computational enzyme design tool Search Results


switchbuild software  (Dynamic Biosensors)
90
Dynamic Biosensors switchbuild software
Switchbuild Software, supplied by Dynamic Biosensors, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/computational+enzyme+design+tool/switchbuild+software/10__1002_slash_admt__202101141-183-6-17
Average 90 stars, based on 1 article reviews
switchbuild software - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
vina 1.5.6 software  (AUTODOCK GmbH)
90
AUTODOCK GmbH vina 1.5.6 software
Vina 1.5.6 Software, supplied by AUTODOCK GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/computational+enzyme+design+tool/vina+1+1+2+software/pmc11024978-101-10-9
Average 90 stars, based on 1 article reviews
vina 1.5.6 software - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
tools 1.5.6 software  (AUTODOCK GmbH)
90
AUTODOCK GmbH tools 1.5.6 software
Tools 1.5.6 Software, supplied by AUTODOCK GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/computational+enzyme+design+tool/tools+1+5+6+software/10__22146_slash_ijc__74167-57-13-12
Average 90 stars, based on 1 article reviews
tools 1.5.6 software - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
pro elisa analysis software  (Molecular Devices LLC)
96
Molecular Devices LLC pro elisa analysis software
Pro Elisa Analysis Software, supplied by Molecular Devices LLC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/computational+enzyme+design+tool/SoftMax+Pro+Software/pmc03838437-55-26-30
Average 96 stars, based on 1 article reviews
pro elisa analysis software - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier
aid elispot v7 software  (AID Diagnostika)
90
AID Diagnostika aid elispot v7 software
Aid Elispot V7 Software, supplied by AID Diagnostika, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/computational+enzyme+design+tool/elispot+reader/pmc07332694-141-16-20
Average 90 stars, based on 1 article reviews
aid elispot v7 software - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
p. multocida romph elisa  (MedCalc Software Ltd)
90
MedCalc Software Ltd p. multocida romph elisa
Details of the <t> P. multocida </t> strains used in this study
P. Multocida Romph Elisa, supplied by MedCalc Software Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/computational+enzyme+design+tool/elisa/pmc05559375-60-12-17
Average 90 stars, based on 1 article reviews
p. multocida romph elisa - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
elispot 6.0 software autoimmun diagnostika  (AID Diagnostika)
90
AID Diagnostika elispot 6.0 software autoimmun diagnostika
Details of the <t> P. multocida </t> strains used in this study
Elispot 6.0 Software Autoimmun Diagnostika, supplied by AID Diagnostika, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/computational+enzyme+design+tool/automated+elispot+reader+autoimmun+diagnostika/pmc05869815-152-35-38
Average 90 stars, based on 1 article reviews
elispot 6.0 software autoimmun diagnostika - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
bsa i enzyme  (GoldenGate Software Inc)
90
GoldenGate Software Inc bsa i enzyme
Details of the <t> P. multocida </t> strains used in this study
Bsa I Enzyme, supplied by GoldenGate Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/computational+enzyme+design+tool/bsa+i+enzyme/pmc09937034-35-0-4
Average 90 stars, based on 1 article reviews
bsa i enzyme - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
graphpad prism 10 graphpad  (Oxford Instruments)
99
Oxford Instruments graphpad prism 10 graphpad
Details of the <t> P. multocida </t> strains used in this study
Graphpad Prism 10 Graphpad, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/computational+enzyme+design+tool/Imaris/pm40178982-541-101-114
Average 99 stars, based on 1 article reviews
graphpad prism 10 graphpad - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier
gaindata software  (Arigo Biolaboratories)
86
Arigo Biolaboratories gaindata software
Details of the <t> P. multocida </t> strains used in this study
Gaindata Software, supplied by Arigo Biolaboratories, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/computational+enzyme+design+tool/analysis+data+elisa+gaindata+software/pm40035664-49-19-21
Average 86 stars, based on 1 article reviews
gaindata software - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
cell lines jaws ii dendritic cells atcc atcc crl 11904tm experimental models  (ATCC)
96
ATCC cell lines jaws ii dendritic cells atcc atcc crl 11904tm experimental models
Details of the <t> P. multocida </t> strains used in this study
Cell Lines Jaws Ii Dendritic Cells Atcc Atcc Crl 11904tm Experimental Models, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/computational+enzyme+design+tool/JAWSII/pmc09421537__mmc2-540-187-193
Average 96 stars, based on 1 article reviews
cell lines jaws ii dendritic cells atcc atcc crl 11904tm experimental models - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier
g0345 pspax2 addgene  (Addgene inc)
98
Addgene inc g0345 pspax2 addgene
KEY RESOURCES TABLE
G0345 Pspax2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/computational+enzyme+design+tool/pMD2%2EG+(Plasmid+%2312259)/pmc07266008-1112-151-153
Average 98 stars, based on 1 article reviews
g0345 pspax2 addgene - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier

Image Search Results


Details of the P. multocida strains used in this study

Journal: The Journal of Veterinary Medical Science

Article Title: Ducks as a potential reservoir for Pasteurella multocida infection detected using a new rOmpH-based ELISA

doi: 10.1292/jvms.17-0124

Figure Lengend Snippet: Details of the P. multocida strains used in this study

Article Snippet: The ROC was set up to determine the cutoff value of the P. multocida rOmpH ELISA in MedCalc for Windows, version 9.2.0.1 (MedCalc Software, Ostend, Belgium).

Techniques: Isolation

A phylogenetic tree based on the ompH gene sequences of the P. multocida strain F39 and other P. multocida strains of different serotypes or from different hosts.

Journal: The Journal of Veterinary Medical Science

Article Title: Ducks as a potential reservoir for Pasteurella multocida infection detected using a new rOmpH-based ELISA

doi: 10.1292/jvms.17-0124

Figure Lengend Snippet: A phylogenetic tree based on the ompH gene sequences of the P. multocida strain F39 and other P. multocida strains of different serotypes or from different hosts.

Article Snippet: The ROC was set up to determine the cutoff value of the P. multocida rOmpH ELISA in MedCalc for Windows, version 9.2.0.1 (MedCalc Software, Ostend, Belgium).

Techniques:

SDS-PAGE and western blotting analysis of expressed and purified rOmpH. A) SDS-PAGE analysis of expressed and purified rOmpH. Lane M, protein molecular mass markers; lane 1, a sonicated whole-cell lysate of pET32a-ompH/BL21; lane 2, a sonicated whole-cell lysate of induced pET32a-ompH/BL21; lane 3, purified rOmpH. B) A western blot of purified rOmpH. Lane M, protein molecular mass markers; lane 1, purified rOmpH.

Journal: The Journal of Veterinary Medical Science

Article Title: Ducks as a potential reservoir for Pasteurella multocida infection detected using a new rOmpH-based ELISA

doi: 10.1292/jvms.17-0124

Figure Lengend Snippet: SDS-PAGE and western blotting analysis of expressed and purified rOmpH. A) SDS-PAGE analysis of expressed and purified rOmpH. Lane M, protein molecular mass markers; lane 1, a sonicated whole-cell lysate of pET32a-ompH/BL21; lane 2, a sonicated whole-cell lysate of induced pET32a-ompH/BL21; lane 3, purified rOmpH. B) A western blot of purified rOmpH. Lane M, protein molecular mass markers; lane 1, purified rOmpH.

Article Snippet: The ROC was set up to determine the cutoff value of the P. multocida rOmpH ELISA in MedCalc for Windows, version 9.2.0.1 (MedCalc Software, Ostend, Belgium).

Techniques: SDS Page, Western Blot, Purification, Sonication

ROC analysis of the rOmpH ELISA. A) ROC curves based on results of the rOmpH ELISA ( n =115). B) The relation of ROC-based estimates of test sensitivity and specificity with the rOmpH ELISA cutoffs. C) An interactive dot diagram based on rOmpH ELISA outcomes in relation to the MAT (MAT negative=0 and MAT positive=1).

Journal: The Journal of Veterinary Medical Science

Article Title: Ducks as a potential reservoir for Pasteurella multocida infection detected using a new rOmpH-based ELISA

doi: 10.1292/jvms.17-0124

Figure Lengend Snippet: ROC analysis of the rOmpH ELISA. A) ROC curves based on results of the rOmpH ELISA ( n =115). B) The relation of ROC-based estimates of test sensitivity and specificity with the rOmpH ELISA cutoffs. C) An interactive dot diagram based on rOmpH ELISA outcomes in relation to the MAT (MAT negative=0 and MAT positive=1).

Article Snippet: The ROC was set up to determine the cutoff value of the P. multocida rOmpH ELISA in MedCalc for Windows, version 9.2.0.1 (MedCalc Software, Ostend, Belgium).

Techniques: Enzyme-linked Immunosorbent Assay

Comparison of the indirect ELISA and the MAT

Journal: The Journal of Veterinary Medical Science

Article Title: Ducks as a potential reservoir for Pasteurella multocida infection detected using a new rOmpH-based ELISA

doi: 10.1292/jvms.17-0124

Figure Lengend Snippet: Comparison of the indirect ELISA and the MAT

Article Snippet: The ROC was set up to determine the cutoff value of the P. multocida rOmpH ELISA in MedCalc for Windows, version 9.2.0.1 (MedCalc Software, Ostend, Belgium).

Techniques: Comparison, Indirect ELISA, Enzyme-linked Immunosorbent Assay

The detection rate of anti- P. multocida antibodies in serum samples (collected during 2015) from healthy-looking ducks

Journal: The Journal of Veterinary Medical Science

Article Title: Ducks as a potential reservoir for Pasteurella multocida infection detected using a new rOmpH-based ELISA

doi: 10.1292/jvms.17-0124

Figure Lengend Snippet: The detection rate of anti- P. multocida antibodies in serum samples (collected during 2015) from healthy-looking ducks

Article Snippet: The ROC was set up to determine the cutoff value of the P. multocida rOmpH ELISA in MedCalc for Windows, version 9.2.0.1 (MedCalc Software, Ostend, Belgium).

Techniques:

KEY RESOURCES TABLE

Journal: Cell

Article Title: Endocrine-exocrine signaling drives obesity-associated pancreatic ductal adenocarcinoma

doi: 10.1016/j.cell.2020.03.062

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Davis (University of Wisconsin) N/A Mouse: Kras LSL-G12D : B6.129S4- Kras tm4Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008179, RRID:IMSR_JAX:008179 Mouse: p53 KO/WT :129- Trp53 tm1Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:002080, RRID:IMSR_JAX:002080 Mouse: p53 R172H/WT : 129S-Trp53 tm2Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008652, RRID:IMSR_JAX:008652 Mouse: Kras LA2 :129S/Sv- Kras tm3Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008185, RRID:IMSR_JAX:008185 Mouse: C57BL/6J : C57/B6 Jackson Laboratories IMSR Cat# JAX:000664, RRID:IMSR_JAX:000664 Oligonucleotides Leptin cDNA Reverse Koch Institute Swanson Biotechnology Center TCAGCATTCAGGGCTAACATCCAACT mLepR sgRNA Forward Keck Biotechnology Center at Yale CACCGTGAAAGCCACCAGACCTCGA mLepR sgRNA Reverse Keck Biotechnology Center at Yale AAACTCGAGGTCTGGTGGCTTTCAC mLepR Target Site Forward Keck Biotechnology Center at Yale GGTTCTCAGTGCACGCATTT mLepR Target Site Reverse Keck Biotechnology Center at Yale ACAACGATTTTCCTGGCATCT Leptin cDNA Forward Koch Institute Swanson Biotechnology Center ATGTGCTGGAGACCCCTGT Recombinant DNA lentiGuide-puro Addgene Cat# 52963 lentiCas9-blast Addgene Cat# 52962 pFBAAVCAGmcsBgHpa University of Iowa Viral Vector Core Cat# G0345 psPAX2 Addgene Cat# 12259 pCMV-VSV-G Addgene Cat# 8454 Software and Algorithms ImageJ NIH N/A QuPath v0.1.2 Github N/A Prism v8.0 Graphpad N/A Image Studio Lite LI-COR N/A PHATE https://github.com/KrishnaswamyLab/PHATE N/A MAGIC https://github.com/KrishnaswamyLab/MAGIC N/A FASTX-toolkit Greg Hannon lab ( http://hannonlab.cshl.edu/fastx_toolkit ) N/A Burrows-Wheeler Aligner v0.5.5 Source Forge N/A Picard toolkit v1.21 Github N/A GATK v.1.0.5538 Broad Institute N/A ANNOVAR http://annovar.openbioinformatics.org/ N/A RSEM v.1.2.12 Dewey lab/Github N/A Cytoscape v.3.3.0 Cytoscape Consortium N/A Cell Ranger 10X Genomics N/A SAS v9.4 SAS Institute, Inc. N/A MELD https://github.com/KrishnaswamyLab/MELD N/A diffxpy https://github.com/theislab/diffxpy/ N/A R package JADE https://www.rdocumentation.org/packages/JADE/versions/1.1-0 N/A Open in a separate window KEY RESOURCES TABLE

Techniques: Virus, Plasmid Preparation, Generated, Transplantation Assay, Recombinant, DNA Extraction, Lysis, Extraction, Blocking Assay, Western Blot, Enzyme-linked Immunosorbent Assay, Cell Viability Assay, Reverse Transcription, Bicinchoninic Acid Protein Assay, Picogreen Assay, Derivative Assay, Software