|
Illumina Inc
nebnext ultra ii rna library prep kit for illumina ![]() Nebnext Ultra Ii Rna Library Prep Kit For Illumina, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cotton+single-cell+transcriptomic+data/pmc09808897-398-9-17?v=Illumina+Inc Average 96 stars, based on 1 article reviews
nebnext ultra ii rna library prep kit for illumina - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
Broad Institute Inc
single cell portal ![]() Single Cell Portal, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cotton+single-cell+transcriptomic+data/pmc11804007-87-52-59?v=Broad+Institute+Inc Average 90 stars, based on 1 article reviews
single cell portal - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Becton Dickinson
rhapsody™ single‑cell analysis system ![]() Rhapsody™ Single‑Cell Analysis System, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cotton+single-cell+transcriptomic+data/pm37941075-1286-9-8?v=Becton+Dickinson Average 90 stars, based on 1 article reviews
rhapsody™ single‑cell analysis system - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
quantitative reverse transcriptase polymerase chain reaction qrt pcr ![]() Quantitative Reverse Transcriptase Polymerase Chain Reaction Qrt Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cotton+single-cell+transcriptomic+data/pmc07858242-1264-0-8?v=Thermo+Fisher Average 98 stars, based on 1 article reviews
quantitative reverse transcriptase polymerase chain reaction qrt pcr - by Bioz Stars,
2026-08
98/100 stars
|
Buy from Supplier |
|
Novus Biologicals
ndst3 ![]() Ndst3, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cotton+single-cell+transcriptomic+data/pmc12970244-400-25-26?v=Novus+Biologicals Average 93 stars, based on 1 article reviews
ndst3 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp acp5 mm00475698 m1 ![]() Gene Exp Acp5 Mm00475698 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cotton+single-cell+transcriptomic+data/pmc08050258-290-49-53?v=Thermo+Fisher Average 99 stars, based on 1 article reviews
gene exp acp5 mm00475698 m1 - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp ddb2 hs00172068 m1 ![]() Gene Exp Ddb2 Hs00172068 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cotton+single-cell+transcriptomic+data/pmc11106736-23-76--1?v=Thermo+Fisher Average 85 stars, based on 1 article reviews
gene exp ddb2 hs00172068 m1 - by Bioz Stars,
2026-08
85/100 stars
|
Buy from Supplier |
|
DSMZ
cell lines rt112 ![]() Cell Lines Rt112, supplied by DSMZ, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cotton+single-cell+transcriptomic+data/pmc10162941-299-4-14?v=DSMZ Average 95 stars, based on 1 article reviews
cell lines rt112 - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
|
GrandOmics Biosciences
single-cell transcriptomics ![]() Single Cell Transcriptomics, supplied by GrandOmics Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cotton+single-cell+transcriptomic+data/pm40319711-8-0-65?v=GrandOmics+Biosciences Average 90 stars, based on 1 article reviews
single-cell transcriptomics - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
tiangen biotech co
e coli dh5α ![]() E Coli Dh5α, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cotton+single-cell+transcriptomic+data/pmc11513822-71-0-4?v=tiangen+biotech+co Average 99 stars, based on 1 article reviews
e coli dh5α - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
Proteintech
hla dra ![]() Hla Dra, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cotton+single-cell+transcriptomic+data/pmc12983932-280-32-33?v=Proteintech Average 94 stars, based on 1 article reviews
hla dra - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
New England Biolabs
bam hi hf restriction enzyme neb cat ![]() Bam Hi Hf Restriction Enzyme Neb Cat, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cotton+single-cell+transcriptomic+data/pm39701104-289-57-61?v=New+England+Biolabs Average 99 stars, based on 1 article reviews
bam hi hf restriction enzyme neb cat - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell reports
Article Title: ΔNp63 drives dysplastic alveolar remodeling and restricts epithelial plasticity upon severe lung injury
doi: 10.1016/j.celrep.2022.111805
Figure Lengend Snippet:
Article Snippet: PolyA-selected RNA was used to generate libraries using the
Techniques: Virus, Recombinant, Lysis, Magnetic Beads, Migration, Single-cell Transcriptomics, Software
Journal: BMC Biology
Article Title: Mapping chromatin remodelling in glioblastoma identifies epigenetic regulation of key molecular pathways and novel druggable targets
doi: 10.1186/s12915-025-02127-9
Figure Lengend Snippet: Integrative analysis of single histone modifications and gene expression reveals dynamic and synergistic epigenetic regulation of pathways involved in glioblastoma pathogenesis. a Pearson correlation heatmaps of integrative analysis of ChIP Seq data for each HM and RNAseq dataset for genes only found in GIC (left) or iNSC (right) for at least one HM. RNAseq data are represented as log fold change of Differentially Expressed (DE) genes between GIC and iNSC: logFC DE > 1 and < − 1 when genes are up (red section) and downregulated (blue section) in GIC as compared to iNSC respectively (left). LogFC DE > 1 and < − 1 when genes are down and upregulated in iNSC as compared to GIC respectively (right). b Percentages of upregulated (red) and downregulated (blue) genes in iNSC as compared to GIC (top) and in GIC as compared to iNSC (bottom) for each HM based on transcriptomic dataset from the SYNGN cohort . Number of genes is also specified for each condition. c mRNA expression of GSC in iNSC, GIC and bulk tumour from the RNAseq dataset of the SYNGN cohort (left) and in bulk tumour and non-tumour samples from TCGA dataset . Results are expressed in log 2 (tpm) transcript per million (tpm). One-way ANOVA test. * p value < 0.05, ** p value < 0.01 and *** p value < 0.001. d Representative immunofluorescent images for GSC (green) in iNSC and GIC from patient 52. Nuclei are counterstained with DAPI. Scale bar: 50 µm. Quantification is shown as Mean Fluorescence Intensity (MFI) standardised by the number of nuclei. One-way ANOVA test. * p value < 0.05, ** p value < 0.01, *** p value < 0.001, **** p value < 0.0001. e GSC gene expression in non-tumour and bulk primary glioblastoma tumour (left panel). t-test. * p value < 0.05, ** p value < 0.01 and *** p value < 0.001. f Survival curve of glioblastoma patients with high and low expression of GSC gene (right panel). Source: TCGA Stat test: log-rank, * p value < 0.05, ** p value < 0.01 and *** p value < 0.001. g Spatial expression of GSC in glioblastoma bulk samples, analysed on Ivy –GAP . The left panel shows an example of histological anatomic structure identified in a sub-block and the right panel represents the expression of GSC in RNAseq data from anatomic structures shown as log2 normalised gene expression. Leading Edge defined as the border of the tumour, where ratio of tumour to normal cells is 1–3 / 100. Infiltrating tumour defined as the intermediate zone between leading edge and cellular tumour, where ratio of tumour to normal cells is 10–20 /100. Cellular tumour defined as tumour core, where tumour to normal cells is 100–500 / 1. One-way ANOVA test. * p value < 0.05, ** p value < 0.01 and *** p value < 0.001. h Single-cell RNAseq data showing GSC expression (left panel) in scRNAseq of glioblastoma samples in clusters defined in (right panel). Data are plotted as tSNE, with logTPM expression ranging from light orange to dark
Article Snippet: At regional level (Glioblastoma Atlas Project—IvyGap) [ ], GSC expression is highest in the cellular tumour (tumour core) and show intermediate expression in the infiltrating tumour (ratio of tumour-to-normal cells 10–20/100) as compared to leading edge (ratio of tumour-to-normal cells 1–3/100 (Fig. g), with GSC being exclusively expressed in malignant cells at
Techniques: Gene Expression, ChIP-sequencing, Expressing, Fluorescence, Blocking Assay
Journal: BMC Biology
Article Title: Mapping chromatin remodelling in glioblastoma identifies epigenetic regulation of key molecular pathways and novel druggable targets
doi: 10.1186/s12915-025-02127-9
Figure Lengend Snippet: Comparative analysis of the functional impact of chromatin states dynamics in GIC and iNSC using automatic fragmentation analysis. a Chromatin states defined by enrichment of HM using ChromHMM . Probabilities of each HM in chromatin states are depicted as a heatmap. b Pie charts show percentages of peaks in each chromatin state in GIC (left) and iNSC (right). c Sankey diagram shows the switch of peaks from one chromatin state in iNSC to another in GIC. The thickness of the links is proportional to the number of peaks included. Flows with the highest number of peaks between two opposite state functions are highlighted in bold red (activating transition in GIC) and blue (repressing transition in GIC). d Percentages of upregulated (red) and downregulated (blue) genes in the chromatin states of interest based on transcriptomic dataset from the SYNGN Cohort . Number of genes is also specified for each condition. e Visualisation of the enriched pathways identified in GIC from genes activated in GIC as compared to iNSC and from genes inactivated in GIC as compared to iNSC. Pathways are annotated based on pathways enrichment analysis performed with Reactome and represented as circle, colours represent each histone (see legend), size of the circle is proportional to the number of genes involved in the pathway (FDR < 0.05)
Article Snippet: At regional level (Glioblastoma Atlas Project—IvyGap) [ ], GSC expression is highest in the cellular tumour (tumour core) and show intermediate expression in the infiltrating tumour (ratio of tumour-to-normal cells 10–20/100) as compared to leading edge (ratio of tumour-to-normal cells 1–3/100 (Fig. g), with GSC being exclusively expressed in malignant cells at
Techniques: Functional Assay
Journal: Advanced Science
Article Title: NDST3‐Induced Epigenetic Reprogramming Reverses Neurodegeneration in Parkinson's Disease
doi: 10.1002/advs.202507323
Figure Lengend Snippet: Identification of regenerating factor as a regulator of therapeutic genes for Parkinson's disease therapy. A) Conceptual diagram outlining the basis of an epigenetic regulator. B) Comparative gene expression heatmap of substantia nigra (SN) in wild type control versus 6‐OHDA‐induced Parkinson's disease (PD) mouse model. C) Heatmap showing gene expression profiles in the caudate and putamen regions of healthy individuals (HI) and a cohort of human PD patients. BG: Basal Ganglia. D) Immunofluorescence images showing TUJ1‐ and MAP2‐positive cells under each condition. Scale bar = 50 µm. E) Immunochemistry and Sholl analysis of TH‐labeled neurons. Left panel: morphology of individual neurons. Right panel: Sholl analysis showing the number of neurite intersections as a function of distance from the soma. Scale bar = 100 µm. The data are presented as mean ± SEM ( n = 5 – 6 cells per group). F) Representative traces of action potentials evoked by depolarizing current injections under each condition (sham, 6‐OHDA, 6‐OHDA+NDST3). G) Dot plot showing the top 14 GO Biological Process terms from enrichment analyses: 6‐OHDA versus Sham (left side) and 6‐OHDA+NDST3 versus 6‐OHDA (right side). H) Pearson correlation matrix of transcriptomic among samples.
Article Snippet: Slices were incubated with primary antibodies targeting dopaminergic neuron markers TH (Merck Millipore, AB152, Lot# 4127053; Merck Millipore, MAB318, Lot#3990619), GIRK2 (Abcam, ab259909, Lot# GR3401320‐4),
Techniques: Gene Expression, Control, Immunofluorescence, Labeling
Journal: Advanced Science
Article Title: NDST3‐Induced Epigenetic Reprogramming Reverses Neurodegeneration in Parkinson's Disease
doi: 10.1002/advs.202507323
Figure Lengend Snippet: Therapeutic efficacy of NDST3 and retrograde tracing with CTB in mice. A) Schematic diagram of in vivo experimental design involving CTB injection in the PD mouse model. B) Representative immunofluorescence images of CTB, TH, and NDST3 expression in the SN of Sham, 6‐OHDA‐induced PD mice, and NDST3‐treated PD mice. Scale bar = 50 µm and 10 µm (Magnified image). C) Quantification of CTB‐, TH‐, and NDST3‐positive cells shown in Figure . Data are presented as mean ± SEM ( n = 6 independent animals per group). One‐way ANOVA with Tukey's multiple comparisons test. ** p < 0.01, *** p < 0.001, **** p < 0.0001, and ns = not significant. D) Immunofluorescence images showing GIRK2‐ and TH‐positive cells in the Sham, 6‐OHDA‐induced PD mice, and NDST3‐treated PD mice. Scale bar = 50 µm and 10 µm (Magnified image). E) 3D Z‐stack analysis (IMARIS) of TH‐positive neurons obtained via confocal microscopy. F) DAB‐DAT staining in the SN.
Article Snippet: Slices were incubated with primary antibodies targeting dopaminergic neuron markers TH (Merck Millipore, AB152, Lot# 4127053; Merck Millipore, MAB318, Lot#3990619), GIRK2 (Abcam, ab259909, Lot# GR3401320‐4),
Techniques: Drug discovery, Retrograde Tracing, In Vivo, Injection, Immunofluorescence, Expressing, Confocal Microscopy, Staining
Journal: Advanced Science
Article Title: NDST3‐Induced Epigenetic Reprogramming Reverses Neurodegeneration in Parkinson's Disease
doi: 10.1002/advs.202507323
Figure Lengend Snippet: Efficacy and electrophysiological properties of NDST3 in chemical‐induced PD model. A) Representative traces of spontaneous firing currents recorded from DA neurons of the SNpc in brain slices from each group. B) Cumulative fractions curves showing shortened inter‐event intervals, indicating a higher frequency of spontaneous firing in the 6‐OHDA + NDST3 group compared to the 6‐OHDA group. The inner bar graph showed mean inter‐event intervals in the ipsilateral of SNpc of each group. Data are presented as mean ± SEM ( n = 6 – 8 independent animals per group). One‐way ANOVA with Tukey's multiple comparisons test. *** p < 0.001. C) Quantification of DA neuronal firing rates in the ipsilateral SNpc of each group. The data are presented as mean ± SEM ( n = 6–8 independent animals per group). One‐way ANOVA with Tukey's multiple comparisons test. * p < 0.05, and ** p < 0.01. D) Representative in vivo recording traces from the SNpc of live animals in each condition. E) Instantaneous firing frequencies during the recorded period. ( n = 4–6 independent animals per group; repeated measures) Two‐way ANOVA with Tukey's multiple comparisons test, * p < 0.05. F) Comparison of action potential waveforms among DA neurons across conditions. G) Representative image of DAB‐TH staining in ST and SN. Scale bar = 1 mm. H) Immunofluorescence images showing GIRK2‐ and TH‐positive cells in the Sham, MPTP‐induced PD mice, NDST3‐treated PD mice, and NDST3 only‐treated mice. Scale bar = 50 µm and 10 µm (Magnified image). I) Error count during the challenging beam traversal test for each experimental condition. The data are presented as mean ± SEM. ( n = 7 – 8 independent animals per group) Two‐way ANOVA with Tukey's multiple comparisons test. **** p < 0.0001. J) Errors per step during the challenging beam traversal test across conditions. The data are presented as mean ± SEM ( n = 7 – 8 independent animal per group). One‐way ANOVA with Tukey's multiple comparisons test. **** p < 0.0001. K) Fall latency in the wire‐hanging test. The data are presented as mean ± SEM ( n = 7–8 independent animals per group). One‐way ANOVA with Tukey's multiple comparisons test. *** p < 0.001 and **** p < 0.0001. L) Time to orient downward (T‐turn) and M) time to descend to the base (T‐total). The data are presented as mean ± SEM ( n = 7–8 independent animals per group). One‐way ANOVA with Tukey's multiple comparisons test. * p < 0.05, *** p < 0.001 and **** p < 0.0001.
Article Snippet: Slices were incubated with primary antibodies targeting dopaminergic neuron markers TH (Merck Millipore, AB152, Lot# 4127053; Merck Millipore, MAB318, Lot#3990619), GIRK2 (Abcam, ab259909, Lot# GR3401320‐4),
Techniques: In Vivo, Comparison, Staining, Immunofluorescence
Journal: Advanced Science
Article Title: NDST3‐Induced Epigenetic Reprogramming Reverses Neurodegeneration in Parkinson's Disease
doi: 10.1002/advs.202507323
Figure Lengend Snippet: Molecular mechanisms of NDST3 in the PD model. A) One‐way hierarchical clustering heatmap based on Z‐score of normalized expression value for 5629 genes selected with fold change ≥ 2 and raw p ‐value < 0.05. B) Principal component analysis (PCA) analysis of RNA‐seq data to visualize sample‐to‐sample variation. C) Volcano plot showing differentially expressed genes between 6‐OHDA and Sham group; Down‐regulated genes marked in blue. D) Volcano plot showing differentially expressed genes between 6‐OHDA+NDST3 and 6‐OHDA; Up‐regulated genes marked in red. E) Dot plot of top 14 GO cellular component terms from GO enrichment analyses: 6‐OHDA+NDST3 versus 6‐OHDA. Heatmap showing gene expression patterns in F) pre‐synaptic neurons, G) post‐synaptic neurons, and H) glia compartments. I) UMAP visualizing cluster identity. J) UMAP representation comparing cellular composition in 6‐OHDA and 6‐OHDA+NDST3. K) Branched trajectory analysis illustrating cell state transitions in a 2D state‐space, where each dot represents a single cell, color‐coded by group identity.
Article Snippet: Slices were incubated with primary antibodies targeting dopaminergic neuron markers TH (Merck Millipore, AB152, Lot# 4127053; Merck Millipore, MAB318, Lot#3990619), GIRK2 (Abcam, ab259909, Lot# GR3401320‐4),
Techniques: Expressing, RNA Sequencing, Gene Expression, Single Cell
Journal: Advanced Science
Article Title: NDST3‐Induced Epigenetic Reprogramming Reverses Neurodegeneration in Parkinson's Disease
doi: 10.1002/advs.202507323
Figure Lengend Snippet: Comprehensive analysis of spatial transcriptomics and epigenetic modulation following NDST3 treatment in a PD model. A) Heatmap showing gene expression patterns in each cluster. ** p < 0.01, and **** p < 0.0001. B) Gene concept network plot displaying genes enriched in catabolic, metabolic, and wound healing GO categories. The top 30 most differentially expressed genes comparing 6‐OHDA versus Sham and 6‐OHDA+NDST3 versus 6‐OHDA. Node color intensity represents the log2 fold‐change of gene expression. C) Cell‐cell communication network plot illustrating interactions among three distinct cell clusters in 6‐OHDA‐induced PD model (left panel) and NDST3‐treated PD model (right panel), based on ligand–receptor pair probabilities using the CellChat database. Line thickness indicates proportionality to the number of interactions. D) Spatial localization of dopamine‐related markers. E) Spatial mapping of dopaminergic lineage markers identified via scRNA‐Seq. F) Heatmap visualization of CUT&RUN and ATAC‐Seq signal intensity ±2 kb around the TSS. G) Immunofluorescence images showing H3K27ac and TH‐positive cells in the Sham, 6‐OHDA‐induced PD mice, and NDST3‐treated PD mice. Scale bar = 50 µm. H) Venn diagram illustrating overlapping genes among DEGs from RNA‐Seq, scRNA‐Seq Cluster 9, CUT&RUN peak, and ATAC‐Seq peak. Average signal plot of I) CUT&RUN and J) ATAC‐seq signals at over‐enriched TSS regions of the Ncoa7 gene. K) Structure of NDST3‐NCOA7‐H3K27ac complex. Blue – NDST3, Green – NCOA7, and Red – H3K27ac. The yellow boundary represents the interaction region.
Article Snippet: Slices were incubated with primary antibodies targeting dopaminergic neuron markers TH (Merck Millipore, AB152, Lot# 4127053; Merck Millipore, MAB318, Lot#3990619), GIRK2 (Abcam, ab259909, Lot# GR3401320‐4),
Techniques: Spatial Transcriptomics, Gene Expression, Immunofluorescence, RNA Sequencing
Journal: Nature Communications
Article Title: Selenoprotein W ensures physiological bone remodeling by preventing hyperactivity of osteoclasts
doi: 10.1038/s41467-021-22565-7
Figure Lengend Snippet: a Downregulation of SELENOW during osteoclastogenesis. Osteoclast precursors were cultured with RANKL and M-CSF, and SELENOW gene expression was analysed by RT-PCR, northern blotting (NB), and immunoblotting (IB). b , c RANKL/RANK/TRAF6 axis-dependent downregulation of SELENOW . Osteoclast precursors were pretreated with interferon-γ (IFN-γ; 150 U/ml), which degrades TRAF6, 30 min prior to RANKL stimulation. Osteoclast precursors treated with IFN-γ ( b ) and TRAF6-deficient osteoclast precursors ( c ) failed to induce RANKL-mediated SELENOW downregulation. d Up- and downregulation of SELENOW via ERK and p38 activation, respectively. Osteoclast precursors were pretreated with inhibitors of ERK (PD98059), JNK (SP600125), p38 (SB203580), NF-κB (SN50), and NFATc1 (cyclosporin A, CsA) for 30 min in the presence of M-CSF and then stimulated with RANKL for 2 days. The expression levels of SELENOW were analysed using RT-PCR. e , f Decreased and increased osteoclast formation following SELENOW knockdown ( e ) and overexpression ( f ), respectively. Osteoclast precursors infected with shRNA-mediated SELENOW gene-silencing lentivirus and SELENOW -overexpressing retrovirus were differentiated into osteoclasts and TRAP-positive multi-nucleated cells (TRAP + MNCs) with more than 3 nuclei were assessed ( n = 3). Scale bars, 100 μm. Images are representative of three independent experiments. Data represent the mean ± SD of triplicate samples. Statistical significance was determined by Student’s two-tailed t -test ( f ). One-way ANOVA was performed followed by Turkey’s test ( e ). Source data are provided as a Source Data file.
Article Snippet: For qPCR analysis, total RNA was reverse transcribed into cDNA with the Superscript First-Strand Synthesis System (Invitrogen) and the reaction was carried out on a 7500 Detection System (Applied Biosystems, Foster City, CA, USA) using the Real-time TaqMan PCR assay kit that included primer sets for NFATc1 (Mm00479445_m1), Acp5 (
Techniques: Cell Culture, Gene Expression, Reverse Transcription Polymerase Chain Reaction, Northern Blot, Western Blot, Activation Assay, Expressing, Knockdown, Over Expression, Infection, shRNA, Two Tailed Test
Journal: Nature Communications
Article Title: Selenoprotein W ensures physiological bone remodeling by preventing hyperactivity of osteoclasts
doi: 10.1038/s41467-021-22565-7
Figure Lengend Snippet: a μCT analysis of proximal tibiae from wild-type (WT) male littermates and age/sex-matched SELENOW −/− mice at 10 weeks. BV/TV, trabecular bone volume per tissue volume; Tb.N, trabecular bone number; Tb.Th, trabecular thickness; Tb.Sp, trabecular separation; BMD, bone mineral density. Scale bar, 0.5 mm. b , c Reduced osteoclast formation on the trabecular bone surface of SELENOW −/− mice. H&E- and TRAP-stained sections of tibiae were used to detect osteoblasts ( b ) and osteoclasts ( c ), respectively. NOb/BS, number of osteoblasts per bone surface; NOc/BS, BV/TV, trabecular bone volume per tissue volume; number of osteoclasts per bone surface. In addition, osteoclast size and eroded bone surface were analysed from the TRAP-stained sections. Scale bar, 100 μm. d Increased bone mass phenotype in μCT analysis of proximal tibiae from WT male littermates ( SELENOW tm1c/tm1c ; SeW fl/fl ) and age/sex-matched osteoclast-specific SELENOW knockout mice ( SELENOW tm/c/tm1c :LysM-Cre; SeW fl/fl ;LysM-Cre) at 10 weeks. Scale bar, 0.5 mm. e Analysis of NOb/BS, number of osteoblasts per bone surface, and BV/TV in H&E-stained sections. Scale bar, 100 μm. f Analysis of NOc/BS, number of osteoclasts per bone surface, osteoclast size and eroded bone surface from TRAP-stained sections. Scale bar, 100 μm. g Histomorphometric analysis of the tibia. BFR, bone formation rate. Scale bar, 10 μm. Data represent mean ± SD ( n = 7 mice per group in a – c ; n = 8 mice per group in d – g ). Statistical significance was determined by Student’s two-tailed t -test. Source data are provided as a Source Data file.
Article Snippet: For qPCR analysis, total RNA was reverse transcribed into cDNA with the Superscript First-Strand Synthesis System (Invitrogen) and the reaction was carried out on a 7500 Detection System (Applied Biosystems, Foster City, CA, USA) using the Real-time TaqMan PCR assay kit that included primer sets for NFATc1 (Mm00479445_m1), Acp5 (
Techniques: Staining, Knock-Out, Two Tailed Test
Journal: Nature Communications
Article Title: Selenoprotein W ensures physiological bone remodeling by preventing hyperactivity of osteoclasts
doi: 10.1038/s41467-021-22565-7
Figure Lengend Snippet: a μCT analysis of proximal tibiae from wild-type (WT) male littermates and age/sex-matched transgenic (TG) mice at 10 weeks. Scale bar, 0.5 mm. b μCT images of calvaria and analysis of bone parameters [trabecular bone volume per tissue volume (BV/TV) and BMD]. scale bar, 3 mm. c , d Increased osteoclast formation on the trabecular bone surface of TG mice. Analysis of NOb/BS, number of osteoblasts per bone surface, from H&E-stained sections ( c ). Analysis of NOc/BS, number of osteoclasts per bone surface, osteoclast size and eroded bone surface from TRAP-stained sections ( d ). Scale bar, 100 μm. e – g Whole calvaria ( e ) and cross-sections ( f ) were stained with TRAP. The number of TRAP + osteoclasts and the calvarial marrow cavity area ( g ), which reflects the degree of osteoporosis, were measured in whole sections. Scale bar, 1 mm. h The level of urinary DPD, a marker of osteoporosis, was measured by enzyme immunoassay. Data represent mean ± SD ( n = 12 mice per group in a , c , d and f , and n = 7 mice per group in b and e – h ). Statistical significance was determined by Student’s two-tailed t -test. Source data are provided as a Source Data file.
Article Snippet: For qPCR analysis, total RNA was reverse transcribed into cDNA with the Superscript First-Strand Synthesis System (Invitrogen) and the reaction was carried out on a 7500 Detection System (Applied Biosystems, Foster City, CA, USA) using the Real-time TaqMan PCR assay kit that included primer sets for NFATc1 (Mm00479445_m1), Acp5 (
Techniques: Transgenic Assay, Staining, Marker, Enzyme-linked Immunosorbent Assay, Two Tailed Test
Journal: Nature Communications
Article Title: Selenoprotein W ensures physiological bone remodeling by preventing hyperactivity of osteoclasts
doi: 10.1038/s41467-021-22565-7
Figure Lengend Snippet: a Osteoclastogenic transcription factors and SELENOW co-translocate into the nucleus. Osteoclast precursors infected with SELENOW -harbouring retrovirus were cultured with M-CSF and RANKL for 2 days. After cells were exposing to RANKL-free condition for 3 h and treated without or with an inhibitor of NFATc1 (cyclosporin A, CsA), cells were stimulated with RANKL for 20 min. Cytosolic and nuclear proteins were fractionated and NF-κB, NFATc1, and SELENOW levels were determined by immunoblotting. b Luciferase reporter assay. RAW264.7 cells were transfected with AP-1-, NF-κB-, and NFATc1-luciferase reporter or pcDNA3.1-His-tagged SELENOW (SeCys-13) vector. Cells were stimulated with RANKL for 24 h and luciferase activity was measured ( n = 3). c , d SELENOW interacts with NF-κB and NFATc1. Cytosolic extracts from HEK 293 T cells expressing a His-tagged SELENOW (SeCys-13) were pulled down with an anti-His-Tag antibody ( c ). Also, cytosolic extracts from HEK 293T cells with a His-tagged wild-type SELENOW (SeCys-13) and His-tagged SELENOW mutants in which SeCys-13 was replaced by cysteine (SeCys13C) or serine (SeCys13S) were immunoprecipitated (IP) with anti-His-Tag antibody and then immunoblotted (IB) with the indicated antibodies ( d ). e ChIP assay. Osteoclast precursors were cultured with M-CSF alone (d0) or with M-CSF and RANKL for 3 days (d3; left panels). Also, osteoclast precursors from wild-type (WT) and SELENOW -overexpressing transgenic (TG) mice were cultured with M-CSF and RANKL for 3 days (right panels). Following immunoprecipitation (IP) of chromatin with anti-SELENOW antibody, ChIP assay was performed to detect the promoter for NF-κB- or NFATc1-binding sites. f , g 14-3-3γ mediates nuclear translocation of NFATc1, NF-κB, and SELENOW, and osteoclast differentiation. After osteoclast precursors from WT and TG mice were cultured with M-CSF and RANKL for 2 days to induce pre-osteoclasts, the cells were exposed to M-CSF- and RANKL-free condition for 3 h and were stimulated with RANKL for indicated times ( f ; left panel). In addition, this was performed in TG mice-derived pre-osteoclasts transduced with control lentivirus (pLKO) or 14-3-3γ-targeted shRNA-harbouring lentivirus ( f ; right panel). Nuclear proteins were fractionated and subjected to immunoblotting. Osteoclast precursors from TG mice were infected with shRNA-mediated 14-3-3γ gene-silencing lentivirus and differentiated into osteoclasts ( n = 3). TRAP + MNCs with more than 3 or 10 nuclei were assessed ( g ). Scale bar, 100 μm. Data represent the mean ± SD of triplicate samples. Statistical significance was determined by Student’s two-tailed t -test ( g ). One-way ANOVA was performed followed by Turkey’s test ( b ). Images are representative of three independent experiments. Source data are provided as a Source Data file.
Article Snippet: For qPCR analysis, total RNA was reverse transcribed into cDNA with the Superscript First-Strand Synthesis System (Invitrogen) and the reaction was carried out on a 7500 Detection System (Applied Biosystems, Foster City, CA, USA) using the Real-time TaqMan PCR assay kit that included primer sets for NFATc1 (Mm00479445_m1), Acp5 (
Techniques: Infection, Cell Culture, Western Blot, Luciferase, Reporter Assay, Transfection, Plasmid Preparation, Activity Assay, Expressing, Immunoprecipitation, Transgenic Assay, Binding Assay, Translocation Assay, Derivative Assay, Transduction, Control, shRNA, Two Tailed Test
Journal: Nature Communications
Article Title: Selenoprotein W ensures physiological bone remodeling by preventing hyperactivity of osteoclasts
doi: 10.1038/s41467-021-22565-7
Figure Lengend Snippet: a , b Induction of pre-osteoclast fusion and osteoclastic bone resorption by SELENOW. Fusion assay in pre-osteoclasts from wild-type and SELENOW -overexpressing transgenic mice ( a ) or SELENOW −/− mice ( b ). Osteoclast precursors were treated with M-CSF and RANKL for 2 days to form pre-osteoclasts following fusion assay. Osteoclast fusion rate was determined by counting TRAP + MNCs with a diameter ≥100 μm ( n = 3). c , d Pit formation. Osteoclast precursors prepared from wild-type and SELENOW -overexpressing transgenic mice ( c ) or SELENOW −/− mice ( d ) were differentiated into osteoclasts for 4 days. After mature osteoclasts were detached from the culture dish and seeded on dentine slice, cells were further cultured with M-CSF and RANKL for 2 days to allow bone resorption. Pit formation by osteoclasts is expressed as a percentage of the resorbed area on the bone slice surface ( n = 3). e Anti-apoptotic effect of SELENOW. Mature osteoclasts were transduced with SELENOW -overexpressing retrovirus and cell survival was assessed 2 days later by staining with TRAP (upper panels) or FITC-labelled phalloidin (lower panels) to detect TRAP + osteoclasts with a full actin ring ( n = 3). f Caspase activity was assessed at indicated times after mature osteoclasts were cultured as in ( e , n = 3). g Increase in the cellular redox status by SELENOW. Osteoclasts were transduced with SELENOW -overexpressing retrovirus and total thiol content was assessed at indicated times ( n = 3). h Increase in the cellular redox status by NAC. After treatment with 4 mM NAC for 24 h or no treatment, cytosolic extracts of mature osteoclasts were prepared and assayed for free thiol level ( n = 3). i Increased mature osteoclast survival by NAC ( n = 3). Osteoclasts were treated as described in h and then stained as in e . Scale bars, 100 μm. Data represent mean ± SD of triplicate samples. Statistical significance was determined by Student’s two-tailed t -test ( a – e , i ). One-way ANOVA was performed followed by Turkey’s test ( f – h ). Source data are provided as a Source Data file.
Article Snippet: For qPCR analysis, total RNA was reverse transcribed into cDNA with the Superscript First-Strand Synthesis System (Invitrogen) and the reaction was carried out on a 7500 Detection System (Applied Biosystems, Foster City, CA, USA) using the Real-time TaqMan PCR assay kit that included primer sets for NFATc1 (Mm00479445_m1), Acp5 (
Techniques: Single Vesicle Fusion Assay, Transgenic Assay, Cell Culture, Transduction, Staining, Activity Assay, Two Tailed Test
Journal: Radiation research
Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
doi: 10.1667/RADE-22-00206.1
Figure Lengend Snippet: Overview of Participating Teams, Utilized Platforms, Number and Names of Genes or Gene Combinations Used, the Origin of Calibration Samples, and Further Details
Article Snippet: TaqMan assays SYBR Green assay , FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) , BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) , CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG , GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC. , TaqMan ® assay: DDB2 (
Techniques: Generated
Journal: Radiation research
Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
doi: 10.1667/RADE-22-00206.1
Figure Lengend Snippet: Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams
Article Snippet: TaqMan assays SYBR Green assay , FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) , BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) , CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG , GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC. , TaqMan ® assay: DDB2 (
Techniques: Reverse Transcription, Polymerase Chain Reaction, Microarray, Isolation, Red Blood Cell Lysis, Control, Concentration Assay, Sequencing, cDNA Synthesis, Labeling, SYBR Green Assay, Multiplex Assay, TaqMan Assay, Real-time Polymerase Chain Reaction, Software, Extraction
Journal: Radiation research
Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
doi: 10.1667/RADE-22-00206.1
Figure Lengend Snippet: The Table Depicts Team Contributions (from Left to Right) Regarding Employed Genes, Reported Dose Estimates per Reference Sample 1–3, Differences among Reported and Reference Dose-Values as well as the Summed Absolute Difference over all Reference Samples (SAD), a Correct (Yes) or Incorrect (No) Order of Dose Estimates (from Lowest to Highest) Corresponding to Three Dose Categories [Unexposed, Low (1.2 Gy) and Highly Exposed (3.5 Gy)], the Use of FDXR Gene Expression Changes for dose estimation, as well as the Report Time
Article Snippet: TaqMan assays SYBR Green assay , FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) , BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) , CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG , GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC. , TaqMan ® assay: DDB2 (
Techniques: Gene Expression
Journal: Oncogene
Article Title: Epigenomic mapping identifies an enhancer repertoire that regulates cell identity in bladder cancer through distinct transcription factor networks
doi: 10.1038/s41388-023-02662-1
Figure Lengend Snippet: A Cell viability in RT112 and SCaBER under siRNA treatment against FOXA1. B Venn diagram comparing differentially expressed genes in RT112 and SCaBER FOXA1 KD. C GSEA plot of Msig Hallmark GSEA Analysis of genes differentially regulated in RT112 and SCaBER cell lines upon FOXA1 siRNA (2 independent siRNA, 2 replicates). D Heatmap of genes in Hallmark interferon gamma response genes that are differentially regulated in FOXA1 KD vs Ct (min Fold Change = 1,5). E Heatmap of Top Luminal TFs expression in RT112 and SCaBER cell lines upon FOXA1 KD. F PCA projection of TCGA Tumours and CRispR mutant clones on the Basal/Luminal signatures. G GSVA analysis of FOXA1 CRispR mutant clones on Urothelial differentiation signature from Eriksson et al. H GSVA analysis of FOXA1 CRispR mutant clones on Basal TFs identified in Fig. I Overrepresentation analysis of DEG in FOXA1 mutant vs Controls. J Volcano plot of Deseq2 RNA-seq analysis comparing pooled CRispR mutant FOXA1 clones in SD48 and RT112 versus controls. K Transient overexpression of HA-FOXA1 in mutant FOXA1 CRispR clones, wildtype RT112 and SCaBER. qPCR expression of ZBED2 after transfection of HA-FOXA1 relative to control plasmid, 4 days post transfection including 24 h of Puromycin selection ( n = 3 for CrispR clones, n = 2 for WT RT112 and SCaBER). Significance was calculated using 2way ANOVA test ( p -value < 0.05 = *).
Article Snippet: The human bladder cancer-derived
Techniques: Expressing, CRISPR, Mutagenesis, Clone Assay, RNA Sequencing Assay, Over Expression, Transfection, Plasmid Preparation, Selection
Journal: Oncogene
Article Title: Epigenomic mapping identifies an enhancer repertoire that regulates cell identity in bladder cancer through distinct transcription factor networks
doi: 10.1038/s41388-023-02662-1
Figure Lengend Snippet: A TCGA expression of ZBED2 by Subtypes. B TCGA expression Heatmap of ZBED2 and FOXA1 and TCGA correlation between ZBED2 and FOXA1. C Expression of FOXA1 and ZBED2 in single-cell transcriptomics from bladder cancer cell lines in the Cancer Cell Line Encyclopedia (CCLE), highlighting the nearly mutually exclusive expression of these genes. D Genome browser view of ZBED2 and FOXA1 loci in SD48 and 5637 cell lines. E GSEA analysis (Hallmark) of ZBED2 correlated genes in basal cells population of GSM4307111 scRNA-seq Tumour. F GSEA analysis (Hallmark) of gene expression upon siZBED2 KD in RT112 (siZBED2-1 and siZBED2-2). G 3’seq STAT2 and CD274 (PD-L1) expression in RT112 and SCaBER after siZBED2 and siFOXA1.
Article Snippet: The human bladder cancer-derived
Techniques: Expressing, Single-cell Transcriptomics
Journal: Cell Reports Medicine
Article Title: Leucine restriction ameliorates Fusobacterium nucleatum- driven malignant progression and radioresistance in nasopharyngeal carcinoma
doi: 10.1016/j.xcrm.2024.101753
Figure Lengend Snippet: Intracellular F. nucleatum promotes radioresistance in NPC cells by suppressing host apoptosis and DNA damage (A–G) Fn-infected and uninfected NPC cells were exposed to 2, 4, and 8 Gy irradiation, respectively. (A) Representative images of NPC cells. Fn (MOI = 10:1) or E. coli -infected NPC cells (MOI = 1:100). Scale bar: 150 μm. (B) Cellular viability with live/dead assay. Statistical results are presented in the below panels. Data are mean values of three biology repeats. Scale bar: 100 μm. (C) Representative photographs of colony formation assays. Statistical results are presented in the right panels. Data are mean values of three biology repeats. (D) The apoptosis rates were determined by flow cytometry. Statistical results are presented in the right panels. Data are mean values of three biology repeats. (E) LDH activity in supernatant was assessed by LDH Cytotoxicity Assay Kit; optical density (OD) values of 490 nm were present with histogram. (F) Representative images of the comet assay. Statistical results are presented in the right panels. Data are mean values of three biology repeats. (G) Western blot analysis of γH2AX was performed. Statistical results are presented in the right panels. Data are mean values of three biology repeats. Data are shown as mean ± SD. p values were determined by independent sample t tests (C–E and G), ∗ p < 0.05, ∗∗ p < 0.001, and ∗∗∗ p < 0.001.
Article Snippet:
Techniques: Infection, Irradiation, Live Dead Assay, Flow Cytometry, Activity Assay, LDH Cytotoxicity Assay, Single Cell Gel Electrophoresis, Western Blot
Journal: Cell Reports Medicine
Article Title: Leucine restriction ameliorates Fusobacterium nucleatum- driven malignant progression and radioresistance in nasopharyngeal carcinoma
doi: 10.1016/j.xcrm.2024.101753
Figure Lengend Snippet:
Article Snippet:
Techniques: Recombinant, Reverse Transcription, SYBR Green Assay, Viability Assay, ROS Assay, LDH Cytotoxicity Assay, ATP Assay, Sequencing, Virus, Synthesized, Software
Journal: Journal for Immunotherapy of Cancer
Article Title: Dual regulation of CXCR6+CD8+ T cells modulates cytotoxic and exhaustion-associated programs during prostate cancer progression
doi: 10.1136/jitc-2025-014276
Figure Lengend Snippet: M1-like macrophages secrete CXCL16 and support CXCR6 + CD8 + T-cell recruitment but are progressively lost during PCa progression. ( A ) UMAP plot of tumor-infiltrating myeloid cells from PCa tissues, identifying five distinct clusters, including an IL1B + macrophage subset. ( B ) Dot plot showing average expression and detection frequency of selected marker genes across macrophage and dendritic cell (DC) clusters. ( C ) Violin plots illustrating the expression of key pro-inflammatory ( IL1B , TLR2 , CD86 ), anti-inflammatory ( CD163 , MRC1 ), and chemokine ( CXCL16 ) genes across myeloid subsets. ( D ) AUCell-based quantification of M1 and M2 gene signatures across clusters; IL1B + macrophages exhibit the highest M1 signature score. Kruskal-Wallis test, ****p<0.0001. ( E ) CellChat network visualizing outgoing macrophage-derived signals to CD8 + T-cell subsets; IL1B + macrophages prominently interact with CXCR6 + TEff-like CD8 + T cells. ( F ) Bubble plot visualizing the results of ligand–receptor interaction analysis; CXCL16–CXCR6 axis ranks among the strongest predicted signals. ( G ) Gating strategy for the identification of murine bone marrow-derived macrophages (BMDMs) induced with M-CSF. ( H ) Flow cytometry of BMDMs polarized to M1 (IFN-γ+LPS) or M2 (IL-4) states, assessed by CD80 and CD206 expression. ( I ) Confocal images of THP-1-derived macrophages stained for CD68 after PMA induction. ( J ) Flow cytometry of THP-1-derived macrophages polarized to M1 (IFN-γ+LPS) or M2 (IL-4) states, assessed by MHC-II and CD206 expression. ( K ) Immunoblots showing higher CXCL16 levels in M1-polarized BMDMs compared with their M2 counterparts. ( L ) ELISA quantification of secreted CXCL16 in the supernatants of M1-polarized and M2-polarized THP-1-derived macrophages. Mann-Whitney U test, **p<0.01. ( M ) Immunoblot analysis demonstrating elevated levels of CXCL16 in M1-polarized THP-1-derived macrophages compared with M2-polarized cells. (N, O). A total of 5×10⁶ TRAMP-C1 cells suspended in 100 µL PBS were subcutaneously implanted into the right flank of 5–6-week-old male WT C57BL/6J mice (n=5 per group). Tumors were harvested at day 35 (early stage) and day 49 (advanced stage) post-inoculation. Flow cytometric analysis of TAMs revealed a significant reduction in the ratio of MHCII + CD206⁻ (M1-like) to MHCII⁻ CD206 + (M2-like) macrophages during tumor progression. Mann-Whitney U test, **p<0.01. ( P ) Multiplex immunohistochemistry of human PCa tissues (GS=3+4 vs GS=5+5) demonstrated spatial proximity between CXCL16 + M1-like macrophages (HLA-DRA + ) and CXCR6 + CD8 + T cells in lower-grade (GS=3+4) tumors, which was largely diminished in high-grade (GS=5+5) lesions. Black arrows indicate matched regions across serial tissue sections. Scale bars: upper panels, 100 µm; lower panels, 40 µm. AUCell, area under the recovery curve; GS, Gleason Score; M-CSF, macrophage colony-stimulating factor; PCa, prostate cancer; PBS, phosphate-buffered saline; TAMs, tumor-associated macrophages.
Article Snippet: Sections were then incubated overnight at 4°C with primary antibodies against CD8 (Abcam, ab17147; 1:200), CXCR6 (Abcam, ab8023; 1:100), CXCL16 (ProteinTech Group, 60123-1-Ig; 1:100), CD68 (Abcam, ab125212; 1:200), iNOS (Abcam, ab3523; 1:200),
Techniques: Expressing, Marker, Derivative Assay, Flow Cytometry, Staining, Western Blot, Enzyme-linked Immunosorbent Assay, MANN-WHITNEY, Multiplex Assay, Immunohistochemistry, Saline
Journal: Journal for Immunotherapy of Cancer
Article Title: Dual regulation of CXCR6+CD8+ T cells modulates cytotoxic and exhaustion-associated programs during prostate cancer progression
doi: 10.1136/jitc-2025-014276
Figure Lengend Snippet: IL-10–STAT3–FOXO1 signaling reprograms CXCR6 + CD8 + T cells toward a dysfunctional state. ( A ) Dot plot showing the expression of IL10RA , STAT3 , STAT4 , CXCR6 , and related markers across CD8 + T cell subsets in scRNA-seq data. ( B ) IL-10 pathway activity scores across CD8 + T cell clusters. Kruskal-Wallis test, ****p<0.0001. (C, D) Murine splenic CD8 + T cells cultured in a medium containing anti-CD3 (5 µg/mL), anti-CD28 (5 µg/mL), and IL-2 (10 ng/mL) for 48 hours. Following initial activation, cells were maintained in fresh medium supplemented with IL-2 (10 ng/mL) for an additional 7 days. On day 9, cells were treated with 20 ng/mL murine IL-10, IL-15, or STAT3 inhibitor Stattic (2 µM) for 24 hours. The protein expression of STAT3, p-STATS, FOXO1, KLF2, and CXCR6 was assessed by Western blot analysis. (E, F) Flow cytometry of mouse spleen-derived CD8 + T cells shows preferential expression of IL-10R on CXCR6 + CD8 + T cells, with upregulation observed following TCR stimulation (anti-CD3/CD28+IL-2, day 10), indicating heightened susceptibility to IL-10-mediated signaling. (G–I) Flow cytometry of human peripheral blood mononuclear cell (PBMC) CD8 + T cells from healthy donors similarly demonstrates enhanced IL-10R expression on CXCR6 + CD8 + T cells and its induction on TCR stimulation. ( J ) PCA of bulk RNA-seq. Prostate tissues from Pb-Cre; Pten flox/flox ( T ) and WT mice (n=3/group) were profiled by bulk RNA-seq. PCA separated T (blue) from WT (red) chiefly along PC1 (87.24% variance) and PC2 (5.64%). ( K ) Sample-to-sample distance heatmap. Distance matrix based on transformed expression values shows tight clustering of biological replicates within genotype and clear segregation between T and WT. ( L ) Volcano plot. Differential expression analysis between T and WT (cut-offs |log2FC|≥1.5, FDR<0.05). Points are colored by direction (Up=red; Down=blue). Dashed lines indicate thresholds. Il10 , Mrc1 , Cd163 , and Cxcr6 are highlighted in purple; other selected genes are labeled as indicated. Y-axis shows –log 10 (adjusted p). ( M ) Multiplex immunofluorescence (human prostate). Representative fields from human prostate specimens (n=9). Channels: DAPI (nuclei), CD68 (pan-macrophage), HLA-DRA (M1-like macrophage), CD163 (M2-like macrophage), and IL-10. IL-10 signal is enriched in tumor regions and co-localizes with CD68 + CD163 + macrophages. Scale bar: 20 µm. DAPI, 4′,6-diamidino-2-phenylindole; FDR, false discovery rate; PCA, principal component analysis; scRNA-seq, single-cell RNA sequencing; WT, wild-type.
Article Snippet: Sections were then incubated overnight at 4°C with primary antibodies against CD8 (Abcam, ab17147; 1:200), CXCR6 (Abcam, ab8023; 1:100), CXCL16 (ProteinTech Group, 60123-1-Ig; 1:100), CD68 (Abcam, ab125212; 1:200), iNOS (Abcam, ab3523; 1:200),
Techniques: Expressing, Activity Assay, Cell Culture, Activation Assay, Western Blot, Flow Cytometry, Derivative Assay, RNA Sequencing, Transformation Assay, Quantitative Proteomics, Labeling, Multiplex Assay, Immunofluorescence, Single Cell