|
Proteintech
anti ck2α cst Anti Ck2α Cst, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ck2%CE%B1/pm38561350__ja3c14380_si_001-132-39-52?v=Proteintech Average 93 stars, based on 1 article reviews
anti ck2α cst - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
SuperArray Bioscience Corporation
primer sets ck2α #pph01514a ![]() Primer Sets Ck2α #Pph01514a, supplied by SuperArray Bioscience Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ck2%CE%B1/pmc02872066-93-7-4?v=SuperArray+Bioscience+Corporation Average 90 stars, based on 1 article reviews
primer sets ck2α #pph01514a - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Biaffin Inc
recombinant maize ck2 α-subunit ![]() Recombinant Maize Ck2 α Subunit, supplied by Biaffin Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ck2%CE%B1/pmc02899928-459-15-24?v=Biaffin+Inc Average 90 stars, based on 1 article reviews
recombinant maize ck2 α-subunit - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
CEM Corporation
inhibitor of ck2α (4,5,6,7- tetrabromo-2-methyl-1h-benzimidazol-1-yl)acetonitrile (2b) ![]() Inhibitor Of Ck2α (4,5,6,7 Tetrabromo 2 Methyl 1h Benzimidazol 1 Yl)acetonitrile (2b), supplied by CEM Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ck2%CE%B1/pm30061228-36-7-21?v=CEM+Corporation Average 90 stars, based on 1 article reviews
inhibitor of ck2α (4,5,6,7- tetrabromo-2-methyl-1h-benzimidazol-1-yl)acetonitrile (2b) - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
GeneTex
polyclonal rabbit anti-ck2α primary antibody gtx107897 ![]() Polyclonal Rabbit Anti Ck2α Primary Antibody Gtx107897, supplied by GeneTex, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ck2%CE%B1/pm38381246-50-1-10?v=GeneTex Average 90 stars, based on 1 article reviews
polyclonal rabbit anti-ck2α primary antibody gtx107897 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
ck2α ![]() Ck2α, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ck2%CE%B1/pmc11570452-426-4-5?v=GenScript+corporation Average 90 stars, based on 1 article reviews
ck2α - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
AUM Biotech
aum silence aso ck2α: tagtctgttaacgtctggtac ![]() Aum Silence Aso Ck2α: Tagtctgttaacgtctggtac, supplied by AUM Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ck2%CE%B1/pmc11570452-57-0-7?v=AUM+Biotech Average 90 stars, based on 1 article reviews
aum silence aso ck2α: tagtctgttaacgtctggtac - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
ATGen Inc
recombinant ck2α ![]() Recombinant Ck2α, supplied by ATGen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ck2%CE%B1/pmc03408420-246-8-10?v=ATGen+Inc Average 90 stars, based on 1 article reviews
recombinant ck2α - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Akela Pharma
anti-calnexin antibody ![]() Anti Calnexin Antibody, supplied by Akela Pharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ck2%CE%B1/pmc04188751-132-8-10?v=Akela+Pharma Average 90 stars, based on 1 article reviews
anti-calnexin antibody - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
ProteinKinase
recombinant ck2α ![]() Recombinant Ck2α, supplied by ProteinKinase, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ck2%CE%B1/pmc03302271-120-42-53?v=ProteinKinase Average 90 stars, based on 1 article reviews
recombinant ck2α - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Ribobio co
sirna against ck2α ![]() Sirna Against Ck2α, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ck2%CE%B1/pmc05640650-252-12-24?v=Ribobio+co Average 90 stars, based on 1 article reviews
sirna against ck2α - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Bioworld Antibodies
rabbit polyclonal anti-ck2α’ antibody ![]() Rabbit Polyclonal Anti Ck2α’ Antibody, supplied by Bioworld Antibodies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ck2%CE%B1/pmc05938699-187-210-215?v=Bioworld+Antibodies Average 90 stars, based on 1 article reviews
rabbit polyclonal anti-ck2α’ antibody - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal:
Article Title: Protein B23/Nucleophosmin/Numatrin nuclear dynamics in Relation to Protein Kinase CK2 and Apoptotic Activity in Prostate Cells
doi: 10.1021/bi9021928
Figure Lengend Snippet: Status of B23 in the cytoplasm and NM fractions of prostate cancer cells in response to CK2 specific inhibitor TBB mediated induction of apoptosis. A, TUNEL staining of ALVA-41 and PC-3 cells treated with varying doses of TBB (from 50 to 150 µM). Induction of apoptosis is shown. Cells were counterstained with Hoechst 33342 to identify nuclear component. B, cytoplasmic and NM associated B23 in ALVA-41 and PC-3 cells treated with TBB at varying concentrations as under A. The relative change in the protein bands is calculated compared to the respective control and normalized to the β-actin in the sample (e.g., lanes 2 and 3 from left in Fig. 1B had a higher amount of protein to ensure visualization of B23 signal in the nuclear matrix). C, effect of TBB and apigenin on CK2 activity at the concentrations of the inhibitors shown. D, measurement of the message expression for CK2α in ALVA-41 and PC-3 cells under the same conditions as for C. E, measurement of B23 message in ALVA-41 and PC-3 cells under the same conditions as for C.
Article Snippet: Primer sets were from
Techniques: TUNEL Assay, Staining, Control, Activity Assay, Expressing
Journal:
Article Title: Protein B23/Nucleophosmin/Numatrin nuclear dynamics in Relation to Protein Kinase CK2 and Apoptotic Activity in Prostate Cells
doi: 10.1021/bi9021928
Figure Lengend Snippet: Status of B23 in the cytoplasm and NM fractions of prostate cancer cells in response to siRNA-mediated downregulation of CK2. A, cell viability was determined by WST-1 assay in ALVA-41 and PC-3 cells transfected with varying concentrations of CK2••′ siRNA for the periods of time shown. B, ALVA-41 and PC-3 cells were transfected with varying concentrations of CK2αα′ siRNA as under A. Cyclophilin B (Dharmacon, Catalog: D-001136-01-05) was employed as a control. All other details were as described under Experimental Procedures. TUNEL staining shows the induction of apoptosis in cells treated with CK2 siRNA. Cells were counterstained with Hoechst 33342 to identify nuclei. C, immunoblot analysis of cytoplasmic and NM associated B23 and CK2••′ was carried out in ALVA-41 and PC-3 cells transfected with varying concentrations of CK2••′ siRNA. Lane a, untreated control; lane b, 5 nM CK2••′ siRNA; lane c, 10 nM CK2••′ siRNA; lane d, 50 nM CK2αα′ siRNA; lane e, untreated control; lane f, DharmaFECT control, lane g, 10 nM CK2αα′ siRNA; lane h, 100 nM CK2αα′ siRNA. The relative change in the protein bands is calculated compared to the respective control.
Article Snippet: Primer sets were from
Techniques: WST-1 Assay, Transfection, Control, TUNEL Assay, Staining, Western Blot
Journal:
Article Title: Protein B23/Nucleophosmin/Numatrin nuclear dynamics in Relation to Protein Kinase CK2 and Apoptotic Activity in Prostate Cells
doi: 10.1021/bi9021928
Figure Lengend Snippet: Effect of apoptosis inducing conditions on NM-associated B23. A, prostate cancer cells (ALVA-41) were treated with doses of etoposide, or CK2 inhibitors (TBB or Apigenin) at doses that are sub-optimal for induction of apoptosis. The results show a minimal effect on cell death under these conditions. When the sub-optimal doses of the same inhibitors are combined it results in induction of apoptosis, as shown in the chart. Illustrated in A are the data employing etoposide (an apoptosis-inducing agent) with and without CK2 inhibitors TBB or apigenin. Similar effects have previously been reported using TRAIL (an apoptosis-inducing agent) with and without TBB at sub-optimal doses (27) (the latter conditions were employed in the experiment shown under C. B, NM-associated B23 immunoreactive protein in cells treated with TBB, apigenin and etoposide, as shown. Lane a, control; lane b, 20 µM etoposide (sub-optimal for induction of apoptosis); lane c, TBB at 40 µM (sub-optimal for induction of apoptosis); lane d, etoposide plus TBB (combined effect to produce apoptotic activity); lane e, apigenin at 20 µM (insufficient for induction of apoptosis); lane f, apigenin plus etoposide (combined effect to produce apoptotic activity). Densitometric values are calculated relative to the level in control cells. C, NM-associated B23 immunoreactive protein in cells treated with TBB, apigenin and TRAIL as shown. Lane a, control; lane b, TRAIL 2 ng/ml (sub-optimal dose which is insufficient for induction of apoptosis); lane c, TBB at 40 µM (sub-optimal dose for induction of apoptosis); lane d, TBB plus TRAIL (combined effect evokes apoptotic activity); lane e, apigenin at 20 µM (insufficient dose for induction of apoptosis); lane f, TRAIL plus apigenin (conditions to induce apoptotic activity). Relative densitometric values are based on level in the control cells. D, combined effect of TBB and TRAIL (both at sub-optimal doses) in causing induction of apoptosis is illustrated by cleavage of lamin A in treated cells, as shown. Lane a, control; lane b, 60 µM TBB (insufficient for induction of apoptosis) showing no cleavage of Lamin A; lane c, 2 ng/ml of TRAIL (insufficient for apoptosis induction) as indicated by a minimal cleavage of Lamin A; lane d, 60 µM TBB plus 2 ng/ml of TRAIL resulting in potent induction of apoptosis as indicated by extensive cleavage of Lamin A. These results accord with the corresponding effect on NM-associated B23 as shown under C. In all cases, equal amount of protein was loaded in the gels, and each experiment was confirmed at least three times.
Article Snippet: Primer sets were from
Techniques: Control, Activity Assay
Journal:
Article Title: Protein B23/Nucleophosmin/Numatrin nuclear dynamics in Relation to Protein Kinase CK2 and Apoptotic Activity in Prostate Cells
doi: 10.1021/bi9021928
Figure Lengend Snippet: Effect of overexpression of CK2α on the status of NM-associated B23 in prostate cancer cells treated with apoptotic inducers. ALVA-41 and PC-3 cells were treated with etoposide or TRAIL at apoptosis inducing concentrations in the absence or presence of forced overexpression of the catalytic subunit CK2α as described under Experimental Procedures. A, treatment with TRAIL at 10 ng/ml for ALVA-41 and 20 ng/ml for PC-3 cells (for 24 h) was carried out to induce apoptotic condition in cells. pcDNA6-CK2α expression vector (2.0 µg/ml) was employed to achieve overexpression of CK2α in ALVA-41 and PC-3 cells, as indicated. NM-associated B23 is shown for each experimental condition; there was no change in cytoplasmic B23 immunoreactive B23 under these conditions (not shown). Lane a, control cells treated with pcDNA6; lane b, pcDNA6 plus TRAIL; lane c, pcDNA6-CK2α; and lane d, pcDNA6-CK2α plus TRAIL. B, treatment of ALVA-41 and PC-3 cells with 50 µM etoposide (apoptosis-inducing level). Overexpression of CK2α was achieved as described under A. NM-associated immunoreactive B23 is shown. Lane a, pcDNA6 control; lane b, pcDNA6 plus 50 µM etoposide for 48 h; lane c, pcDNA6-CK2α; and lane d, pcDNA6-CK2α plus etoposide. C, a representative experiment showing confirmation of CK2α overexpression in PC-3 cells by transient transfection with pcDNA6-CK2α is illustrated by analysis of the message and protein levels.
Article Snippet: Primer sets were from
Techniques: Over Expression, Expressing, Plasmid Preparation, Control, Transfection
Journal:
Article Title: Protein B23/Nucleophosmin/Numatrin nuclear dynamics in Relation to Protein Kinase CK2 and Apoptotic Activity in Prostate Cells
doi: 10.1021/bi9021928
Figure Lengend Snippet: Colocalization of CK2α and B23 in the nucleus. A, double immunofluorescence staining for anti-CK2α and anti-B23 was carried out in ALVA-41 cells treated with varying doses of TBB, as shown. Merged image of the immunofluorescence stains for anti-CK2α and anti-B23 shows co-localization of the two proteins in the nucleus. Downregulation of CK2 by TBB treatment (producing apoptotic condition) shows co-ordinate loss of B23 and CK2α in the nucleus. B, double immunofluorescence staining for anti-CK2α and anti-B23 was carried out in PC-3 cells treated with varying doses of TBB. All details are the same as for A. Results confirm the co-localization of CK2α and B23 in the nucleus and its reduction on induction of apoptotic condition induced by TBB mediated inhibition of CK2 as observed for ALVA-41 cells under A.
Article Snippet: Primer sets were from
Techniques: Double Immunofluorescence Staining, Immunofluorescence, Inhibition
Journal:
Article Title: Protein B23/Nucleophosmin/Numatrin nuclear dynamics in Relation to Protein Kinase CK2 and Apoptotic Activity in Prostate Cells
doi: 10.1021/bi9021928
Figure Lengend Snippet: Effect of altered androgenic status on CK2α and B23 levels in rat ventral prostate tissue. Lysate, cytoplasm and nuclear matrix fractions were isolated from prostatic tissue of rats subjected to various treatments as shown. Each fraction was analyzed by Western blotting for the presence of immunoreactive CK2α, B23 and lamin A. A, level of B23 in total lysates from prostatic tissues isolated from rats with altered androgenic status. Lane a, control rats; lanes b to d, rats orchiectomized for 1, 2, and 3 days, respectively. B, detection of protein CK2α, B23 and lamin A in cytoplasm and NM fractions isolated from prostate tissue of normal rats, or rats subjected to altered androgenic status. Lane a, control rats; lane b, 3-day orchiectomized rats; lane c, 6-day orchiectomized rats; lane d, 6-day orchiectomized rats given 5α-DHT for 4 days; lane e, same as lane d except that 5α-DHT was administered for 7 days. Breakdown of lamin A (to 28 kDa fragment) in the NM fraction indicates apoptotic condition. All other details are as described under Experimental Procedures.
Article Snippet: Primer sets were from
Techniques: Isolation, Western Blot, Control
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet: Endogenous and exogenous MOTS-c regulates CK2 activity in the skeletal muscle (A–C) CK2 activity assessed by detecting endogenous proteins containing a pS/pTDXE motif and MOTS-c expression levels in gastrocnemius muscle from young control (2 months) and aged (22 months) mice ( n = 4 per group). (D–F) Effect of 4 weeks of voluntary wheel running exercise on CK2 activity and MOTS-c expression levels in gastrocnemius muscle from young mice ( n = 4 per group). (G and H) Effect of 8 weeks of MOTS-c administration (5 mg/kg/day) on CK2 activity in quadriceps muscle from high-fat-diet (HFD)-fed mice ( n = 4 per group). (I) Summary of MOTS-c and CK2 activity in the skeletal muscle. Data are represented as mean ± SEM for (B, C, E, F, and H). ∗∗ p < 0.01.
Article Snippet: First, 70 nM of
Techniques: Activity Assay, Expressing, Control
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet: MOTS-c directly binds and activates CK2 in cell-free systems (A–C) Dot blot assays with (A) CK2 complex (contains both CK2α and CK2β subunits) immobilized, MOTS-c flowed over the membrane, and detected by MOTS-c antibody. (B–C) MOTS-c immobilized, CK2 complex flowed over the membrane, and detected by CK2α (B) and CK2β (C) antibodies. (D) CK2α or CK2β immobilized, MOTS-c flowed over the membrane, and detected by MOTS-c antibody. FO, flow over; IB, immunoblotting. (E): Surface plasmon resonance (Biacore assay) of MOTS-c (10 μg/mL) and CK2α (2.5 nM, 5.0 nM, 10 nM, and 20 nM). MOTS-c was immobilized on the sensor chip and CK2α flowed over the sensor chip. K D , dissociation constant. (F) Molecular docking simulation of the binding between MOTS-c and CK2α by using AlphaFold2. (G) CK2 activity assessed by kinase activity assay with/without MOTS-c in cell-free condition. A different dose of MOTS-c (0–100 μM) was used for the assay. Data are represented as mean ± SEM for (G). ∗ p < 0.05, ∗∗ p < 0.01 versus CK2 without MOTS-c group.
Article Snippet: First, 70 nM of
Techniques: Dot Blot, Membrane, Western Blot, SPR Assay, Binding Assay, Activity Assay, Kinase Assay
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet: MOTS-c modulates CK2 activity in a tissue-specific manner (A) Experimental design of a single MOTS-c administration (7.5 mg/kg) experiment in young mice ( n = 5 per time point). (B) Plasma MOTS-c levels after MOTS-c administration. ∗: p < 0.05 versus time 0. (C) Quantification of CK2 activity assessed by western blotting in each tissue shown in (E–F). (E–F) CK2 activity assessed by western blotting with p-CK2 substrate antibody in gastrocnemius muscle (D), epididymal fat (E), and liver (F) after MOTS-c administration. ∗ p < 0.05, ∗∗ p < 0.01 versus time 0 in same tissue. (G–I) MOTS-c detection following CK2α immunoprecipitation (IP) in gastrocnemius muscle (G), epididymal fat (H), and liver (I) 30 min after MOTS-c administration (7.5 mg/kg). The "-" indicates tissues from non-MOTS-c administered mice, while the "+" indicates tissues from MOTS-c administered mice. (J–K) CK2 activity after 10 min MOTS-c treatment (10 μM) in differentiated skeletal muscle (J) and adipocyte (K). Data are represented as mean ± SEM for (B, C, J, and K).
Article Snippet: First, 70 nM of
Techniques: Activity Assay, Western Blot, Immunoprecipitation
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet: MOTS-c modulates the CK2 interactome in a tissue-specific manner (A) Experimental design for the interactome analyses in young mice ( n = 3 per condition). Proteome analysis was performed following CK2α immunoprecipitation in gastrocnemius muscle and epididymal fat with/without MOTS-c administration. (B) Principal components (PCs) of control and MOTS-c-treated mouse gastrocnemius muscle and epididymal fat. (C) Venn diagram of interacting proteins in each condition. (D–E) Numbers of CK2 interacting proteins (D) and enriched Reactome pathways (E) in gastrocnemius muscle. (F–G) Numbers of CK2 interacting proteins (F) and enriched Reactome pathways (G) in epididymal fat. (H) Interacting proteins and significantly enriched Reactome pathways in MOTS-c-administered gastrocnemius muscle compared to the control group. The protein-protein interactions and enrichment analysis were assessed by using the STRING database. (I) Summary of the interactome analysis in gastrocnemius muscle and epididymal fat.
Article Snippet: First, 70 nM of
Techniques: Immunoprecipitation, Control
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet: A naturally occurring K14Q MOTS-c is a bio-inactive form of MOTS-c due to its reduced binding to CK2 alpha (A) Nucleotide and amino acid substitutions of naturally occurring MOTS-c variant K14Q MOTS-c, which modulates skeletal muscle function and increases type 2 diabetes risk. (B) Comparison of reciprocal K D between WT and K14Q MOTS-c assessed by the surface plasmon resonance (Biacore) assay. (C) Comparison of CK2 activating effects between WT MOTS-c and K14Q MOTS-c in cell-free condition ( n = 3 per group). MOTS-c concentrations are 0, 0.8, 1.6, 3.1, 6.3, 12.5, and 25 μM ∗ p < 0.05, ∗∗ p < 0.01 versus control. # p < 0.05 versus same concentration of K14Q MOTS-c. (D–E) Comparison of gastrocnemius muscle CK2 activity between WT MOTS-c- and K14Q MOTS-c-administered young mice (2.5 mg/kg, n = 5 per group). ∗ p < 0.05 versus control group. (F) Protective effect of MOTS-c administration (WT or K14Q MOTS-c, 15 mg/kg/day, IP injection) against 8 days of immobilization-induced skeletal muscle atrophy ( n = 8 per group). Skeletal muscle mass was assessed by a total mass of gastrocnemius, plantaris, and soleus muscles. ∗ p < 0.05, ∗∗ p < 0.01. (G)Skeletal muscle 2-deoxy-d-glucose (2DG) uptake after MOTS-c administration (WT or K14Q, 7.5 mg/kg) with/without CK2 inhibitor (CX-4945, 25 mg/kg) ( n = 10–11 per group). ∗ p < 0.05. Data are represented as mean ± SEM for (C, E, F, and G).
Article Snippet: First, 70 nM of
Techniques: Binding Assay, Variant Assay, Comparison, SPR Assay, Control, Concentration Assay, Activity Assay, Injection, Muscles
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet:
Article Snippet: First, 70 nM of
Techniques: Recombinant, RNA Sequencing Assay, Software, Immunoprecipitation, Blocking Assay, Western Blot, Bicinchoninic Acid Protein Assay
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet: Endogenous and exogenous MOTS-c regulates CK2 activity in the skeletal muscle (A–C) CK2 activity assessed by detecting endogenous proteins containing a pS/pTDXE motif and MOTS-c expression levels in gastrocnemius muscle from young control (2 months) and aged (22 months) mice ( n = 4 per group). (D–F) Effect of 4 weeks of voluntary wheel running exercise on CK2 activity and MOTS-c expression levels in gastrocnemius muscle from young mice ( n = 4 per group). (G and H) Effect of 8 weeks of MOTS-c administration (5 mg/kg/day) on CK2 activity in quadriceps muscle from high-fat-diet (HFD)-fed mice ( n = 4 per group). (I) Summary of MOTS-c and CK2 activity in the skeletal muscle. Data are represented as mean ± SEM for (B, C, E, F, and H). ∗∗ p < 0.01.
Article Snippet:
Techniques: Activity Assay, Expressing, Control
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet: MOTS-c directly binds and activates CK2 in cell-free systems (A–C) Dot blot assays with (A) CK2 complex (contains both CK2α and CK2β subunits) immobilized, MOTS-c flowed over the membrane, and detected by MOTS-c antibody. (B–C) MOTS-c immobilized, CK2 complex flowed over the membrane, and detected by CK2α (B) and CK2β (C) antibodies. (D) CK2α or CK2β immobilized, MOTS-c flowed over the membrane, and detected by MOTS-c antibody. FO, flow over; IB, immunoblotting. (E): Surface plasmon resonance (Biacore assay) of MOTS-c (10 μg/mL) and CK2α (2.5 nM, 5.0 nM, 10 nM, and 20 nM). MOTS-c was immobilized on the sensor chip and CK2α flowed over the sensor chip. K D , dissociation constant. (F) Molecular docking simulation of the binding between MOTS-c and CK2α by using AlphaFold2. (G) CK2 activity assessed by kinase activity assay with/without MOTS-c in cell-free condition. A different dose of MOTS-c (0–100 μM) was used for the assay. Data are represented as mean ± SEM for (G). ∗ p < 0.05, ∗∗ p < 0.01 versus CK2 without MOTS-c group.
Article Snippet:
Techniques: Dot Blot, Membrane, Western Blot, SPR Assay, Binding Assay, Activity Assay, Kinase Assay
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet: MOTS-c modulates CK2 activity in a tissue-specific manner (A) Experimental design of a single MOTS-c administration (7.5 mg/kg) experiment in young mice ( n = 5 per time point). (B) Plasma MOTS-c levels after MOTS-c administration. ∗: p < 0.05 versus time 0. (C) Quantification of CK2 activity assessed by western blotting in each tissue shown in (E–F). (E–F) CK2 activity assessed by western blotting with p-CK2 substrate antibody in gastrocnemius muscle (D), epididymal fat (E), and liver (F) after MOTS-c administration. ∗ p < 0.05, ∗∗ p < 0.01 versus time 0 in same tissue. (G–I) MOTS-c detection following CK2α immunoprecipitation (IP) in gastrocnemius muscle (G), epididymal fat (H), and liver (I) 30 min after MOTS-c administration (7.5 mg/kg). The "-" indicates tissues from non-MOTS-c administered mice, while the "+" indicates tissues from MOTS-c administered mice. (J–K) CK2 activity after 10 min MOTS-c treatment (10 μM) in differentiated skeletal muscle (J) and adipocyte (K). Data are represented as mean ± SEM for (B, C, J, and K).
Article Snippet:
Techniques: Activity Assay, Western Blot, Immunoprecipitation
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet: MOTS-c modulates the CK2 interactome in a tissue-specific manner (A) Experimental design for the interactome analyses in young mice ( n = 3 per condition). Proteome analysis was performed following CK2α immunoprecipitation in gastrocnemius muscle and epididymal fat with/without MOTS-c administration. (B) Principal components (PCs) of control and MOTS-c-treated mouse gastrocnemius muscle and epididymal fat. (C) Venn diagram of interacting proteins in each condition. (D–E) Numbers of CK2 interacting proteins (D) and enriched Reactome pathways (E) in gastrocnemius muscle. (F–G) Numbers of CK2 interacting proteins (F) and enriched Reactome pathways (G) in epididymal fat. (H) Interacting proteins and significantly enriched Reactome pathways in MOTS-c-administered gastrocnemius muscle compared to the control group. The protein-protein interactions and enrichment analysis were assessed by using the STRING database. (I) Summary of the interactome analysis in gastrocnemius muscle and epididymal fat.
Article Snippet:
Techniques: Immunoprecipitation, Control
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet: A naturally occurring K14Q MOTS-c is a bio-inactive form of MOTS-c due to its reduced binding to CK2 alpha (A) Nucleotide and amino acid substitutions of naturally occurring MOTS-c variant K14Q MOTS-c, which modulates skeletal muscle function and increases type 2 diabetes risk. (B) Comparison of reciprocal K D between WT and K14Q MOTS-c assessed by the surface plasmon resonance (Biacore) assay. (C) Comparison of CK2 activating effects between WT MOTS-c and K14Q MOTS-c in cell-free condition ( n = 3 per group). MOTS-c concentrations are 0, 0.8, 1.6, 3.1, 6.3, 12.5, and 25 μM ∗ p < 0.05, ∗∗ p < 0.01 versus control. # p < 0.05 versus same concentration of K14Q MOTS-c. (D–E) Comparison of gastrocnemius muscle CK2 activity between WT MOTS-c- and K14Q MOTS-c-administered young mice (2.5 mg/kg, n = 5 per group). ∗ p < 0.05 versus control group. (F) Protective effect of MOTS-c administration (WT or K14Q MOTS-c, 15 mg/kg/day, IP injection) against 8 days of immobilization-induced skeletal muscle atrophy ( n = 8 per group). Skeletal muscle mass was assessed by a total mass of gastrocnemius, plantaris, and soleus muscles. ∗ p < 0.05, ∗∗ p < 0.01. (G)Skeletal muscle 2-deoxy-d-glucose (2DG) uptake after MOTS-c administration (WT or K14Q, 7.5 mg/kg) with/without CK2 inhibitor (CX-4945, 25 mg/kg) ( n = 10–11 per group). ∗ p < 0.05. Data are represented as mean ± SEM for (C, E, F, and G).
Article Snippet:
Techniques: Binding Assay, Variant Assay, Comparison, SPR Assay, Control, Concentration Assay, Activity Assay, Injection, Muscles
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet:
Article Snippet:
Techniques: Recombinant, RNA Sequencing Assay, Software, Immunoprecipitation, Blocking Assay, Western Blot, Bicinchoninic Acid Protein Assay
Journal: Molecular Biology of the Cell
Article Title: Nuclear hormone receptor corepressor promotes esophageal cancer cell invasion by transcriptional repression of interferon-γ–inducible protein 10 in a casein kinase 2–dependent manner
doi: 10.1091/mbc.E11-11-0947
Figure Lengend Snippet: CK2α phosphorylates Ser-2436 of NCoR. (A) Reciprocal immunoprecipitation analysis was performed using HeLa cell lysates with a CK2α or NCoR antibody, and immunoblotting was performed using their respective antibodies (right). HeLa cells were transfected with Myc-CK2α, and cell lysates were immunoprecipitated and immunoblotted with their respective antibodies (left). (B) A schematic of the deletion mutants of NCoR for in vitro translation (left). Bound proteins were eluted and analyzed by autoradiography (right, top). HeLa cells were transfected with FLAG-tagged NCoR-15/16 (1985–2440) and HA-tagged CK2α plasmids. Whole-cell lysates were immunoprecipitated and immunoblotted with the indicated antibodies (right, bottom). (C and D) In vitro kinase assays were performed with CK2α and the indicated GST-fused NCoR-15/16 proteins. Bound proteins were eluted and analyzed by autoradiography (C) and scintillation counter (D). (E) In vitro kinase assays were performed with recombinant CK2α enzyme and the indicated GST-fused NCoR-15/16 proteins. Western blotting was performed with phospho-NCoR antibody. CBB , Coomassie blue staining. (F) Full-length GFP-NCoR plasmids were transfected into HeLa cells with or without Myc-CK2α and treated with TBB (50 μM) for 6 h. Cell lysates were analyzed by Western blotting with indicated antibodies. (G) HeLa cells were seeded on coverslips and transfected with the indicated expression plasmids in the presence or absence of TBB (50 μM). The permeabilized HeLa cells were incubated with indicated antibodies and/or 1 μg/ml of non-phosphopeptide (NPP) or phosphopeptide (PP) for 12 h, which was followed by PLA probes (PLUS and MINUS) treatment. The positive signal was analyzed using confocal microscopy. (H) In situ PLA analysis was performed under the same conditions as above without transfection of expression plasmids. The level of NCoR phosphorylation was assessed with αNCoR antibody and α-phospho-NCoR antibody.
Article Snippet: GST-fusion proteins were incubated with 500 U of
Techniques: Immunoprecipitation, Western Blot, Transfection, In Vitro, Autoradiography, Recombinant, Staining, Expressing, Incubation, Phospho-proteomics, Confocal Microscopy, In Situ
Journal: Molecular Biology of the Cell
Article Title: Nuclear hormone receptor corepressor promotes esophageal cancer cell invasion by transcriptional repression of interferon-γ–inducible protein 10 in a casein kinase 2–dependent manner
doi: 10.1091/mbc.E11-11-0947
Figure Lengend Snippet: CK2α-dependent NCoR phosphorylation increases NCoR stability via inhibition of the ubiquitin-dependent proteasomal pathway. (A) HeLa cells were transfected with full-length GFP-NCoR plasmids and treated with an increase amount of TBB (10, 50, 100 μM) and/or MG132 (10 μM) for 6 h. Cell lysates were analyzed by Western blotting. (B) HeLa cells were treated with an increase amount of TBB (10, 50 μM) and/or MG132, and cell lysates were analyzed by Western blotting with indicated antibodies. (C) HeLa cells were transfected with either FLAG-NCoR-15/16 WT or FLAG-NCoR-15/16 S2436A plasmid. After 2 d, cells were treated with cycloheximide (10 μg/ml), TBB (50 μM), and/or MG132 for various time periods, and cell lysates were analyzed by Western blotting. (D) HeLa cells were treated with TBB (50 μM) and/or MG132, and endogenous NCoR and phospho-NCoR levels were analyzed by confocal microscopy. (E and F) HeLa cells were treated with TBB (50 μM) or siRNAs against NCoR or CK2α, and then protein and mRNA levels were analyzed by Western blotting (E) and RT-PCR (F), respectively. (G) HeLa cells were treated with emodin (50 μM), TBB, LiCl 2 , and indicated siRNAs, and endogenous NCoR levels were then analyzed by confocal microscopy. (H) HeLa cells were treated with indicated inhibitors or siRNAs, and cell lysates were analyzed by Western blotting. (I) FLAG-NCoR-15/16 plasmids and HA-ubiquitin (Ub) were transfected into HeLa cells with TBB and/or MG132, and cell lysates were analyzed by Western blotting.
Article Snippet: GST-fusion proteins were incubated with 500 U of
Techniques: Phospho-proteomics, Inhibition, Ubiquitin Proteomics, Transfection, Western Blot, Plasmid Preparation, Confocal Microscopy, Reverse Transcription Polymerase Chain Reaction
Journal: Molecular Biology of the Cell
Article Title: Nuclear hormone receptor corepressor promotes esophageal cancer cell invasion by transcriptional repression of interferon-γ–inducible protein 10 in a casein kinase 2–dependent manner
doi: 10.1091/mbc.E11-11-0947
Figure Lengend Snippet: The levels of NCoR phosphorylation at Ser-2436 are well associated with patterns of CK2α activities. (A) In vitro kinase assays were performed by incubation of GST-NCoR-15/16 protein and immunoprecipitated CK2α enzyme from TE2, TE2-CK2α and HCE4 cells, and CK2α phosphorylation levels were analyzed by autoradiography and scintillation counter. (B) Whole-cell lysates from TE2 and HCE4 cells were analyzed by Western blotting. (C) HCE4 cells were treated with TBB (10, 50 μM) and/or MG132 for 6 h, and cell lysates were analyzed by Western blotting. (D) TE2, TE2-CK2α, and HCE4 cells were seeded on coverslips and treated with or without TBB (50 μM). Permeabilized cells were incubated with a phosphospecific NCoR antibody, an NCoR antibody, and PLA probes. Duolink in situ PLA analysis was performed as described in Materials and Methods .
Article Snippet: GST-fusion proteins were incubated with 500 U of
Techniques: Phospho-proteomics, In Vitro, Incubation, Immunoprecipitation, Autoradiography, Western Blot, In Situ
Journal: Molecular Biology of the Cell
Article Title: Nuclear hormone receptor corepressor promotes esophageal cancer cell invasion by transcriptional repression of interferon-γ–inducible protein 10 in a casein kinase 2–dependent manner
doi: 10.1091/mbc.E11-11-0947
Figure Lengend Snippet: NCoR promotes the invasion of esophageal cancer cells in a CK2α-dependent manner. (A) Invasion was analyzed by counting cells that migrated through the extracellular matrix layer of BioCoat Matrigel invasion chambers. Data are expressed as the means ± SD of at least three independent experiments. (B) Both TE2-CK2α and HCE4 cells were transfected with siRNAs against NCoR and/or TBB (50 μM) before application to the upper chamber. Data are expressed as the means ± SD of at least three independent experiments. (C) HCE4 cells were treated with individual siNCoRs, GFP-NCoR plasmids, and/or TBB, and invasion was analyzed by counting cells that migrated through the extracellular matrix layer of BioCoat Matrigel invasion chambers. *, p < 0.05 vs. siCon; **, p < 0.01 vs. siCon + TBB. (D) Either TE2 or HCE4 cell was treated with indicated siRNAs or TBB, and cell lysates were analyzed by Western blotting.
Article Snippet: GST-fusion proteins were incubated with 500 U of
Techniques: Transfection, Western Blot
Journal: Molecular Biology of the Cell
Article Title: Nuclear hormone receptor corepressor promotes esophageal cancer cell invasion by transcriptional repression of interferon-γ–inducible protein 10 in a casein kinase 2–dependent manner
doi: 10.1091/mbc.E11-11-0947
Figure Lengend Snippet: NCoR selectively represses transcription of the anti-tumorigenic gene IP-10/CXCL10 in a CK2α-dependent manner. (A) HCE4 cells were transfected with siRNA against NCoR and CK2α, and the change in mRNA expression was analyzed by cDNA microarray analysis using the Illumina HumanRef-8 version 3 Expression BeadChip. Data outputs and the average intensity for each array were normalized against housekeeping genes located on each array. Differentially expressed genes were identified by comparison of the siCK2 sample set with the small-interfering control sample set, and the siNCoR-2 sample set with the small-interfering control sample set using p < 0.05 as the significance cutoff. Only fold changes greater than 2.0 were considered. (B) HCE4 cells were treated with siRNAs, and the levels of indicated genes were analyzed by real-time PCR (left). The relative levels of indicated genes between TE2 and HCE4 cells were analyzed by real-time PCR (right). All samples were normalized to human GAPDH. (C) HCE4 cells were treated with TBB (50 μM, 6 H) or indicated siRNAs, and the level of each gene was analyzed by real-time PCR. (D) HCE4 cells were treated with an increasing amount of indicated inhibitors, and then mRNAs were analyzed by real-time PCR. (E) HCE4 cells were treated with siRNAs against each HDAC, and the level of each gene was analyzed by real-time PCR. (F) HCE4 cells were treated with TBB (50 μM, 6 H) or indicated siRNAs, and the level of each gene was analyzed by real-time PCR. (G) TE2 cells were transfected with CK2α plasmid. After 24 h, cells were treated with indicated siRNAs or TBB (50 μm, 6 H), and the levels of the indicated genes were analyzed by real-time PCR. *, p < 0.01 vs. CK2α alone; **, p < 0.05 vs. CK2α alone; #, p < 0.05 vs. CK2α +.siCon; # #, p < 0.05 vs. CK2α + siCon.
Article Snippet: GST-fusion proteins were incubated with 500 U of
Techniques: Transfection, Expressing, Microarray, Comparison, Control, Real-time Polymerase Chain Reaction, Plasmid Preparation
Journal: Molecular Biology of the Cell
Article Title: Nuclear hormone receptor corepressor promotes esophageal cancer cell invasion by transcriptional repression of interferon-γ–inducible protein 10 in a casein kinase 2–dependent manner
doi: 10.1091/mbc.E11-11-0947
Figure Lengend Snippet: NCoR complexes repress IP-10 transcription at the epigenetic status via deacetylation of histone tails in a CK2α-dependent manner. (A and B) HCE4 cells were treated with TBB (50 μM, 6 H) or indicated siRNAs, and ChIP assays were performed with the indicated antibodies. The precipitated samples were analyzed by real-time PCR, and results are given as the percentage of input as means ± SD of three independent experiments. *, p < 0.005 vs. SiCon; #, P < 0.01 vs. SiCon; **, p < 0.05 vs. SiCon. (C) ChIP and reChIP assays were performed with the indicated antibodies. Error bars, SD ( n = 3). *, p < 0.05 vs. IgG; **, p < 0.01 vs. IgG. (D) TE2 cells were transfected with indicated siRNAs and/or plasmids, and treated with TBB (50 μM, 6 H). The invading cells were counted in BioCoat Matrigel invasion chambers. (E) Model of our findings. In tumor cells with high CK2α activity, active CK2α phosphorylates NCoR and HDAC3 to repress IP-10 transcription, enhancing tumorigenesis. Additionally, CK2α phosphorylates Snail1 to repress E-cadherin transcription via an NCoR-independent pathway. Thus selective CK2α inhibition may be promising for anticancer therapy.
Article Snippet: GST-fusion proteins were incubated with 500 U of
Techniques: Real-time Polymerase Chain Reaction, Transfection, Activity Assay, Inhibition
Journal: Cell Death & Disease
Article Title: Ablation of beta subunit of protein kinase CK2 in mouse oocytes causes follicle atresia and premature ovarian failure
doi: 10.1038/s41419-018-0505-1
Figure Lengend Snippet: a Immunoblotting detection of the expression of CK2α and CK2α’ in ovaries of Ck2β fl/fl and Ck2β fl/fl ;GCre + at 2 weeks after birth. b Immunoblotting detection of CK2 activity in ovaries of Ck2β fl/fl and Ck2β fl/fl ;GCre + at 2 weeks after birth. The obviously altered bands were marked with red arrows. The ovary lysates were obtained from at least three mice of each genotype and immunoblotted for CK2α, CK2α’, CK2β, and phospho-CK2 substrate, β-actin. Level of β-actin was used as internal control. Each experiment was repeated at least three times. Molecular mass is given in kilo Daltons
Article Snippet: Rabbit monoclonal anti-CK2β antibody (AJ1128b; ABGENT); mouse monoclonal anti-β-actin antibody (sc-47778; Santa Cruz); mouse monoclonal anti-MVH antibody (ab27591; abcam); rabbit monoclonal anti-p-Akt (S473) antibody (4046; Cell Signaling Technology, Inc.); rabbit monoclonal anti-p-Akt (T308) (13038; Cell Signaling Technology, Inc.); rabbit monoclonal anti-p-Akt (S129) (ab133458; abcam); rabbit monoclonal anti-AKT1/2/3 antibody (ab32505; abcam); rabbit monoclonal anti-PTEN antibody (9559; Cell Signaling Technology, Inc.); rabbit polyclonal anti-p-TSC2 (S1387) antibody (5584; Cell Signaling Technology, Inc.); rabbit monoclonal anti-TSC2 antibody (4308; Cell Signaling Technology, Inc.); rabbit monoclonal anti-p-mTOR (S2448) antibody (5536; Cell Signaling Technology, Inc.); rabbit monoclonal anti-p-S6K (T389) antibody (9234; Cell Signaling Technology, Inc.); rabbit monoclonal anti-p-rpS6 (S240/244) antibody (5364; Cell Signaling Technology, Inc.); rabbit polyclonal anti-GSK3α/β (S21/9) antibody (9331; Cell Signaling Technology, Inc.); rabbit monoclonal anti-GSK3α/β antibody (5676; Cell Signaling Technology, Inc.); rabbit polyclonal anti-p-FOXO1 (T24)/FOXO3a (T32) antibody (9464; Cell Signaling Technology, Inc.); rabbit monoclonal anti-FOXO1 antibody (2880; Cell Signaling Technology, Inc.); rabbit monoclonal anti-γH2AX antibody (9718; Cell Signaling Technology, Inc.); rabbit monoclonal anti-H2AX antibody (7631; Cell Signaling Technology, Inc.); rabbit polyclonal anti-p-CHK2 (T68) antibody (BS4043; Bioworld Technology, Inc.); rabbit polyclonal anti-CHK2 antibody (BS6791; Bioworld Technology, Inc.); rabbit monoclonal anti-p-p53 (S15) (12571; Cell Signaling Technology, Inc.); rabbit polyclonal anti-p53 antibody (BS3156; Bioworld Technology, Inc.); rabbit monoclonal anti-p63 (ab124762; abcam); mouse monoclonal anti-CK2α antibody (ab70774; abcam);
Techniques: Western Blot, Expressing, Activity Assay