h). (D) Expression of MeCP2-regulated genes is also dependent of MSK1. qPCR analysis show downregulation of Gad1 , responsible of GABA production, Drd1 and Drd3 , which code for dopamine receptors, in the striatum of P60 Msk1 IV KO mice. However, transcript levels for the gene coding the GABA A receptor subunit gamma3 ( Gabrg3 ) and the dopamine receptor Drd2 are increased. * P <0.05, *** P <0.001 (mean ± SEM; n=3; two tailed unpaired Student’s t test).

Article Snippet: The open reading frame for MSK1 was amplified by PCR from cDNA obtained from C57BL/6J WT mouse brain using the primers MSK1 BamHI-Forward, MSK1 NotI-Reverse, MSK1 NotI-myc-Reverse ( ) The PCR product was purified using an agarose gel and co-digested with BamHI and NotI restriction enzymes (New England Biolab) and directly cloned into the pLL-hSYN-hSYN-GFP vector at the BamHI and NotI restriction sites located downstream of the first hSYN promoter.

Techniques: Western Blot, Cell Culture, Phospho-proteomics, Inhibition, Two Tailed Test, Transfection, Expressing, Immunoprecipitation, Magnetic Beads, Activation Assay

(A and B) Locomotor activity of adult Msk1 IV KO mice compared to control wild-type mice. (A) Msk1 IV KO mice do not show altered locomotor activity as determined by the Open Field Test. However, male mutant mice, but not females, enter more into the centre of the field and spend more time in the centre zone. (B) Rotarod test shows no motor impairment in Msk1 IV KO mice, independently of their sex. (C) Representative pictures of a nest built after 24h. Innate responses analysed by the nest building test at 4h and 24h in control and mutant male and female mice show that mutant mice have an inability to build a proper nest. (D) Three-chamber test assesses social behaviour of mutant males and females compared to their corresponding wild-type control. Mutant mice spend more time interacting with an unfamiliar conspecific mouse (sociability) or novel object (novelty) than control mice. (E) Analysis of the anxiety response assessed by the marble burying test performed during 30min. Msk1 IV KO mice buried significantly less marbles than their wild-type littermates. No differences were observed between wild-type and mutant females. (F) Depressive-like state was analysed by the immobility time of mice during the Forced swimming test. Both male and mutant females show an increased immobility during the test compared to control mice. In all cases animals were 2 to 4 months old and statistical analysis was performed with two tailed unpaired Student’s t test * P <0.05, ** P <0.01, *** P <0.001. (mean ± SEM; n= 9 to 13 mice per condition and sex).

Journal: bioRxiv

Article Title: MSK1 expression in the GABAergic network and its relationship with striatal growth, BDNF-mediated MeCP2 phosphorylation and schizophrenia

doi: 10.1101/2024.01.23.576945

Figure Lengend Snippet: (A and B) Locomotor activity of adult Msk1 IV KO mice compared to control wild-type mice. (A) Msk1 IV KO mice do not show altered locomotor activity as determined by the Open Field Test. However, male mutant mice, but not females, enter more into the centre of the field and spend more time in the centre zone. (B) Rotarod test shows no motor impairment in Msk1 IV KO mice, independently of their sex. (C) Representative pictures of a nest built after 24h. Innate responses analysed by the nest building test at 4h and 24h in control and mutant male and female mice show that mutant mice have an inability to build a proper nest. (D) Three-chamber test assesses social behaviour of mutant males and females compared to their corresponding wild-type control. Mutant mice spend more time interacting with an unfamiliar conspecific mouse (sociability) or novel object (novelty) than control mice. (E) Analysis of the anxiety response assessed by the marble burying test performed during 30min. Msk1 IV KO mice buried significantly less marbles than their wild-type littermates. No differences were observed between wild-type and mutant females. (F) Depressive-like state was analysed by the immobility time of mice during the Forced swimming test. Both male and mutant females show an increased immobility during the test compared to control mice. In all cases animals were 2 to 4 months old and statistical analysis was performed with two tailed unpaired Student’s t test * P <0.05, ** P <0.01, *** P <0.001. (mean ± SEM; n= 9 to 13 mice per condition and sex).

Article Snippet: The open reading frame for MSK1 was amplified by PCR from cDNA obtained from C57BL/6J WT mouse brain using the primers MSK1 BamHI-Forward, MSK1 NotI-Reverse, MSK1 NotI-myc-Reverse ( ) The PCR product was purified using an agarose gel and co-digested with BamHI and NotI restriction enzymes (New England Biolab) and directly cloned into the pLL-hSYN-hSYN-GFP vector at the BamHI and NotI restriction sites located downstream of the first hSYN promoter.

Techniques: Activity Assay, Control, Mutagenesis, Two Tailed Test

( a ) BTSCs were subjected to immunoblotting analysis using the antibodies indicated on the blots. wtEGFR and EGFRvIII bands are marked with * and **, respectively. ( b ) Densitometric quantification of galectin1 protein level normalized to tubulin in different BTSC lines is shown. ( c-d ) EGFR / EGFRvIII KD (si EGFR ) and control BTSCs (siCTL) were analyzed by immunoblotting as described in a. ( e-h ) BTSCs were treated with 1 or 5 µM lapatinib and galectin1 expression was assessed by immunoblotting (e-f) and immunostaining (g-h). Nuclei were stained with DAPI. Scale bar = 10 μm. ( i ) BTSCs were subjected to immunoblotting analysis using the antibodies indicated on the blots. ( j ) Pearson correlation analysis of pSTAT3-Y705 and galectin1 protein expression in different BTSCs is shown. ( k-l ) STAT3 KD (si STAT3 ) and siCTL BTSCs were analyzed by immunoblotting as described above. ( m-p ) BTSCs were subjected to immunoblotting or immunostaining following treatment with 25 or 50 µM of the STAT3 inhibitor, S3I-201. Scale bar = 10 μm. ( q-s ) EGFRvIII-expressing BTSCs were subjected to ChIP using an antibody to STAT3 or IgG control followed by qPCR using two different pairs of primers ( LGALS1 -a and LGALS1 -b). OSMR , and HPRT loci were used as positive and negative controls, respectively. ( t-u ) Luciferase reporter assay was performed in BTSC73 following KD of STAT3 using siRNA (t) or treatment with STAT3 inhibitors, 5 µM WP1066 or 50 μM S3I-201 (u). Data are presented as the mean□±□SEM, n ≥ 3. Unpaired two-tailed t -test (q, r and s); one-way ANOVA followed by Dunnett’s test (b) or Tukey’s test (t and u),*p < 0.05, **p < 0.01, ***p < 0.001. See also Figures S1 and S2.

Journal: bioRxiv

Article Title: Transcriptional Control of Brain Tumour Stem Cells by a Carbohydrate Binding Protein

doi: 10.1101/2021.04.14.439704

Figure Lengend Snippet: ( a ) BTSCs were subjected to immunoblotting analysis using the antibodies indicated on the blots. wtEGFR and EGFRvIII bands are marked with * and **, respectively. ( b ) Densitometric quantification of galectin1 protein level normalized to tubulin in different BTSC lines is shown. ( c-d ) EGFR / EGFRvIII KD (si EGFR ) and control BTSCs (siCTL) were analyzed by immunoblotting as described in a. ( e-h ) BTSCs were treated with 1 or 5 µM lapatinib and galectin1 expression was assessed by immunoblotting (e-f) and immunostaining (g-h). Nuclei were stained with DAPI. Scale bar = 10 μm. ( i ) BTSCs were subjected to immunoblotting analysis using the antibodies indicated on the blots. ( j ) Pearson correlation analysis of pSTAT3-Y705 and galectin1 protein expression in different BTSCs is shown. ( k-l ) STAT3 KD (si STAT3 ) and siCTL BTSCs were analyzed by immunoblotting as described above. ( m-p ) BTSCs were subjected to immunoblotting or immunostaining following treatment with 25 or 50 µM of the STAT3 inhibitor, S3I-201. Scale bar = 10 μm. ( q-s ) EGFRvIII-expressing BTSCs were subjected to ChIP using an antibody to STAT3 or IgG control followed by qPCR using two different pairs of primers ( LGALS1 -a and LGALS1 -b). OSMR , and HPRT loci were used as positive and negative controls, respectively. ( t-u ) Luciferase reporter assay was performed in BTSC73 following KD of STAT3 using siRNA (t) or treatment with STAT3 inhibitors, 5 µM WP1066 or 50 μM S3I-201 (u). Data are presented as the mean□±□SEM, n ≥ 3. Unpaired two-tailed t -test (q, r and s); one-way ANOVA followed by Dunnett’s test (b) or Tukey’s test (t and u),*p < 0.05, **p < 0.01, ***p < 0.001. See also Figures S1 and S2.

Article Snippet: The upstream 376 bp region of the human LGALS1 transcriptional start site was cloned into the pGL4.23 (Promega) vector to generate the LGALS1 luciferase reporter gene ( LGALS1 pGL4.23) by digesting the plasmid and the annealed primer pair using EcoRV (NEB, #R0195L) and HindIII (NEB, #R0104L) and ligating them with T4 DNA ligase (NEB, #M0202L).

Techniques: Western Blot, Expressing, Immunostaining, Staining, Luciferase, Reporter Assay, Two Tailed Test

( a-b ) Cell viability was assessed by CellTiter-Glo assay in LGALS1 CRISPR and CTL BTSCs. ( c ) Population growth curves for LGALS1 CRISPR and CTL BTSC73 are shown. ( d-f ) Cell viability assay (d-e) and population growth curves (f) of BTSC73 treated with 1 or 10 µM OTX008 are shown. ( g ) Representative images of EdU staining in LGALS1 CRISPR and CTL BTSC73 are shown. ( h ) The number of EdU positive cells was quantified using Fiji software. ( i ) EdU incorporation was analyzed by flow cytometry in LGALS1 CRISPR and CTL BTSC73. Representative scatter plots of flow cytometry analyses are shown. Data are presented as the mean□±□SEM, n = 3. Unpaired two-tailed t -test (a, b, c and h); one-way ANOVA followed by Dunnett’s test (d, e and f), **p < 0.01, ***p < 0.001. See also Figures S3 and S4.

Journal: bioRxiv

Article Title: Transcriptional Control of Brain Tumour Stem Cells by a Carbohydrate Binding Protein

doi: 10.1101/2021.04.14.439704

Figure Lengend Snippet: ( a-b ) Cell viability was assessed by CellTiter-Glo assay in LGALS1 CRISPR and CTL BTSCs. ( c ) Population growth curves for LGALS1 CRISPR and CTL BTSC73 are shown. ( d-f ) Cell viability assay (d-e) and population growth curves (f) of BTSC73 treated with 1 or 10 µM OTX008 are shown. ( g ) Representative images of EdU staining in LGALS1 CRISPR and CTL BTSC73 are shown. ( h ) The number of EdU positive cells was quantified using Fiji software. ( i ) EdU incorporation was analyzed by flow cytometry in LGALS1 CRISPR and CTL BTSC73. Representative scatter plots of flow cytometry analyses are shown. Data are presented as the mean□±□SEM, n = 3. Unpaired two-tailed t -test (a, b, c and h); one-way ANOVA followed by Dunnett’s test (d, e and f), **p < 0.01, ***p < 0.001. See also Figures S3 and S4.

Article Snippet: The upstream 376 bp region of the human LGALS1 transcriptional start site was cloned into the pGL4.23 (Promega) vector to generate the LGALS1 luciferase reporter gene ( LGALS1 pGL4.23) by digesting the plasmid and the annealed primer pair using EcoRV (NEB, #R0195L) and HindIII (NEB, #R0104L) and ligating them with T4 DNA ligase (NEB, #M0202L).

Techniques: Glo Assay, CRISPR, Viability Assay, Staining, Software, Flow Cytometry, Two Tailed Test

( a-b ) LGALS1 CRISPR or CTL BTSC73 were subcutaneously injected into SCID mice. Representative bioluminescence real-time images tracing tumour growth are shown (a). Graph represents tumour mass (b). ( c-f ) BTSC73 or BTSC147 were injected subcutaneously into SCID mice and treated with 10 mg/kg OTX008. Representative bioluminescence real-time images tracing tumour growth are shown (c, e). Graphs represent tumour mass (d, f). ( g-j ) LGALS1 CRISPR or CTL BTSC73 were intracranially injected into SCID mice. Representative bioluminescence real-time images tracing tumour growth are shown (g). Intensities of luciferase signal were quantified at different time points using Xenogen IVIS software (h). Graph represents quantification of animal weight (i). KM survival plot was graphed to evaluate mice lifespan in each group (j). Data are presented as the mean□±μSEM, n ≥ 4 mice. Unpaired two-tailed t -test (b, d, f, h and i); log-rank test (j), **p < 0.01, ***p < 0.001.

Journal: bioRxiv

Article Title: Transcriptional Control of Brain Tumour Stem Cells by a Carbohydrate Binding Protein

doi: 10.1101/2021.04.14.439704

Figure Lengend Snippet: ( a-b ) LGALS1 CRISPR or CTL BTSC73 were subcutaneously injected into SCID mice. Representative bioluminescence real-time images tracing tumour growth are shown (a). Graph represents tumour mass (b). ( c-f ) BTSC73 or BTSC147 were injected subcutaneously into SCID mice and treated with 10 mg/kg OTX008. Representative bioluminescence real-time images tracing tumour growth are shown (c, e). Graphs represent tumour mass (d, f). ( g-j ) LGALS1 CRISPR or CTL BTSC73 were intracranially injected into SCID mice. Representative bioluminescence real-time images tracing tumour growth are shown (g). Intensities of luciferase signal were quantified at different time points using Xenogen IVIS software (h). Graph represents quantification of animal weight (i). KM survival plot was graphed to evaluate mice lifespan in each group (j). Data are presented as the mean□±μSEM, n ≥ 4 mice. Unpaired two-tailed t -test (b, d, f, h and i); log-rank test (j), **p < 0.01, ***p < 0.001.

Article Snippet: The upstream 376 bp region of the human LGALS1 transcriptional start site was cloned into the pGL4.23 (Promega) vector to generate the LGALS1 luciferase reporter gene ( LGALS1 pGL4.23) by digesting the plasmid and the annealed primer pair using EcoRV (NEB, #R0195L) and HindIII (NEB, #R0104L) and ligating them with T4 DNA ligase (NEB, #M0202L).

Techniques: CRISPR, Injection, Luciferase, Software, Two Tailed Test

( a ) Volcano plot representing LGALS1 differentially regulated genes is shown. ( b-c ) GSEA analysis demonstrates enrichment for gene sets corresponding to mesenchymal (b) and proneural (c) subtypes of glioblastoma. ( d ) GSEA analysis demonstrates enrichment for gene sets corresponding to mesenchymal-like meta-module (MES1-like) signature. ( e-f ) GSEA analysis demonstrates enrichment for gene sets corresponding to recruitment of NuMA to mitotic centrosomes (e) and mitotic G2−G2/M phases (f). ( g-h ) RNA-seq data was validated by RT-qPCR in BTSC73 and BTSC147. ( i-j ) Cell cycle distribution was assessed by flow cytometry after PI staining in LGALS1 CRISPR BTSCs. Data are presented as the mean□±□SEM, n = 3. One-way ANOVA followed by Dunnett’s test (g and h); unpaired two- tailed t -test (i and j), *p < 0.05, **p < 0.01, ***p < 0.001. See also Figure S5.

Journal: bioRxiv

Article Title: Transcriptional Control of Brain Tumour Stem Cells by a Carbohydrate Binding Protein

doi: 10.1101/2021.04.14.439704

Figure Lengend Snippet: ( a ) Volcano plot representing LGALS1 differentially regulated genes is shown. ( b-c ) GSEA analysis demonstrates enrichment for gene sets corresponding to mesenchymal (b) and proneural (c) subtypes of glioblastoma. ( d ) GSEA analysis demonstrates enrichment for gene sets corresponding to mesenchymal-like meta-module (MES1-like) signature. ( e-f ) GSEA analysis demonstrates enrichment for gene sets corresponding to recruitment of NuMA to mitotic centrosomes (e) and mitotic G2−G2/M phases (f). ( g-h ) RNA-seq data was validated by RT-qPCR in BTSC73 and BTSC147. ( i-j ) Cell cycle distribution was assessed by flow cytometry after PI staining in LGALS1 CRISPR BTSCs. Data are presented as the mean□±□SEM, n = 3. One-way ANOVA followed by Dunnett’s test (g and h); unpaired two- tailed t -test (i and j), *p < 0.05, **p < 0.01, ***p < 0.001. See also Figure S5.

Article Snippet: The upstream 376 bp region of the human LGALS1 transcriptional start site was cloned into the pGL4.23 (Promega) vector to generate the LGALS1 luciferase reporter gene ( LGALS1 pGL4.23) by digesting the plasmid and the annealed primer pair using EcoRV (NEB, #R0195L) and HindIII (NEB, #R0104L) and ligating them with T4 DNA ligase (NEB, #M0202L).

Techniques: RNA Sequencing Assay, Quantitative RT-PCR, Flow Cytometry, Staining, CRISPR, Two Tailed Test

( a-d ) LGALS1 CRISPR and CTL EGFRvIII-expressing BTSCs were subjected to LDA (a-b) or ELDA (c-d). ( e-f ) EGFRvIII-expressing LGALS1 CRISPR and CTL BTSCs were subjected to clonogenicity assay performed by culturing one single cell per well. ( g-h ) BTSCs that don’t harbour the EGFRvIII mutation were electroporated with siCTL or si LGALS1 and subjected for ELDA analysis. ( i-p ) EGFRvIII-expressing BTSCs were subjected to LDA (i, j, m and n) or ELDA (k, l, o and p) following the treatment with 1 or 10 µM OTX008. ( q-t ) BTSCs that don’t harbour the EGFRvIII mutation were subjected to LDA (q-r) or ELDA (s-t) following the treatment with 1 or 10 µM OTX008. *p < 0.05, **p < 0.01, ***p < 0.001; unpaired two-tailed t -test (a, b, e and f); one-way ANOVA followed by Dunnett’s test (i, j, m and n), n = 3. Data are presented as the mean□±□SEM. See also Figure S6.

Journal: bioRxiv

Article Title: Transcriptional Control of Brain Tumour Stem Cells by a Carbohydrate Binding Protein

doi: 10.1101/2021.04.14.439704

Figure Lengend Snippet: ( a-d ) LGALS1 CRISPR and CTL EGFRvIII-expressing BTSCs were subjected to LDA (a-b) or ELDA (c-d). ( e-f ) EGFRvIII-expressing LGALS1 CRISPR and CTL BTSCs were subjected to clonogenicity assay performed by culturing one single cell per well. ( g-h ) BTSCs that don’t harbour the EGFRvIII mutation were electroporated with siCTL or si LGALS1 and subjected for ELDA analysis. ( i-p ) EGFRvIII-expressing BTSCs were subjected to LDA (i, j, m and n) or ELDA (k, l, o and p) following the treatment with 1 or 10 µM OTX008. ( q-t ) BTSCs that don’t harbour the EGFRvIII mutation were subjected to LDA (q-r) or ELDA (s-t) following the treatment with 1 or 10 µM OTX008. *p < 0.05, **p < 0.01, ***p < 0.001; unpaired two-tailed t -test (a, b, e and f); one-way ANOVA followed by Dunnett’s test (i, j, m and n), n = 3. Data are presented as the mean□±□SEM. See also Figure S6.

Article Snippet: The upstream 376 bp region of the human LGALS1 transcriptional start site was cloned into the pGL4.23 (Promega) vector to generate the LGALS1 luciferase reporter gene ( LGALS1 pGL4.23) by digesting the plasmid and the annealed primer pair using EcoRV (NEB, #R0195L) and HindIII (NEB, #R0104L) and ligating them with T4 DNA ligase (NEB, #M0202L).

Techniques: CRISPR, Expressing, Mutagenesis, Two Tailed Test

( a ) ELDA was performed following 4 Gy of IR in LGALS1 CRISPR or CTL BTSCs. ( b-c ) LGALS1 CRISPR and CTL BTSC73 were subjected to IR (8□Gy). Apoptosis analysis was performed by flow cytometry 48□h following IR using annexin V and PI double staining. Representative scatter plots of flow cytometry analyses are shown (b). The percentage of cell death (annexin V positive cells) is presented in the histogram (c), n□=□3. ( d ) Schematic diagram of the experimental procedure is shown. BTSC73 were intracranially injected into SCID mice and then treated with OTX008, 4□Gy of IR or a combination of OTX008 and IR. ( e ) Representative bioluminescence real-time images tracing tumour growth are shown, n□=□6 mice. ( f ) Coronal sections of mouse brains were stained with hematoxylin and eosin on day 22 after injection. Representative images of 3 different tumour sections are shown. Scale bar = 1□mm, scale bar (inset) = 0.2 mm. ( g ) Intensities of luciferase signal were quantified at different time points, n = 6 mice. ( h ) KM survival plot was graphed to assess animal lifespan, n□=□6 mice. ( i ) Survival extension of mice bearing BTSC-derived tumours treated with OTX008, IR, or OTX008 + IR relative to those treated with the vehicle control. Data are presented as the mean□±□SEM. One-way ANOVA followed by Tukey’s test (c and i); log-rank test (h), *p < 0.05, **p < 0.01, ***p < 0.001.

Journal: bioRxiv

Article Title: Transcriptional Control of Brain Tumour Stem Cells by a Carbohydrate Binding Protein

doi: 10.1101/2021.04.14.439704

Figure Lengend Snippet: ( a ) ELDA was performed following 4 Gy of IR in LGALS1 CRISPR or CTL BTSCs. ( b-c ) LGALS1 CRISPR and CTL BTSC73 were subjected to IR (8□Gy). Apoptosis analysis was performed by flow cytometry 48□h following IR using annexin V and PI double staining. Representative scatter plots of flow cytometry analyses are shown (b). The percentage of cell death (annexin V positive cells) is presented in the histogram (c), n□=□3. ( d ) Schematic diagram of the experimental procedure is shown. BTSC73 were intracranially injected into SCID mice and then treated with OTX008, 4□Gy of IR or a combination of OTX008 and IR. ( e ) Representative bioluminescence real-time images tracing tumour growth are shown, n□=□6 mice. ( f ) Coronal sections of mouse brains were stained with hematoxylin and eosin on day 22 after injection. Representative images of 3 different tumour sections are shown. Scale bar = 1□mm, scale bar (inset) = 0.2 mm. ( g ) Intensities of luciferase signal were quantified at different time points, n = 6 mice. ( h ) KM survival plot was graphed to assess animal lifespan, n□=□6 mice. ( i ) Survival extension of mice bearing BTSC-derived tumours treated with OTX008, IR, or OTX008 + IR relative to those treated with the vehicle control. Data are presented as the mean□±□SEM. One-way ANOVA followed by Tukey’s test (c and i); log-rank test (h), *p < 0.05, **p < 0.01, ***p < 0.001.

Article Snippet: The upstream 376 bp region of the human LGALS1 transcriptional start site was cloned into the pGL4.23 (Promega) vector to generate the LGALS1 luciferase reporter gene ( LGALS1 pGL4.23) by digesting the plasmid and the annealed primer pair using EcoRV (NEB, #R0195L) and HindIII (NEB, #R0104L) and ligating them with T4 DNA ligase (NEB, #M0202L).

Techniques: CRISPR, Flow Cytometry, Double Staining, Injection, Staining, Luciferase, Derivative Assay

( a ) LGALS1 -differentially regulated genes were subjected to enrichment analysis of TF binding motifs using oPOSSUM-3 software. ( b ) Volcano plot representing the HOXA5 target genes among the LGALS1 -differentially-regulated genes is shown. ( c ) BTSCs were analyzed by immunoblotting using the antibodies indicated on the blots. ( d ) Pearson correlation analysis of HOXA5 and galectin1 protein expression is shown. ( e ) KM survival plot describing the association between LGALS1 and HOXA5 expression and the survival of glioblastoma patients is shown. ( f ) Relative positions of HOXA5 ChIP-seq peaks to the adjacent TSS of LGALS1 -differentially regulated genes are shown. The x-axis indicates the distance between peak centers and the TSS of adjacent LGALS1 -differentially regulated genes. The y-axis denotes the expression ratios (log2) of the LGALS1 -differentially regulated gene. Circle size indicates HOXA5 peak height, and color denotes the conservation score of HOXA5 peaks. ( g-h ) HOXA5 KD (si HOXA5 ) and siCTL BTSCs were subjected to RT-qPCR analysis. ( i ) ELDA was performed following 4LGy of IR in si HOXA5 vs. siCTL. ( j - m ) Endogenous Co-IP experiments were performed in different BTSC lines using an anti-HOXA5 antibody, followed by immunoblotting with galectin1 and HOXA5 antibodies. ( n ) Co-IP experiment was performed using anti-FLAG antibody, followed by immunoblotting with anti-FLAG and anti-HOXA5 antibodies. ( o - r ) PLA of galectin1 and HOXA5 were performed in different BTSC lines. Primary antibodies were omitted for the controls. Nuclei were stained with DAPI. Scale bar = 10 μm. ( s ) LGALS1 CRISPR and CTL BTSC73 were subjected to ChIP using an antibody to HOXA5 followed by qPCR for HOXA5 candidate target genes. HBB locus was used as a negative control. ( t-u ) KM survival plot describing the association between LGALS1 and HOXA5 expression and the survival of glioblastoma patients treated with radiotherapy (microarray G4502A Agilent, level 3, n = 489). Data are presented as the meanL±LSEM, n = 3. Log-rank test (e, t and u); one-way ANOVA followed by Dunnett’s test (g and h); unpaired two-tailed t -test (s). *p < 0.05, **p < 0.01, ***p < 0.001. See also Figure S7.

Journal: bioRxiv

Article Title: Transcriptional Control of Brain Tumour Stem Cells by a Carbohydrate Binding Protein

doi: 10.1101/2021.04.14.439704

Figure Lengend Snippet: ( a ) LGALS1 -differentially regulated genes were subjected to enrichment analysis of TF binding motifs using oPOSSUM-3 software. ( b ) Volcano plot representing the HOXA5 target genes among the LGALS1 -differentially-regulated genes is shown. ( c ) BTSCs were analyzed by immunoblotting using the antibodies indicated on the blots. ( d ) Pearson correlation analysis of HOXA5 and galectin1 protein expression is shown. ( e ) KM survival plot describing the association between LGALS1 and HOXA5 expression and the survival of glioblastoma patients is shown. ( f ) Relative positions of HOXA5 ChIP-seq peaks to the adjacent TSS of LGALS1 -differentially regulated genes are shown. The x-axis indicates the distance between peak centers and the TSS of adjacent LGALS1 -differentially regulated genes. The y-axis denotes the expression ratios (log2) of the LGALS1 -differentially regulated gene. Circle size indicates HOXA5 peak height, and color denotes the conservation score of HOXA5 peaks. ( g-h ) HOXA5 KD (si HOXA5 ) and siCTL BTSCs were subjected to RT-qPCR analysis. ( i ) ELDA was performed following 4LGy of IR in si HOXA5 vs. siCTL. ( j - m ) Endogenous Co-IP experiments were performed in different BTSC lines using an anti-HOXA5 antibody, followed by immunoblotting with galectin1 and HOXA5 antibodies. ( n ) Co-IP experiment was performed using anti-FLAG antibody, followed by immunoblotting with anti-FLAG and anti-HOXA5 antibodies. ( o - r ) PLA of galectin1 and HOXA5 were performed in different BTSC lines. Primary antibodies were omitted for the controls. Nuclei were stained with DAPI. Scale bar = 10 μm. ( s ) LGALS1 CRISPR and CTL BTSC73 were subjected to ChIP using an antibody to HOXA5 followed by qPCR for HOXA5 candidate target genes. HBB locus was used as a negative control. ( t-u ) KM survival plot describing the association between LGALS1 and HOXA5 expression and the survival of glioblastoma patients treated with radiotherapy (microarray G4502A Agilent, level 3, n = 489). Data are presented as the meanL±LSEM, n = 3. Log-rank test (e, t and u); one-way ANOVA followed by Dunnett’s test (g and h); unpaired two-tailed t -test (s). *p < 0.05, **p < 0.01, ***p < 0.001. See also Figure S7.

Article Snippet: The upstream 376 bp region of the human LGALS1 transcriptional start site was cloned into the pGL4.23 (Promega) vector to generate the LGALS1 luciferase reporter gene ( LGALS1 pGL4.23) by digesting the plasmid and the annealed primer pair using EcoRV (NEB, #R0195L) and HindIII (NEB, #R0104L) and ligating them with T4 DNA ligase (NEB, #M0202L).

Techniques: Binding Assay, Software, Western Blot, Expressing, ChIP-sequencing, Quantitative RT-PCR, Co-Immunoprecipitation Assay, Staining, CRISPR, Negative Control, Microarray, Two Tailed Test

Circadian rhythmicity in Dbp mRna was abolished in Klf9 and Klf13 double knockout ht22 cells. We created single and double knockout cells using CRisPR/Cas9 genome editing. We plated cells at equal densities, treated with 1 μM CORt for 1 h at 6-h intervals through 60 h to synchronize circadian gene expression, and then all cells were harvested together at 66 h for analysis of Dbp mRna by real-time quantitative polymerase chain reaction. We analyzed circadian rhythmicity using CircWave software. the ht22 parent cell line (wild type) showed statistically significant circadian oscillation in Dbp mRna. Mutation of Klf9 or Klf13 alone did not affect the Dbp mRna rhythm. By contrast, regular oscillations in Dbp mRna were abolished in the double knockout cells. each point represents the mean ± seM (n = 4/treatment).

Journal: Journal of biological rhythms

Article Title: The Paralogous Krüppel-like Factors 9 and 13 Regulate the Mammalian Cellular Circadian Clock Output Gene Dbp

doi: 10.1177/0748730420913205

Figure Lengend Snippet: Circadian rhythmicity in Dbp mRna was abolished in Klf9 and Klf13 double knockout ht22 cells. We created single and double knockout cells using CRisPR/Cas9 genome editing. We plated cells at equal densities, treated with 1 μM CORt for 1 h at 6-h intervals through 60 h to synchronize circadian gene expression, and then all cells were harvested together at 66 h for analysis of Dbp mRna by real-time quantitative polymerase chain reaction. We analyzed circadian rhythmicity using CircWave software. the ht22 parent cell line (wild type) showed statistically significant circadian oscillation in Dbp mRna. Mutation of Klf9 or Klf13 alone did not affect the Dbp mRna rhythm. By contrast, regular oscillations in Dbp mRna were abolished in the double knockout cells. each point represents the mean ± seM (n = 4/treatment).

Article Snippet: To construct the pcDNA4:TO- Klf13 expression vector, we used pCMV-Entry- Klf13 (MR224297; OriGene, Rockville, MD) as template to PCR amplify the Klf13 open reading frame, then we directionally subcloned this DNA fragment into the pCDNA4:TO vector (Invitrogen, Carlsbad, CA; in the absence of the tet repressor, this is a constitutive expression vector).

Techniques: Double Knockout, CRISPR, Gene Expression, Real-time Polymerase Chain Reaction, Software, Mutagenesis

Circadian clock and clock-output genes are genomic targets of KLF13 in ht22 cells and in mouse hippocampus; KLF13 may regulate multiple components of the cellular circadian clock. (a) Genome browser tracks (University of California, santa Cruz) showing the location of KLF13 peaks at clock and clock-output genes identified by chromatin-streptavidin precipitation followed by deep sequencing in ht22 cells. Black boxes below the tracks indicate exons, with the direction of transcription 5′→3′, left to right. Gray boxes indicate locations of CLOCK ChiP-seq peaks identified in mouse liver by Yoshitane and colleagues (2014). (B) KLF13 associates in chromatin from mouse hippocampus at Dbp, Tef, and Wee1 genes, analyzed by chromatin immunoprecipitation assay. asterisks indicate statistically significant differences between antiserum to KLF13 and normal immunoglobulin G analyzed by unpaired student’s t test (p < 0.05). (C) Forced expression of Klf13 represses baseline and CLOCK+BMaL1-dependent activation of the full-length Dbp reporter. We co-transfected heK293 cells with the psFV-Dbp-luc reporter vector with or without varying amounts of the pcDna4:tO-Klf13 expression vector and with or without pshuttle-Clock plus pshuttle-Bmal1. We analyzed reporter activity by dual luciferase assay. Bars represent the mean ± seM (n = 4 wells/treatment; –Clock+Bmal1: F3,12 = 6.371, p = 0.008; +Clock+Bmal1: F3,12 = 136.637, p < 0.0001; analysis of variance; the experiment was repeated twice with similar results). Means with the same letter are not significantly different (p < 0.05, Fisher’s least significant difference post hoc test). Co-transfection of Clock and Bmal1 expression vectors activated transcription by the reporter in the absence of pcDna4:tO-Klf13 (0 dose control; p < 0.0001, unpaired student’s t test).

Journal: Journal of biological rhythms

Article Title: The Paralogous Krüppel-like Factors 9 and 13 Regulate the Mammalian Cellular Circadian Clock Output Gene Dbp

doi: 10.1177/0748730420913205

Figure Lengend Snippet: Circadian clock and clock-output genes are genomic targets of KLF13 in ht22 cells and in mouse hippocampus; KLF13 may regulate multiple components of the cellular circadian clock. (a) Genome browser tracks (University of California, santa Cruz) showing the location of KLF13 peaks at clock and clock-output genes identified by chromatin-streptavidin precipitation followed by deep sequencing in ht22 cells. Black boxes below the tracks indicate exons, with the direction of transcription 5′→3′, left to right. Gray boxes indicate locations of CLOCK ChiP-seq peaks identified in mouse liver by Yoshitane and colleagues (2014). (B) KLF13 associates in chromatin from mouse hippocampus at Dbp, Tef, and Wee1 genes, analyzed by chromatin immunoprecipitation assay. asterisks indicate statistically significant differences between antiserum to KLF13 and normal immunoglobulin G analyzed by unpaired student’s t test (p < 0.05). (C) Forced expression of Klf13 represses baseline and CLOCK+BMaL1-dependent activation of the full-length Dbp reporter. We co-transfected heK293 cells with the psFV-Dbp-luc reporter vector with or without varying amounts of the pcDna4:tO-Klf13 expression vector and with or without pshuttle-Clock plus pshuttle-Bmal1. We analyzed reporter activity by dual luciferase assay. Bars represent the mean ± seM (n = 4 wells/treatment; –Clock+Bmal1: F3,12 = 6.371, p = 0.008; +Clock+Bmal1: F3,12 = 136.637, p < 0.0001; analysis of variance; the experiment was repeated twice with similar results). Means with the same letter are not significantly different (p < 0.05, Fisher’s least significant difference post hoc test). Co-transfection of Clock and Bmal1 expression vectors activated transcription by the reporter in the absence of pcDna4:tO-Klf13 (0 dose control; p < 0.0001, unpaired student’s t test).

Article Snippet: To construct the pcDNA4:TO- Klf13 expression vector, we used pCMV-Entry- Klf13 (MR224297; OriGene, Rockville, MD) as template to PCR amplify the Klf13 open reading frame, then we directionally subcloned this DNA fragment into the pCDNA4:TO vector (Invitrogen, Carlsbad, CA; in the absence of the tet repressor, this is a constitutive expression vector).

Techniques: Sequencing, ChIP-sequencing, Chromatin Immunoprecipitation, Expressing, Activation Assay, Transfection, Plasmid Preparation, Activity Assay, Luciferase, Cotransfection, Control

Journal: eLife

Article Title: Cyclin-dependent kinase 5 (CDK5) regulates the circadian clock

doi: 10.7554/eLife.50925

Figure Lengend Snippet:

Article Snippet: Transfected construct ( M. musculus ) , Sh RNA scramble , Origene , Cat. #: TR30021 , .

Techniques: Mutagenesis, CRISPR, Transfection, Construct, Diagnostic Assay, Recombinant, Cloning, Protease Inhibitor, Software, Fluorescence

a , Eight-week-old C57BL/6J mice were injected with 5×10 11 GC of AAV-CRISPR and 1×10 11 GC of an AAV-Donor containing the promoterless coding sequences of human FAH (selectable marker) and FIX or 6×10 11 GC of AAV-GFP as control. Mice were injected with Fah -siRNA (3 mg/kg or saline as control) every 4 weeks until 12 weeks post-AAV injection. Blood was collected at time 0 and every two to four weeks and mice were sacrificed at 52 weeks post AAV-injection. Created with BioRender.com. b , Human FIX ELISA in plasma samples. c , Representative immunohistochemistry staining of 2A-tagged FAH (FAH-2A), hematoxylin and eosin (H&E) and Fah in the liver. Scale bar is 100 µm. Data are expressed as mean ± s.d. (n= 3 Control and 9 Unselected and Repair Drive mice) with significance determined by two-way ANOVA followed by Tukey test. **** p<0.0001 Repair Drive vs. Control and Unselected mice.

Journal: bioRxiv

Article Title: In vivo expansion of gene-targeted hepatocytes through transient inhibition of an essential gene

doi: 10.1101/2023.07.26.550728

Figure Lengend Snippet: a , Eight-week-old C57BL/6J mice were injected with 5×10 11 GC of AAV-CRISPR and 1×10 11 GC of an AAV-Donor containing the promoterless coding sequences of human FAH (selectable marker) and FIX or 6×10 11 GC of AAV-GFP as control. Mice were injected with Fah -siRNA (3 mg/kg or saline as control) every 4 weeks until 12 weeks post-AAV injection. Blood was collected at time 0 and every two to four weeks and mice were sacrificed at 52 weeks post AAV-injection. Created with BioRender.com. b , Human FIX ELISA in plasma samples. c , Representative immunohistochemistry staining of 2A-tagged FAH (FAH-2A), hematoxylin and eosin (H&E) and Fah in the liver. Scale bar is 100 µm. Data are expressed as mean ± s.d. (n= 3 Control and 9 Unselected and Repair Drive mice) with significance determined by two-way ANOVA followed by Tukey test. **** p<0.0001 Repair Drive vs. Control and Unselected mice.

Article Snippet: Human FIX was measured in 1:16.7 diluted plasma by using Factor IX Human SimpleStep ELISA Kit (ab188393, Abcam), following the manufacturer’s protocol.

Techniques: Injection, CRISPR, Marker, Control, Saline, Enzyme-linked Immunosorbent Assay, Clinical Proteomics, Immunohistochemistry, Staining

(A) Ter119 negative cells and Ter119 positive erythroid cells were purified from wild-type mouse bone marrow cells. G4 levels were tested by flow cytometry using the BG4 antibody that specifically recognizes G4. Quantification is on the right. (B) Bone marrow lineage-negative cells were cultured in Epo medium for 2 days. G4 levels were tested on different days using flow cytometry by the BG4 antibody. Quantification is on the right. (C) CD34+ human HSPCs were cultured in Epo medium for 21 days. The levels of G4 were measured by flow cytometry as in B at the indicated time. Cells at day 7, 14, and 21 represent proerythroblasts, polychromatic to orthochromatic erythroblasts, and orthochromatic to mature red blood cells, respectively. (D) Flow cytometric assays of G4 levels in the indicated bone marrow lineage cells purified from wild-type mice. (E) Quantification of D. (F) Gating strategy of various erythroblasts. Populations I to VI represent proerythroblasts, basophilic erythroblasts, polychromatic erythroblasts, orthochromatic erythroblasts, late orthochromatic to reticulocytes, and mature red blood cells, respectively. (G-H) Flow cytometric assay of G4 level in bone marrow erythroid populations I (G) and V (H) from the indicated mice. Quantification is on the right. (I) Bone marrow lineage negative cells from the indicated mice were cultured in Epo medium for 2 days. G4 levels on different days were measured by flow cytometry using BG4 antibody. Quantification is below the histogram. (J) CD34+ cells were transduced with lentiviral vectors expressing indicated sgRNAs and Cas9. Cells were then harvested for Western blotting of the indicated proteins at day 9 in culture. (K) Quantitative analyses of G4 levels in cells from J using flow cytometric assays. (L) Quantitative analyses of cell death in cells from J using flow cytometric assays. The dead cells are defined as propidium iodide and annexin V double positive. (M) Quantitative analyses of G4 levels in bone marrow mononuclear cells from the patient with DDX41 mutated MDS. All the error bars represent the SEM of the mean. The comparison between two groups was evaluated with 2 tailed t tests, and the comparison among multiple groups was evaluated with 1-way ANOVA tests. * p<0.05, **p<0.01, ***p<0.001, and ****p<0.0001. ns: not significant.

Journal: bioRxiv

Article Title: DDX41 dissolves G-quadruplexes to maintain erythroid genome integrity and prevent cGAS-mediated cell death

doi: 10.1101/2024.10.14.617891

Figure Lengend Snippet: (A) Ter119 negative cells and Ter119 positive erythroid cells were purified from wild-type mouse bone marrow cells. G4 levels were tested by flow cytometry using the BG4 antibody that specifically recognizes G4. Quantification is on the right. (B) Bone marrow lineage-negative cells were cultured in Epo medium for 2 days. G4 levels were tested on different days using flow cytometry by the BG4 antibody. Quantification is on the right. (C) CD34+ human HSPCs were cultured in Epo medium for 21 days. The levels of G4 were measured by flow cytometry as in B at the indicated time. Cells at day 7, 14, and 21 represent proerythroblasts, polychromatic to orthochromatic erythroblasts, and orthochromatic to mature red blood cells, respectively. (D) Flow cytometric assays of G4 levels in the indicated bone marrow lineage cells purified from wild-type mice. (E) Quantification of D. (F) Gating strategy of various erythroblasts. Populations I to VI represent proerythroblasts, basophilic erythroblasts, polychromatic erythroblasts, orthochromatic erythroblasts, late orthochromatic to reticulocytes, and mature red blood cells, respectively. (G-H) Flow cytometric assay of G4 level in bone marrow erythroid populations I (G) and V (H) from the indicated mice. Quantification is on the right. (I) Bone marrow lineage negative cells from the indicated mice were cultured in Epo medium for 2 days. G4 levels on different days were measured by flow cytometry using BG4 antibody. Quantification is below the histogram. (J) CD34+ cells were transduced with lentiviral vectors expressing indicated sgRNAs and Cas9. Cells were then harvested for Western blotting of the indicated proteins at day 9 in culture. (K) Quantitative analyses of G4 levels in cells from J using flow cytometric assays. (L) Quantitative analyses of cell death in cells from J using flow cytometric assays. The dead cells are defined as propidium iodide and annexin V double positive. (M) Quantitative analyses of G4 levels in bone marrow mononuclear cells from the patient with DDX41 mutated MDS. All the error bars represent the SEM of the mean. The comparison between two groups was evaluated with 2 tailed t tests, and the comparison among multiple groups was evaluated with 1-way ANOVA tests. * p<0.05, **p<0.01, ***p<0.001, and ****p<0.0001. ns: not significant.

Article Snippet: The sgRNAs targeting DDX41 or scrambled sgRNA were cloned into the lentiviral vector lentiCRISPR v2 (Addgene, #52961, encoding Cas9) using the previously reported protocol .

Techniques: Purification, Flow Cytometry, Cell Culture, Transduction, Expressing, Western Blot, Comparison

(A) Epo medium-cultured mouse bone marrow lineage negative HSPCs were treated with 1 μM PDS for the indicated time. Immunofluorescence assays of γ-H2AX were performed, and representative images of the erythroid cells were presented. Scale bar: 5 μm. (B) Flow cytometry assay of the cells in A. (C) Statistical quantification of γH2AX signals in B. (D) Epo medium-cultured mouse bone marrow lineage negative HSPCs were cultured for 1 day, followed by the treatment of 1 μM PDS for 6 hours. Quantitative RT-PCR analyses of indicated ribosome RNAs were performed using different primer sets. (E) Western blotting assays of indicated in cells from D. Actin was used as a loading control. (F) Same as D except that bone marrow lineage negative HSPCs from HBBCre:Ddx41 fl/fl mouse were cultured for 1 day before the quantitative RT-PCR assays. (G) Western blotting assays of the indicated proteins in F. Cells from both day 1 and day 2 cultured cells were analyzed. (H) CD34+ cells were transduced with lentiviral vectors expressing indicated sgRNAs and Cas9. Cells were then harvested for Western blotting of the indicated proteins at day 9 in culture. (I) Immunohistochemical stains of p53 in bone marrow core biopsies from the patient in normal individual. Scale bar: 100 μm. (J) Quantification of γ-H2AX in bone marrow mononuclear cells from the patient in I and 2 control individuals. All the error bars represent the SEM of the mean. The comparison between two groups was evaluated with 2 tailed t tests, and the comparison among multiple groups was evaluated with 1-way ANOVA tests. * p<0.05, **p<0.01, ns: not significant.

Journal: bioRxiv

Article Title: DDX41 dissolves G-quadruplexes to maintain erythroid genome integrity and prevent cGAS-mediated cell death

doi: 10.1101/2024.10.14.617891

Figure Lengend Snippet: (A) Epo medium-cultured mouse bone marrow lineage negative HSPCs were treated with 1 μM PDS for the indicated time. Immunofluorescence assays of γ-H2AX were performed, and representative images of the erythroid cells were presented. Scale bar: 5 μm. (B) Flow cytometry assay of the cells in A. (C) Statistical quantification of γH2AX signals in B. (D) Epo medium-cultured mouse bone marrow lineage negative HSPCs were cultured for 1 day, followed by the treatment of 1 μM PDS for 6 hours. Quantitative RT-PCR analyses of indicated ribosome RNAs were performed using different primer sets. (E) Western blotting assays of indicated in cells from D. Actin was used as a loading control. (F) Same as D except that bone marrow lineage negative HSPCs from HBBCre:Ddx41 fl/fl mouse were cultured for 1 day before the quantitative RT-PCR assays. (G) Western blotting assays of the indicated proteins in F. Cells from both day 1 and day 2 cultured cells were analyzed. (H) CD34+ cells were transduced with lentiviral vectors expressing indicated sgRNAs and Cas9. Cells were then harvested for Western blotting of the indicated proteins at day 9 in culture. (I) Immunohistochemical stains of p53 in bone marrow core biopsies from the patient in normal individual. Scale bar: 100 μm. (J) Quantification of γ-H2AX in bone marrow mononuclear cells from the patient in I and 2 control individuals. All the error bars represent the SEM of the mean. The comparison between two groups was evaluated with 2 tailed t tests, and the comparison among multiple groups was evaluated with 1-way ANOVA tests. * p<0.05, **p<0.01, ns: not significant.

Article Snippet: The sgRNAs targeting DDX41 or scrambled sgRNA were cloned into the lentiviral vector lentiCRISPR v2 (Addgene, #52961, encoding Cas9) using the previously reported protocol .

Techniques: Cell Culture, Immunofluorescence, Flow Cytometry, Quantitative RT-PCR, Western Blot, Control, Transduction, Expressing, Immunohistochemical staining, Comparison

(A) Representative wide-field picture and H&E stains of bone marrow organoid in culture. (B) Whole-mount 3D imaging of the organoids. Imaris was used for cell surface rendering. Organoids were stained with indicated antibodies and subsequently imaged using a laser scanning confocal platform. (C) Confocal immunofluorescence assays of erythroid islands in the iPSC-derived bone marrow organoids (left) and a primary human bone marrow biopsy (right). CD71 was labeled with green for organoids and magenta for primary bone marrow. DAPI: blue. (D) Flow cytometry assays of the organoids using indicated antibodies for various lineages. (E) 10,000 CellVue-labeled donor CD34+ HSPCs were co-incubated with iPSC-derived bone marrow organoids for 3 days in each well of a 96-well plate, followed by an immunofluorescence assay. Representative pictures show the engraftment of donor hematopoietic cells into the organoid. Green, red, and blue represent CD71, CellVue, and DAPI-positive nuclei, respectively. The arrow points to an engrafted CellVue positive cell expressing CD71. (F) Flow cytometry of the organoids using indicated antibodies for various lineages of the engrafted cells in organoids from E. (G) Same as E, except the donor CD34+ cells were transduced with lentiviral vectors expressing Cas9 and indicated sgRNAs before co-incubation. After 3 days, the cells were collected for flow cytometric assays of erythroid and myeloid differentiation of CellVue-positive donor hematopoietic cells and negative iPSC-derived hematopoietic cells. Each data point represents cells combined from 10 organoids. The comparison was evaluated with 1-way ANOVA tests. * p<0.05, **p<0.01. (H) Schematic model of the function of DDX41 during erythropoiesis. The diagram is generated through BioRender.

Journal: bioRxiv

Article Title: DDX41 dissolves G-quadruplexes to maintain erythroid genome integrity and prevent cGAS-mediated cell death

doi: 10.1101/2024.10.14.617891

Figure Lengend Snippet: (A) Representative wide-field picture and H&E stains of bone marrow organoid in culture. (B) Whole-mount 3D imaging of the organoids. Imaris was used for cell surface rendering. Organoids were stained with indicated antibodies and subsequently imaged using a laser scanning confocal platform. (C) Confocal immunofluorescence assays of erythroid islands in the iPSC-derived bone marrow organoids (left) and a primary human bone marrow biopsy (right). CD71 was labeled with green for organoids and magenta for primary bone marrow. DAPI: blue. (D) Flow cytometry assays of the organoids using indicated antibodies for various lineages. (E) 10,000 CellVue-labeled donor CD34+ HSPCs were co-incubated with iPSC-derived bone marrow organoids for 3 days in each well of a 96-well plate, followed by an immunofluorescence assay. Representative pictures show the engraftment of donor hematopoietic cells into the organoid. Green, red, and blue represent CD71, CellVue, and DAPI-positive nuclei, respectively. The arrow points to an engrafted CellVue positive cell expressing CD71. (F) Flow cytometry of the organoids using indicated antibodies for various lineages of the engrafted cells in organoids from E. (G) Same as E, except the donor CD34+ cells were transduced with lentiviral vectors expressing Cas9 and indicated sgRNAs before co-incubation. After 3 days, the cells were collected for flow cytometric assays of erythroid and myeloid differentiation of CellVue-positive donor hematopoietic cells and negative iPSC-derived hematopoietic cells. Each data point represents cells combined from 10 organoids. The comparison was evaluated with 1-way ANOVA tests. * p<0.05, **p<0.01. (H) Schematic model of the function of DDX41 during erythropoiesis. The diagram is generated through BioRender.

Article Snippet: The sgRNAs targeting DDX41 or scrambled sgRNA were cloned into the lentiviral vector lentiCRISPR v2 (Addgene, #52961, encoding Cas9) using the previously reported protocol .

Techniques: Imaging, Staining, Immunofluorescence, Derivative Assay, Labeling, Flow Cytometry, Incubation, Expressing, Transduction, Comparison, Generated

( A ) Schematic outline of the kinome shRNA and whole genome CRISPR-Cas9 screens. ( B ) Volcano plot representing gene summary of MAGeCK analysis of the kinome shRNA screens in KB2P-1.21 cells treated with olaparib. ( C ) Volcano plot representing gene summary of MAGeCK analysis of the whole genome CRISPR-Cas9 screens in RPE1-hTERT BRCA1 -/- ;p53 -/- cells treated with 2 Gy IR. ( D, E ) Growth assays in KB2P-3.4 (D) or KB1P-G3 (E) Taok1 -/- cell lines treated with the indicated doses of olaparib (D) or IR (E). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( F ) Representative images of growth assays in KB1P-G3 NT, Taok1 -/- with empty rescue construct (pOZ-empty) or Taok1 full cDNA rescue construct (pOZ-Taok1) treated with the indicated doses of olaparib. ( G ) Kaplan-Meier survival curve of mice transplanted with KB1P-4S organoids with NT or Taok1 sgRNAs and treated with olaparib. Statistical analysis was performed with the log-rank test. ( H, I ) Growth assays in KB1P-G3 Taok1 -/- cell lines complemented with indicated rescue construct. Cells were treated with indicated doses of olaparib (H) or IR (I). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test.

Journal: bioRxiv

Article Title: TAOK1 regulates chemo- and radiosensitivity in BRCA1/2-deficient tumors

doi: 10.1101/2025.10.14.682031

Figure Lengend Snippet: ( A ) Schematic outline of the kinome shRNA and whole genome CRISPR-Cas9 screens. ( B ) Volcano plot representing gene summary of MAGeCK analysis of the kinome shRNA screens in KB2P-1.21 cells treated with olaparib. ( C ) Volcano plot representing gene summary of MAGeCK analysis of the whole genome CRISPR-Cas9 screens in RPE1-hTERT BRCA1 -/- ;p53 -/- cells treated with 2 Gy IR. ( D, E ) Growth assays in KB2P-3.4 (D) or KB1P-G3 (E) Taok1 -/- cell lines treated with the indicated doses of olaparib (D) or IR (E). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( F ) Representative images of growth assays in KB1P-G3 NT, Taok1 -/- with empty rescue construct (pOZ-empty) or Taok1 full cDNA rescue construct (pOZ-Taok1) treated with the indicated doses of olaparib. ( G ) Kaplan-Meier survival curve of mice transplanted with KB1P-4S organoids with NT or Taok1 sgRNAs and treated with olaparib. Statistical analysis was performed with the log-rank test. ( H, I ) Growth assays in KB1P-G3 Taok1 -/- cell lines complemented with indicated rescue construct. Cells were treated with indicated doses of olaparib (H) or IR (I). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test.

Article Snippet: For CRISPR-Cas9 editing of human MDA-MB-436 cell line, NT sgRNA and TAOK1 sgRNAs were cloned into pX330 vector (Addgene, #42230) with puromycin resistance cassette.

Techniques: shRNA, CRISPR, Construct

(A) Volcano plot representing gene summary of MAGeCK analysis of the whole genome CRISPR-Cas9 screens in RPE1-hTERT BRCA1 -/- ;p53 -/- cells treated with 1 Gy IR. ( B-E ) Western blot analysis of TAOK1 protein expression of NT and TAOK1 KO in KB2P-3.4 (B), KB1P-G3 including HA-tagged, Taok1 cDNA rescue (pOZ-Taok1) (C), MDA-MB-436 (D) and KB2P-1.21 (E) cell lines. ( F ) TIDE analysis of polyclonal KB2P-1.21 cells. ( G, H ) Growth assays in KB1P-G3 NT, Taok1 -/- and Taok1 rescue cells treated with the indicated doses of olaparib (G) or talazoparib (H). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( I, J ) Growth assays in MDA-MB-436 NT and TAOK1 -/- cell lines treated with indicated doses of olaparib (I) or IR (J). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( K, L ) Growth assays in KB2P-1.21 NT and Taok1 sgRNA cells treated with the indicated doses of olaparib (K) or IR (L). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( M ) TIDE analysis of polyclonal KB1P-4S organoids. ( N ) Immunohistochemistry staining for TAOK1 of untreated BRCA1;p53-deficient mouse mammary tumors with NT or Taok1 sgRNA. ( O ) Olaparib response of KB1P-4S organoids transduced with NT or Taok1 sgRNAs. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test.

Journal: bioRxiv

Article Title: TAOK1 regulates chemo- and radiosensitivity in BRCA1/2-deficient tumors

doi: 10.1101/2025.10.14.682031

Figure Lengend Snippet: (A) Volcano plot representing gene summary of MAGeCK analysis of the whole genome CRISPR-Cas9 screens in RPE1-hTERT BRCA1 -/- ;p53 -/- cells treated with 1 Gy IR. ( B-E ) Western blot analysis of TAOK1 protein expression of NT and TAOK1 KO in KB2P-3.4 (B), KB1P-G3 including HA-tagged, Taok1 cDNA rescue (pOZ-Taok1) (C), MDA-MB-436 (D) and KB2P-1.21 (E) cell lines. ( F ) TIDE analysis of polyclonal KB2P-1.21 cells. ( G, H ) Growth assays in KB1P-G3 NT, Taok1 -/- and Taok1 rescue cells treated with the indicated doses of olaparib (G) or talazoparib (H). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( I, J ) Growth assays in MDA-MB-436 NT and TAOK1 -/- cell lines treated with indicated doses of olaparib (I) or IR (J). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( K, L ) Growth assays in KB2P-1.21 NT and Taok1 sgRNA cells treated with the indicated doses of olaparib (K) or IR (L). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( M ) TIDE analysis of polyclonal KB1P-4S organoids. ( N ) Immunohistochemistry staining for TAOK1 of untreated BRCA1;p53-deficient mouse mammary tumors with NT or Taok1 sgRNA. ( O ) Olaparib response of KB1P-4S organoids transduced with NT or Taok1 sgRNAs. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test.

Article Snippet: For CRISPR-Cas9 editing of human MDA-MB-436 cell line, NT sgRNA and TAOK1 sgRNAs were cloned into pX330 vector (Addgene, #42230) with puromycin resistance cassette.

Techniques: CRISPR, Western Blot, Expressing, Immunohistochemistry, Staining, Transduction

( A-C ) Quantification (A, B) and representative images (C) of growth assays in KB1P-G3B1 WT (A) and KB1P-G3 WT and Taok1 -/- cells treated with the indicated doses of CP 43 and olaparib. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( D ) Western blot analysis of expression level of HA-tagged Taok1 rescue constructs. ( E ) In vitro kinase assay of indicated KB1P-G3 cell lines. Protein was isolated from KB1P-G3 cell lines by co-IP with HA-tag. NT cell line was used as negative control with no HA-tag while the other cell lines expressed an HA-tag with the indicated construct. Bars represent mean ± SD, statistical analysis was done with two-way ANOVA followed by Dunnett’s test. ( F, G ) Representative images of growth assay of KB1P-G3 NT, Taok1 -/- and Taok1 full cDNA rescue (pOZ-Taok1) or two different kinase mutants (pOZ-K57A, pOZ-D169A) and a double mutant (pOZ-K57A+D169A) treated with indicated doses of olaparib (F) or IR (G).

Journal: bioRxiv

Article Title: TAOK1 regulates chemo- and radiosensitivity in BRCA1/2-deficient tumors

doi: 10.1101/2025.10.14.682031

Figure Lengend Snippet: ( A-C ) Quantification (A, B) and representative images (C) of growth assays in KB1P-G3B1 WT (A) and KB1P-G3 WT and Taok1 -/- cells treated with the indicated doses of CP 43 and olaparib. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( D ) Western blot analysis of expression level of HA-tagged Taok1 rescue constructs. ( E ) In vitro kinase assay of indicated KB1P-G3 cell lines. Protein was isolated from KB1P-G3 cell lines by co-IP with HA-tag. NT cell line was used as negative control with no HA-tag while the other cell lines expressed an HA-tag with the indicated construct. Bars represent mean ± SD, statistical analysis was done with two-way ANOVA followed by Dunnett’s test. ( F, G ) Representative images of growth assay of KB1P-G3 NT, Taok1 -/- and Taok1 full cDNA rescue (pOZ-Taok1) or two different kinase mutants (pOZ-K57A, pOZ-D169A) and a double mutant (pOZ-K57A+D169A) treated with indicated doses of olaparib (F) or IR (G).

Article Snippet: For CRISPR-Cas9 editing of human MDA-MB-436 cell line, NT sgRNA and TAOK1 sgRNAs were cloned into pX330 vector (Addgene, #42230) with puromycin resistance cassette.

Techniques: Western Blot, Expressing, Construct, In Vitro, Kinase Assay, Isolation, Co-Immunoprecipitation Assay, Negative Control, Growth Assay, Mutagenesis

( A ) Graph representing percentage of cells with micronuclei upon 0.5 µM olaparib treatment for 48 h. Bars are plotted as mean ± SD, statistical analysis was performed using ANOVA followed by Tukey’s multiple comparison test. ( B ) Quantification of RAD51 foci formation upon 10 µM olaparib. Bars represent mean ± SD, statistical analysis was performed using ANOVA followed by Tukey’s multiple comparison test. ( C ) Representative images of RAD51 foci formation upon 10 µM olaparib in Brca1 reconstituted KB1P-G3B1, KB1P-G3 and KB2P-3.4 cell lines with the indicated modifications. ( D ) Quantification of DSB spectrum assay in HEK293T cells treated with the indicated siRNAs. Each dot represents an experiment ran in duplicates, bars represent mean ± SD, statistical analysis was performed using ANOVA followed by Tukey’s multiple comparison test. ( E ) Growth assays of KB1P-G3 NT, Taok1 -/- and TAOK1 rescue cells treated with the indicated doses of cisplatin. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test.

Journal: bioRxiv

Article Title: TAOK1 regulates chemo- and radiosensitivity in BRCA1/2-deficient tumors

doi: 10.1101/2025.10.14.682031

Figure Lengend Snippet: ( A ) Graph representing percentage of cells with micronuclei upon 0.5 µM olaparib treatment for 48 h. Bars are plotted as mean ± SD, statistical analysis was performed using ANOVA followed by Tukey’s multiple comparison test. ( B ) Quantification of RAD51 foci formation upon 10 µM olaparib. Bars represent mean ± SD, statistical analysis was performed using ANOVA followed by Tukey’s multiple comparison test. ( C ) Representative images of RAD51 foci formation upon 10 µM olaparib in Brca1 reconstituted KB1P-G3B1, KB1P-G3 and KB2P-3.4 cell lines with the indicated modifications. ( D ) Quantification of DSB spectrum assay in HEK293T cells treated with the indicated siRNAs. Each dot represents an experiment ran in duplicates, bars represent mean ± SD, statistical analysis was performed using ANOVA followed by Tukey’s multiple comparison test. ( E ) Growth assays of KB1P-G3 NT, Taok1 -/- and TAOK1 rescue cells treated with the indicated doses of cisplatin. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test.

Article Snippet: For CRISPR-Cas9 editing of human MDA-MB-436 cell line, NT sgRNA and TAOK1 sgRNAs were cloned into pX330 vector (Addgene, #42230) with puromycin resistance cassette.

Techniques: Comparison

( A ) Quantification of RAD51 foci formation 3 h post 10 Gy IR. Bars represent mean ± SD, statistical analysis was performed using ANOVA followed by Tukey’s multiple comparison test. ( B ) Verification of siRNA KD efficiency in HEK293T DSB-Spectrum_V1 cell line. ( C ) Growth assays with MDA-MB-436 NT and TAOK1 KO cell lines treated with the indicated doses of cisplatin. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( D, E ) Growth assays in KB1P-G3 NT, TAOK1 KO and Taok1 rescue cell lines treated with indicated doses of carboplatin (D) or oxaliplatin (E). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test.

Journal: bioRxiv

Article Title: TAOK1 regulates chemo- and radiosensitivity in BRCA1/2-deficient tumors

doi: 10.1101/2025.10.14.682031

Figure Lengend Snippet: ( A ) Quantification of RAD51 foci formation 3 h post 10 Gy IR. Bars represent mean ± SD, statistical analysis was performed using ANOVA followed by Tukey’s multiple comparison test. ( B ) Verification of siRNA KD efficiency in HEK293T DSB-Spectrum_V1 cell line. ( C ) Growth assays with MDA-MB-436 NT and TAOK1 KO cell lines treated with the indicated doses of cisplatin. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( D, E ) Growth assays in KB1P-G3 NT, TAOK1 KO and Taok1 rescue cell lines treated with indicated doses of carboplatin (D) or oxaliplatin (E). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test.

Article Snippet: For CRISPR-Cas9 editing of human MDA-MB-436 cell line, NT sgRNA and TAOK1 sgRNAs were cloned into pX330 vector (Addgene, #42230) with puromycin resistance cassette.

Techniques: Comparison

(A) Representative images of IHC staining for TAOK1 on human tumor samples of prostate and lung showing variable nuclear and diffuse cytoplasmatic localization. ( B ) Representative images of IHC staining for TAOK1 on human tumor samples of prostate, bladder and ovary showing varying TAOK1 expression levels. ( C )Western blot analysis of KB1P-G3 NT samples of cytoplasmatic (C) and nuclear (N) fraction and Taok1 -/- whole cell lysate. ( D ) Representative images of immunofluorescence for cellular expression pattern of KB1P-G3 Taok1 -/- cells with HA-tagged pOZ-Taok1 rescue construct compared to pOZ-empty vector control. ( E ) Growth assay in KB1P-G3 NT, Taok1 -/- and Taok1 rescue cell lines treated with indicated doses of camptothecin. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( F ) Growth assay in KB2P-3.4 NT and Taok1 -/- clones treated with indicated doses of JH-RE-06 with or without olaparib (0.1 µM). Statistical analysis was performed using two-way ANOVA followed by Tukey’s test. ( G ) DNA fiber analysis in indicated cell lines with or without 4 mM HU treatment (3 h). Bar represents mean of IdU/CldU ratio of at least 250 fibers, statistical analysis was done with ANOVA followed by Tukey’s multiple comparison test. (H) DNA fiber analysis in indicated cell lines treated with 10 µM olaparib 2h prior and while labelling with CldU and IdU, ssDNA was digested with S1 nuclease if indicated. Bar represents the mean of IdU track length of at least 250 fibers, statistical analysis was done with ANOVA followed by Tukey’s multiple comparison test.

Journal: bioRxiv

Article Title: TAOK1 regulates chemo- and radiosensitivity in BRCA1/2-deficient tumors

doi: 10.1101/2025.10.14.682031

Figure Lengend Snippet: (A) Representative images of IHC staining for TAOK1 on human tumor samples of prostate and lung showing variable nuclear and diffuse cytoplasmatic localization. ( B ) Representative images of IHC staining for TAOK1 on human tumor samples of prostate, bladder and ovary showing varying TAOK1 expression levels. ( C )Western blot analysis of KB1P-G3 NT samples of cytoplasmatic (C) and nuclear (N) fraction and Taok1 -/- whole cell lysate. ( D ) Representative images of immunofluorescence for cellular expression pattern of KB1P-G3 Taok1 -/- cells with HA-tagged pOZ-Taok1 rescue construct compared to pOZ-empty vector control. ( E ) Growth assay in KB1P-G3 NT, Taok1 -/- and Taok1 rescue cell lines treated with indicated doses of camptothecin. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( F ) Growth assay in KB2P-3.4 NT and Taok1 -/- clones treated with indicated doses of JH-RE-06 with or without olaparib (0.1 µM). Statistical analysis was performed using two-way ANOVA followed by Tukey’s test. ( G ) DNA fiber analysis in indicated cell lines with or without 4 mM HU treatment (3 h). Bar represents mean of IdU/CldU ratio of at least 250 fibers, statistical analysis was done with ANOVA followed by Tukey’s multiple comparison test. (H) DNA fiber analysis in indicated cell lines treated with 10 µM olaparib 2h prior and while labelling with CldU and IdU, ssDNA was digested with S1 nuclease if indicated. Bar represents the mean of IdU track length of at least 250 fibers, statistical analysis was done with ANOVA followed by Tukey’s multiple comparison test.

Article Snippet: For CRISPR-Cas9 editing of human MDA-MB-436 cell line, NT sgRNA and TAOK1 sgRNAs were cloned into pX330 vector (Addgene, #42230) with puromycin resistance cassette.

Techniques: Immunohistochemistry, Expressing, Western Blot, Immunofluorescence, Construct, Plasmid Preparation, Control, Growth Assay, Clone Assay, Comparison

( A ) Quantification of SIRF foci formation of HA-tagged TAOK1 with and without 2 mM HU. Bars represent mean ± SD, statistical analysis was performed using ANOVA followed by Tukey’s multiple comparison test. ( B ) Representative images of analysis shown in ( A ). ( C ) Volcano plot of mass spectrum analysis of TAOK1 co-IP samples from KB1P-G3 NT nuclear fraction compared to TAOK1 KO. Positive log2 fold change values indicate enrichment in the NT nuclear fraction compared to TAOK1 KO of four independent replicas. ( D ) Western blot of input and co-IP of KB1P-G3 NT and TAOK1 KO. Pulldown was performed with PCNA antibody. ( E ) Growth assay of KB1P-G3 NT, TAOK1 KO and TAOK1 rescue cells treated with topotecan at indicated doses. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( F ) Growth assay of KB1P-G3 NT, TAOK1 KO and TAOK1 rescue cells treated with JH-RE-06 alone or in combination with olaparib. Statistical analysis was performed using two-way ANOVA followed by Tukey’s test.

Journal: bioRxiv

Article Title: TAOK1 regulates chemo- and radiosensitivity in BRCA1/2-deficient tumors

doi: 10.1101/2025.10.14.682031

Figure Lengend Snippet: ( A ) Quantification of SIRF foci formation of HA-tagged TAOK1 with and without 2 mM HU. Bars represent mean ± SD, statistical analysis was performed using ANOVA followed by Tukey’s multiple comparison test. ( B ) Representative images of analysis shown in ( A ). ( C ) Volcano plot of mass spectrum analysis of TAOK1 co-IP samples from KB1P-G3 NT nuclear fraction compared to TAOK1 KO. Positive log2 fold change values indicate enrichment in the NT nuclear fraction compared to TAOK1 KO of four independent replicas. ( D ) Western blot of input and co-IP of KB1P-G3 NT and TAOK1 KO. Pulldown was performed with PCNA antibody. ( E ) Growth assay of KB1P-G3 NT, TAOK1 KO and TAOK1 rescue cells treated with topotecan at indicated doses. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( F ) Growth assay of KB1P-G3 NT, TAOK1 KO and TAOK1 rescue cells treated with JH-RE-06 alone or in combination with olaparib. Statistical analysis was performed using two-way ANOVA followed by Tukey’s test.

Article Snippet: For CRISPR-Cas9 editing of human MDA-MB-436 cell line, NT sgRNA and TAOK1 sgRNAs were cloned into pX330 vector (Addgene, #42230) with puromycin resistance cassette.

Techniques: Comparison, Co-Immunoprecipitation Assay, Western Blot, Growth Assay

( A ) Graph showing replication speed by total track length of untreated DNA fiber assay in KB1P-G3 NT and TAOK1 KO cells. Bar represents the mean of at least 250 fibers, statistical analysis was done with unpaired t-test. ( B ) DNA fiber analysis in indicated cell lines with or without 4 mM HU treatment. Bar represents the mean of IdU/CldU ratio of at least 300 fibers, statistical analysis was done with unpaired t-test. ( C ) DNA fiber analysis in indicated cell lines treated with 10 µM olaparib 2h prior and while labelling with CldU and IdU, ssDNA was digested with S1 nuclease if indicated. Bar represents the mean of IdU track length of at least 250 fibers, statistical analysis was done with ANOVA followed by Tukey’s multiple comparison test. ( D, E ) Quantification (D) and representative images (E) of immunofluorescence analysis of RPA foci formation in KB1P-G3 NT, TAOK1 KO and TAOK1 rescue cells upon olaparib treatment (10 µM for 16 h). Bars indicate the mean number of foci per nucleus of at least 1000 nuclei. Statistical analysis was done with ANOVA followed by Tukey’s multiple comparison test. (F) Western blot of input and co-IP of KB1P-G3 NT and TAOK1 rescue cells. Pulldown was performed with TRIM25 antibody. ( G, H ) Western blot of indicated KB1P-G3 (H) and MDA-MB-436 (I) cell lines for ISG15 protein levels. Cells were untreated or treated with 10 µM olaparib for 24 h. Vinculin was used as loading control. ( I, J ) Schematic predicting replication dynamics in presence (I) or absence of TAOK1 (J) in BRCA1/2-deficient cells. (I) TAOK1 interacts with PCNA and TRIM25 and does not allow alternative fork protection mechanisms or ssDNA gap repair in BRCA-deficient cells, leading to RF instability. (J) In the absence of TAOK1, increased ISG15 expression and potentially recruitment to RF activates fork protection and gap suppression mechanisms and thus, RF stability.

Journal: bioRxiv

Article Title: TAOK1 regulates chemo- and radiosensitivity in BRCA1/2-deficient tumors

doi: 10.1101/2025.10.14.682031

Figure Lengend Snippet: ( A ) Graph showing replication speed by total track length of untreated DNA fiber assay in KB1P-G3 NT and TAOK1 KO cells. Bar represents the mean of at least 250 fibers, statistical analysis was done with unpaired t-test. ( B ) DNA fiber analysis in indicated cell lines with or without 4 mM HU treatment. Bar represents the mean of IdU/CldU ratio of at least 300 fibers, statistical analysis was done with unpaired t-test. ( C ) DNA fiber analysis in indicated cell lines treated with 10 µM olaparib 2h prior and while labelling with CldU and IdU, ssDNA was digested with S1 nuclease if indicated. Bar represents the mean of IdU track length of at least 250 fibers, statistical analysis was done with ANOVA followed by Tukey’s multiple comparison test. ( D, E ) Quantification (D) and representative images (E) of immunofluorescence analysis of RPA foci formation in KB1P-G3 NT, TAOK1 KO and TAOK1 rescue cells upon olaparib treatment (10 µM for 16 h). Bars indicate the mean number of foci per nucleus of at least 1000 nuclei. Statistical analysis was done with ANOVA followed by Tukey’s multiple comparison test. (F) Western blot of input and co-IP of KB1P-G3 NT and TAOK1 rescue cells. Pulldown was performed with TRIM25 antibody. ( G, H ) Western blot of indicated KB1P-G3 (H) and MDA-MB-436 (I) cell lines for ISG15 protein levels. Cells were untreated or treated with 10 µM olaparib for 24 h. Vinculin was used as loading control. ( I, J ) Schematic predicting replication dynamics in presence (I) or absence of TAOK1 (J) in BRCA1/2-deficient cells. (I) TAOK1 interacts with PCNA and TRIM25 and does not allow alternative fork protection mechanisms or ssDNA gap repair in BRCA-deficient cells, leading to RF instability. (J) In the absence of TAOK1, increased ISG15 expression and potentially recruitment to RF activates fork protection and gap suppression mechanisms and thus, RF stability.

Article Snippet: For CRISPR-Cas9 editing of human MDA-MB-436 cell line, NT sgRNA and TAOK1 sgRNAs were cloned into pX330 vector (Addgene, #42230) with puromycin resistance cassette.

Techniques: Comparison, Immunofluorescence, Western Blot, Co-Immunoprecipitation Assay, Control, Expressing

( A, B ) Representative images (A) and quantification (B) of immunofluorescence analysis of RPA foci formation in KB2P-3.4 NT and Taok1 -/- cells upon olaparib treatment (10 µM for 16 h). Bars indicate mean number of foci per nucleus of at least 1000 nuclei. Statistical analysis was done with ANOVA followed by Tukey’s multiple comparison test. ( C, D ) Graph representing ssDNA intensity of native BrdU incorporation in KB1P-G3 (C) and MDA-MB-436 (D) cell lines. Cells were treated with 0.75 µM olaparib for 5 h. Ordinary one-way ANOVA with Dunnett’s multiple comparison test was used for statistical analysis. ( E ) Representative images of PLA assay between TRIM25 and HA-tag in KB1P-G3 NT and Taok1 rescue cells. ( F ) Kaplan-Meier curve of survival probability of SCAN-B dataset treated with non-chemotherapy. Statistical analysis was done with log-rank test.

Journal: bioRxiv

Article Title: TAOK1 regulates chemo- and radiosensitivity in BRCA1/2-deficient tumors

doi: 10.1101/2025.10.14.682031

Figure Lengend Snippet: ( A, B ) Representative images (A) and quantification (B) of immunofluorescence analysis of RPA foci formation in KB2P-3.4 NT and Taok1 -/- cells upon olaparib treatment (10 µM for 16 h). Bars indicate mean number of foci per nucleus of at least 1000 nuclei. Statistical analysis was done with ANOVA followed by Tukey’s multiple comparison test. ( C, D ) Graph representing ssDNA intensity of native BrdU incorporation in KB1P-G3 (C) and MDA-MB-436 (D) cell lines. Cells were treated with 0.75 µM olaparib for 5 h. Ordinary one-way ANOVA with Dunnett’s multiple comparison test was used for statistical analysis. ( E ) Representative images of PLA assay between TRIM25 and HA-tag in KB1P-G3 NT and Taok1 rescue cells. ( F ) Kaplan-Meier curve of survival probability of SCAN-B dataset treated with non-chemotherapy. Statistical analysis was done with log-rank test.

Article Snippet: For CRISPR-Cas9 editing of human MDA-MB-436 cell line, NT sgRNA and TAOK1 sgRNAs were cloned into pX330 vector (Addgene, #42230) with puromycin resistance cassette.

Techniques: Immunofluorescence, Comparison, BrdU Incorporation Assay

( A, B ) Analysis of the SCAN-B dataset for TAOK1 high or low expression. Kaplan-Meier curves for survival probability of all patients (A) and patients treated with chemotherapy specifically (B). Risk tables are shown below. Statistical analysis was done with log-rank test.

Journal: bioRxiv

Article Title: TAOK1 regulates chemo- and radiosensitivity in BRCA1/2-deficient tumors

doi: 10.1101/2025.10.14.682031

Figure Lengend Snippet: ( A, B ) Analysis of the SCAN-B dataset for TAOK1 high or low expression. Kaplan-Meier curves for survival probability of all patients (A) and patients treated with chemotherapy specifically (B). Risk tables are shown below. Statistical analysis was done with log-rank test.

Article Snippet: For CRISPR-Cas9 editing of human MDA-MB-436 cell line, NT sgRNA and TAOK1 sgRNAs were cloned into pX330 vector (Addgene, #42230) with puromycin resistance cassette.

Techniques: Expressing