|
Addgene inc
cloning rab3c cds ![]() Cloning Rab3c Cds, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cloning+rab3c+cds/pmc07907685-431-51-63?v=Addgene+inc Average 92 stars, based on 1 article reviews
cloning rab3c cds - by Bioz Stars,
2026-08
92/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Developmental Cell
Article Title: Combined kinesin-1 and kinesin-3 activity drives axonal trafficking of TrkB receptors in Rab6 carriers
doi: 10.1016/j.devcel.2021.01.010
Figure Lengend Snippet: Anterogradely transported RUSH-TrkB carriers are negative for Rab27B, Rab3C, Rab8A, and Rab11A (A–L) Neurons co-expressing RUSH-TrkB-GFP and labeled Rab proteins: (A–C) mRuby3-Rab27B, (D–F) mRuby3-Rab3C, (G–I) mRFP-Rab8A, and (J–L) mRFP-Rab11A. Neurons were live imaged in the soma area immediately after addition of biotin for 45 min at 1 frame/min (A, D, G, and J), and then we imaged for 5 min at 1 s/frame at the proximal axon during a time window of 45–90 min after addition of biotin (C, F, I, and L). Plots show RUSH-TrkB and Rab proteins intensities in the peri-nuclear Golgi region over time in representative neurons (B, E, H, and K). Kymographs of RUSH-TrkB-GFP and respective Rab proteins motility in individual axons (C, F, I, and L).
Article Snippet: GFP-Rab6A and mCherry-Rab6A were previously cloned in-house by inserting human Rab6A CDS into pGW2-GFP and pGW2-mCherry (modified pGW1) backbones. mCherry-Rab6A-Q72L and mCherry-Rab6A-T27N were constructed by site-directed mutagenesis of mCherry-Rab6A using circular PCR with the following primers: Q72L-Fw: ACAGCAGGTCTAGAGCGGTTC, Q72L-Rev: GTCCCATAATTGCAATCGTAC, T27N-Fw: GTTGGAAAGAACTCTTTGATCACCAGATTCATGTATGACAG and T27N-Rev: GCTTTGCTCCCCCAGGAA. mRuby3-Rab3C and mRuby3-Rab27B were constructed by
Techniques: Expressing, Labeling
Journal: Developmental Cell
Article Title: Combined kinesin-1 and kinesin-3 activity drives axonal trafficking of TrkB receptors in Rab6 carriers
doi: 10.1016/j.devcel.2021.01.010
Figure Lengend Snippet:
Article Snippet: GFP-Rab6A and mCherry-Rab6A were previously cloned in-house by inserting human Rab6A CDS into pGW2-GFP and pGW2-mCherry (modified pGW1) backbones. mCherry-Rab6A-Q72L and mCherry-Rab6A-T27N were constructed by site-directed mutagenesis of mCherry-Rab6A using circular PCR with the following primers: Q72L-Fw: ACAGCAGGTCTAGAGCGGTTC, Q72L-Rev: GTCCCATAATTGCAATCGTAC, T27N-Fw: GTTGGAAAGAACTCTTTGATCACCAGATTCATGTATGACAG and T27N-Rev: GCTTTGCTCCCCCAGGAA. mRuby3-Rab3C and mRuby3-Rab27B were constructed by
Techniques: Recombinant, Derivative Assay, shRNA, Sequencing, Mutagenesis, Plasmid Preparation, Software