chi Search Results


89
Thermo Fisher advanced mirna chi mir 1 477820 mir
Boxplot diagram showing differential circulating miRNA expression profile in GDM women depending on their glycemic status after 15 years. ( a ) relative <t>hsa-miR-1-3p</t> expression, ( p = 0.385); ( b ) relative hsa-miR-24-3p expression ( p = 0.030); ( c ) relative hsa-miR-329-3p expression ( p = 0.596); ( d ) relative hsa-miR-543 expression ( p = 0.071). * p -value < 0.05 cel-miR-39-3p was used for miRNA expression normalization.
Advanced Mirna Chi Mir 1 477820 Mir, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/advanced mirna chi mir 1 477820 mir/product/Thermo Fisher
Average 89 stars, based on 1 article reviews
advanced mirna chi mir 1 477820 mir - by Bioz Stars, 2026-03
89/100 stars
  Buy from Supplier

93
Proteintech nltp scp2
Boxplot diagram showing differential circulating miRNA expression profile in GDM women depending on their glycemic status after 15 years. ( a ) relative <t>hsa-miR-1-3p</t> expression, ( p = 0.385); ( b ) relative hsa-miR-24-3p expression ( p = 0.030); ( c ) relative hsa-miR-329-3p expression ( p = 0.596); ( d ) relative hsa-miR-543 expression ( p = 0.071). * p -value < 0.05 cel-miR-39-3p was used for miRNA expression normalization.
Nltp Scp2, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nltp scp2/product/Proteintech
Average 93 stars, based on 1 article reviews
nltp scp2 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
Proteintech sterol carrier protein x
Boxplot diagram showing differential circulating miRNA expression profile in GDM women depending on their glycemic status after 15 years. ( a ) relative <t>hsa-miR-1-3p</t> expression, ( p = 0.385); ( b ) relative hsa-miR-24-3p expression ( p = 0.030); ( c ) relative hsa-miR-329-3p expression ( p = 0.596); ( d ) relative hsa-miR-543 expression ( p = 0.071). * p -value < 0.05 cel-miR-39-3p was used for miRNA expression normalization.
Sterol Carrier Protein X, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sterol carrier protein x/product/Proteintech
Average 93 stars, based on 1 article reviews
sterol carrier protein x - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
Developmental Studies Hybridoma Bank mouse anti profilin
Boxplot diagram showing differential circulating miRNA expression profile in GDM women depending on their glycemic status after 15 years. ( a ) relative <t>hsa-miR-1-3p</t> expression, ( p = 0.385); ( b ) relative hsa-miR-24-3p expression ( p = 0.030); ( c ) relative hsa-miR-329-3p expression ( p = 0.596); ( d ) relative hsa-miR-543 expression ( p = 0.071). * p -value < 0.05 cel-miR-39-3p was used for miRNA expression normalization.
Mouse Anti Profilin, supplied by Developmental Studies Hybridoma Bank, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse anti profilin/product/Developmental Studies Hybridoma Bank
Average 93 stars, based on 1 article reviews
mouse anti profilin - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
Proteintech gene exp scp2 hs00920780 m1
<t>SCP2</t> deficiency significantly attenuates diet-induced atherosclerosis. At 10 weeks of age, LDLR−/− and LS mice were fed a high-fat, high-cholesterol–containing Western-type diet (TD88137) for 16 weeks. Aortae were dissected and prepared for en face analyses. The total area as well as the area occupied by the lesions was quantified using Axiovision software and expressed as percent lesion area. A, representative images. B, percent area occupied by the lesions in the aortic arch. C, percent area occupied by the lesions in the entire aorta. *, p < 0.05; individual p values are included in the text.
Gene Exp Scp2 Hs00920780 M1, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp scp2 hs00920780 m1/product/Proteintech
Average 93 stars, based on 1 article reviews
gene exp scp2 hs00920780 m1 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
ATCC g joobiniege g7
( A ) Gene arrangement of Ahg943 compared to Ahg558 and Ahg786 in the G. <t>joobiniege</t> <t>G7</t> genome and the distribution of the conserved domain. The nucleotide numbers of the chromosomal region used for gene arrangement are presented above both ends of each DNA fragment based on the genomic data of G. joobiniege G7. Each ORF is indicated by an arrow with a stop codon at the arrowhead. The NCBI accession number is marked in each arrow with the annotated function in the lower row. Similar to Ahg558 and Ahg786, Ahg943 (WP_017446943.1) has a long conserved domain (cd08992) of the GH117 family spanning between N-61 and D-389 with an e-value of 3.96 xe -164 . Three putative catalytic residues, D-88, H-292, and E-293, are represented by triangles. ( B ) Phylogenetic tree of α-neoagarooligosaccharide hydrolases, including Ahg943. A phylogenetic tree was constructed by comparing 11 α-neoagarooligosaccharide hydrolases, including Ahg943, identified so far through the neighbor-joining method in MEGA 6. The tree was constructed to have branch lengths in the same units as the evolutionary distances used to infer phylogenetic trees. Sequence ID of each protein is indicated in parentheses. ( C ) Comparison of secondary structure of Ahg943 with ZgAhgB. Two-dimensional structures of Ahg943 and ZgAhgB were constructed using the NetSurfP-2.0 program server ( http://www.cbs.dtu.dk/services/NetSurfP/ ) for comparison. Two proteins were aligned depending on their amino acid sequence using Clustal Omega ( https://www.ebi.ac.uk/Tools/msa/clustalo/ ). The secondary structure of the protein is indicated at the top of Ahg943 and the bottom of ZgAhgB. The alpha-helix structure is shown as a thick line, and the beta-strand is shown as an arrow. The conserved residues constituting the active site are depicted with boxes.
G Joobiniege G7, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/g joobiniege g7/product/ATCC
Average 90 stars, based on 1 article reviews
g joobiniege g7 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

85
Addgene inc p415 chi
Yeast strains used in this study
P415 Chi, supplied by Addgene inc, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/p415 chi/product/Addgene inc
Average 85 stars, based on 1 article reviews
p415 chi - by Bioz Stars, 2026-03
85/100 stars
  Buy from Supplier

95
Gatan Inc chroma cl
Yeast strains used in this study
Chroma Cl, supplied by Gatan Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/chroma cl/product/Gatan Inc
Average 95 stars, based on 1 article reviews
chroma cl - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

86
Thermo Fisher advanced mirna chi mir 30c 5p 478008 mir
Comparison of <t> miR-30c-5p </t> and miR-92a-3p expression levels. Means ± SD of 2 independent extractions. p < 0.05.
Advanced Mirna Chi Mir 30c 5p 478008 Mir, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/advanced mirna chi mir 30c 5p 478008 mir/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
advanced mirna chi mir 30c 5p 478008 mir - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier

94
Thermo Fisher advanced mirna chi mir 18a 5p rno480968 mir
Comparison of <t> miR-30c-5p </t> and miR-92a-3p expression levels. Means ± SD of 2 independent extractions. p < 0.05.
Advanced Mirna Chi Mir 18a 5p Rno480968 Mir, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/advanced mirna chi mir 18a 5p rno480968 mir/product/Thermo Fisher
Average 94 stars, based on 1 article reviews
advanced mirna chi mir 18a 5p rno480968 mir - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

Image Search Results


Boxplot diagram showing differential circulating miRNA expression profile in GDM women depending on their glycemic status after 15 years. ( a ) relative hsa-miR-1-3p expression, ( p = 0.385); ( b ) relative hsa-miR-24-3p expression ( p = 0.030); ( c ) relative hsa-miR-329-3p expression ( p = 0.596); ( d ) relative hsa-miR-543 expression ( p = 0.071). * p -value < 0.05 cel-miR-39-3p was used for miRNA expression normalization.

Journal: International Journal of Molecular Sciences

Article Title: miR-24-3p and Body Mass Index as Type 2 Diabetes Risk Factors in Spanish Women 15 Years after Gestational Diabetes Mellitus Diagnosis

doi: 10.3390/ijms24021152

Figure Lengend Snippet: Boxplot diagram showing differential circulating miRNA expression profile in GDM women depending on their glycemic status after 15 years. ( a ) relative hsa-miR-1-3p expression, ( p = 0.385); ( b ) relative hsa-miR-24-3p expression ( p = 0.030); ( c ) relative hsa-miR-329-3p expression ( p = 0.596); ( d ) relative hsa-miR-543 expression ( p = 0.071). * p -value < 0.05 cel-miR-39-3p was used for miRNA expression normalization.

Article Snippet: hsa-miR-1-3p , 477820_mir , 5′-UGGAAUGUAAAGAAGUAUGUAU-3′.

Techniques: Expressing

SCP2 deficiency significantly attenuates diet-induced atherosclerosis. At 10 weeks of age, LDLR−/− and LS mice were fed a high-fat, high-cholesterol–containing Western-type diet (TD88137) for 16 weeks. Aortae were dissected and prepared for en face analyses. The total area as well as the area occupied by the lesions was quantified using Axiovision software and expressed as percent lesion area. A, representative images. B, percent area occupied by the lesions in the aortic arch. C, percent area occupied by the lesions in the entire aorta. *, p < 0.05; individual p values are included in the text.

Journal: The Journal of Biological Chemistry

Article Title: Sterol carrier protein-2 deficiency attenuates diet-induced dyslipidemia and atherosclerosis in mice

doi: 10.1074/jbc.RA118.002290

Figure Lengend Snippet: SCP2 deficiency significantly attenuates diet-induced atherosclerosis. At 10 weeks of age, LDLR−/− and LS mice were fed a high-fat, high-cholesterol–containing Western-type diet (TD88137) for 16 weeks. Aortae were dissected and prepared for en face analyses. The total area as well as the area occupied by the lesions was quantified using Axiovision software and expressed as percent lesion area. A, representative images. B, percent area occupied by the lesions in the aortic arch. C, percent area occupied by the lesions in the entire aorta. *, p < 0.05; individual p values are included in the text.

Article Snippet: Quantitative RT-PCR was used to measure mRNA levels using a TaqMan assay (Hs00920780_m1), and the protein levels were measured by Western blot analyses using primary antibody 23006-1-AP (Proteintech Group), which recognizes both SCP2 and SCPx.

Techniques: Western Blot, Software

SCP2 deficiency reduces plaque size as well as plaque necrosis in the aortic root. Paraffin-embedded aortic root sections (5 μm) were stained with H&E or Masson's trichrome, imaged, and analyzed by Axiovision software. A, representative H&E stained images of the aortic root of the indicated genotypes/sex. Scale bar = 100 μm. B, the total aortic root and area occupied by the lesions was quantified, and data (mean ± S.D., n = 6) are presented as percent lesion area. C, representative trichrome-stained images of the indicated genotypes/sex. Scale bar = 50 μm. D, the total and necrotic areas were quantified for all three aortic valve leaflets, and data (mean ± S.D., n = 12 leaflets) are presented as percent necrotic area. *, p < 0.05.

Journal: The Journal of Biological Chemistry

Article Title: Sterol carrier protein-2 deficiency attenuates diet-induced dyslipidemia and atherosclerosis in mice

doi: 10.1074/jbc.RA118.002290

Figure Lengend Snippet: SCP2 deficiency reduces plaque size as well as plaque necrosis in the aortic root. Paraffin-embedded aortic root sections (5 μm) were stained with H&E or Masson's trichrome, imaged, and analyzed by Axiovision software. A, representative H&E stained images of the aortic root of the indicated genotypes/sex. Scale bar = 100 μm. B, the total aortic root and area occupied by the lesions was quantified, and data (mean ± S.D., n = 6) are presented as percent lesion area. C, representative trichrome-stained images of the indicated genotypes/sex. Scale bar = 50 μm. D, the total and necrotic areas were quantified for all three aortic valve leaflets, and data (mean ± S.D., n = 12 leaflets) are presented as percent necrotic area. *, p < 0.05.

Article Snippet: Quantitative RT-PCR was used to measure mRNA levels using a TaqMan assay (Hs00920780_m1), and the protein levels were measured by Western blot analyses using primary antibody 23006-1-AP (Proteintech Group), which recognizes both SCP2 and SCPx.

Techniques: Staining, Software

SCP2 deficiency significantly reduces plasma cholesterol and triglyceride levels. At 10 weeks of age, LDLR−/− and LS mice were fed a high-fat, high-cholesterol–containing Western-type diet (TD88137) for 16 weeks. After an overnight fast, mice were euthanized, and fasting plasma was collected. A, levels of total plasma cholesterol for indicated genotype and sexes. B, percent of total plasma cholesterol associated with the non-HDL or HDL fraction. C, percent of total plasma cholesterol associated with the non-HDL or HDL fraction in both genotypes normalized to total plasma cholesterol in LDLR−/− mice of the respective sex. D, linear regression analyses of total lesion area and plasma cholesterol; the observed coefficient of correlation (R) as significance of correlation (p value) is indicated. E, total plasma triglyceride for the indicated genotype and sexes. F, linear regression analyses of total lesion area and plasma triglyceride levels; the observed coefficients of correlation (R) as significance of correlation (p value) is indicated.

Journal: The Journal of Biological Chemistry

Article Title: Sterol carrier protein-2 deficiency attenuates diet-induced dyslipidemia and atherosclerosis in mice

doi: 10.1074/jbc.RA118.002290

Figure Lengend Snippet: SCP2 deficiency significantly reduces plasma cholesterol and triglyceride levels. At 10 weeks of age, LDLR−/− and LS mice were fed a high-fat, high-cholesterol–containing Western-type diet (TD88137) for 16 weeks. After an overnight fast, mice were euthanized, and fasting plasma was collected. A, levels of total plasma cholesterol for indicated genotype and sexes. B, percent of total plasma cholesterol associated with the non-HDL or HDL fraction. C, percent of total plasma cholesterol associated with the non-HDL or HDL fraction in both genotypes normalized to total plasma cholesterol in LDLR−/− mice of the respective sex. D, linear regression analyses of total lesion area and plasma cholesterol; the observed coefficient of correlation (R) as significance of correlation (p value) is indicated. E, total plasma triglyceride for the indicated genotype and sexes. F, linear regression analyses of total lesion area and plasma triglyceride levels; the observed coefficients of correlation (R) as significance of correlation (p value) is indicated.

Article Snippet: Quantitative RT-PCR was used to measure mRNA levels using a TaqMan assay (Hs00920780_m1), and the protein levels were measured by Western blot analyses using primary antibody 23006-1-AP (Proteintech Group), which recognizes both SCP2 and SCPx.

Techniques: Western Blot

SCP2 deficiency significantly reduces intestinal cholesterol absorption, and SCP2 knockdown in intestinal epithelial cells reduces cholesterol uptake. A, C57BL/6 (WT) or SCP2−/− mice were injected intravenously with the lipoprotein lipase inhibitor tyloxapol (500 mg/kg body weight) and gavaged with [3H]cholesterol in olive oil (2 μCi in 200 μl) after 5 min. Intestinal cholesterol absorption was assessed by monitoring the radiolabel associated with plasma collected at the time of euthanasia. Data are presented as plasma DPM per microliter of plasma for the indicated genotype and sex. B, the entire length of the intestine, from the base of the stomach to the tip of the cecum, was divided into four equal parts (P1 to P4), and total RNA was isolated. The mRNA levels of indicated genes were determined by real-time PCR as described under “Experimental procedures” and normalized to the housekeeping gene β-actin. C, total protein extracts from ileum segments P1 to P4 of WT and SCP2−/− mice as well as the colon (C) were analyzed by Western blotting for expression of SCP2; β-actin was used as the loading control. Human intestinal epithelial cells (HT-29) were transfected with scrambled or SCP2-specific siRNA as described under “Experimental procedures.” Total protein or RNA was extracted and used to determine the levels of SCP2. D, top, a representative Western blot. Bottom, levels of SCP2 mRNA quantified by quantitative PCR and SCP2 protein by densitometric analyses of Western blots. Data are presented as percent scrambled siRNA-transfected controls for the indicated SCP2 siRNA concentrations used. E, HT-29 cells transfected with scrambled siRNA or 53.3 nm SCP2-specific siRNA were incubated with [3H]-cholesterol, and total cellular uptake was monitored as described under “Experimental procedures.” Data (mean ± S.D., n = 6) are presented as DPM normalized to total cellular protein. *, p < 0.05.

Journal: The Journal of Biological Chemistry

Article Title: Sterol carrier protein-2 deficiency attenuates diet-induced dyslipidemia and atherosclerosis in mice

doi: 10.1074/jbc.RA118.002290

Figure Lengend Snippet: SCP2 deficiency significantly reduces intestinal cholesterol absorption, and SCP2 knockdown in intestinal epithelial cells reduces cholesterol uptake. A, C57BL/6 (WT) or SCP2−/− mice were injected intravenously with the lipoprotein lipase inhibitor tyloxapol (500 mg/kg body weight) and gavaged with [3H]cholesterol in olive oil (2 μCi in 200 μl) after 5 min. Intestinal cholesterol absorption was assessed by monitoring the radiolabel associated with plasma collected at the time of euthanasia. Data are presented as plasma DPM per microliter of plasma for the indicated genotype and sex. B, the entire length of the intestine, from the base of the stomach to the tip of the cecum, was divided into four equal parts (P1 to P4), and total RNA was isolated. The mRNA levels of indicated genes were determined by real-time PCR as described under “Experimental procedures” and normalized to the housekeeping gene β-actin. C, total protein extracts from ileum segments P1 to P4 of WT and SCP2−/− mice as well as the colon (C) were analyzed by Western blotting for expression of SCP2; β-actin was used as the loading control. Human intestinal epithelial cells (HT-29) were transfected with scrambled or SCP2-specific siRNA as described under “Experimental procedures.” Total protein or RNA was extracted and used to determine the levels of SCP2. D, top, a representative Western blot. Bottom, levels of SCP2 mRNA quantified by quantitative PCR and SCP2 protein by densitometric analyses of Western blots. Data are presented as percent scrambled siRNA-transfected controls for the indicated SCP2 siRNA concentrations used. E, HT-29 cells transfected with scrambled siRNA or 53.3 nm SCP2-specific siRNA were incubated with [3H]-cholesterol, and total cellular uptake was monitored as described under “Experimental procedures.” Data (mean ± S.D., n = 6) are presented as DPM normalized to total cellular protein. *, p < 0.05.

Article Snippet: Quantitative RT-PCR was used to measure mRNA levels using a TaqMan assay (Hs00920780_m1), and the protein levels were measured by Western blot analyses using primary antibody 23006-1-AP (Proteintech Group), which recognizes both SCP2 and SCPx.

Techniques: Injection, Isolation, Real-time Polymerase Chain Reaction, Western Blot, Expressing, Transfection, Incubation

SCP2 deficiency significantly reduces lipid secretion from liver and isolated hepatocytes. A, C57BL/6 (WT) or SCP2−/− mice were injected with the lipoprotein lipase inhibitor tyloxapol (500 mg/kg of body weight), and blood samples were drawn at 0 and 3 h. Triglyceride secretion rates for indicated genotypes and sexes are presented. B and C, primary hepatocytes were prepared from C57BL/6 (WT) or SCP2−/− mice. Following incubation with [3H]oleic acid, radiolabel associated with secreted triglycerides (TG, B) or cholesteryl esters (C) was determined as described under “Experimental procedures” and normalized to cellular protein. Data are presented as DPM associated with the triglyceride or cholesteryl ester fraction in the total lipids extracted from the medium per milligram of total protein.

Journal: The Journal of Biological Chemistry

Article Title: Sterol carrier protein-2 deficiency attenuates diet-induced dyslipidemia and atherosclerosis in mice

doi: 10.1074/jbc.RA118.002290

Figure Lengend Snippet: SCP2 deficiency significantly reduces lipid secretion from liver and isolated hepatocytes. A, C57BL/6 (WT) or SCP2−/− mice were injected with the lipoprotein lipase inhibitor tyloxapol (500 mg/kg of body weight), and blood samples were drawn at 0 and 3 h. Triglyceride secretion rates for indicated genotypes and sexes are presented. B and C, primary hepatocytes were prepared from C57BL/6 (WT) or SCP2−/− mice. Following incubation with [3H]oleic acid, radiolabel associated with secreted triglycerides (TG, B) or cholesteryl esters (C) was determined as described under “Experimental procedures” and normalized to cellular protein. Data are presented as DPM associated with the triglyceride or cholesteryl ester fraction in the total lipids extracted from the medium per milligram of total protein.

Article Snippet: Quantitative RT-PCR was used to measure mRNA levels using a TaqMan assay (Hs00920780_m1), and the protein levels were measured by Western blot analyses using primary antibody 23006-1-AP (Proteintech Group), which recognizes both SCP2 and SCPx.

Techniques: Isolation, Injection, Incubation

SCP2 deficiency leads to reduced lipid accumulation in the liver without a change in the expression of lipogenic genes. A, liver tissue harvested from WD-fed LDLR−/− or LS mice were paraffin-embedded, and 5-μm sections were stained with H&E. Images were acquired using a Zeiss inverted microscope fitted with a digital camera. Scale bar = 50 μm. B, SCP2 mRNA levels in total liver RNA were determined by real-time PCR as described under “Experimental procedures” and normalized to the housekeeping gene β-actin. Relative expression (mean ± S.D., n = 6) is shown. C, hepatic mRNA levels of the indicated genes were determined by real-time PCR as described under “Experimental procedures” and normalized to the housekeeping gene β-actin. Relative expression (mean ± S.D., n = 6) is shown.

Journal: The Journal of Biological Chemistry

Article Title: Sterol carrier protein-2 deficiency attenuates diet-induced dyslipidemia and atherosclerosis in mice

doi: 10.1074/jbc.RA118.002290

Figure Lengend Snippet: SCP2 deficiency leads to reduced lipid accumulation in the liver without a change in the expression of lipogenic genes. A, liver tissue harvested from WD-fed LDLR−/− or LS mice were paraffin-embedded, and 5-μm sections were stained with H&E. Images were acquired using a Zeiss inverted microscope fitted with a digital camera. Scale bar = 50 μm. B, SCP2 mRNA levels in total liver RNA were determined by real-time PCR as described under “Experimental procedures” and normalized to the housekeeping gene β-actin. Relative expression (mean ± S.D., n = 6) is shown. C, hepatic mRNA levels of the indicated genes were determined by real-time PCR as described under “Experimental procedures” and normalized to the housekeeping gene β-actin. Relative expression (mean ± S.D., n = 6) is shown.

Article Snippet: Quantitative RT-PCR was used to measure mRNA levels using a TaqMan assay (Hs00920780_m1), and the protein levels were measured by Western blot analyses using primary antibody 23006-1-AP (Proteintech Group), which recognizes both SCP2 and SCPx.

Techniques: Expressing, Staining, Inverted Microscopy, Real-time Polymerase Chain Reaction

Effects of SCP2 deficiency on cholesterol accumulation in and cholesterol efflux from macrophages. Thioglycolate-elicited macrophages were isolated from C57BL/6 (WT) and SCP2−/− mice and incubated with AcLDL (25 μg/ml) for 48 h. A and B, following two washes with PBS, cells were either fixed and stained with Oil Red O (A) or used for total lipid extraction and cholesterol mass measurement (B). Total cholesterol mass was normalized to total cellular protein, and data (mean ± S.D., n = 6) are presented as nanomoles per milligram of protein. C, total protein extracts of macrophages were subjected to Western blot analyses to assess SR-A expression; β-actin was used as a loading control. D, for measurement of cholesterol efflux, cells were loaded with AcLDL and labeled with [3H]-cholesterol for 48 h. Following a 24-h equilibration, cholesterol efflux to 10% FBS in the growth medium was monitored over time. Data (mean ± S.D., n = 6) are presented as percent efflux. *, p < 0.05.

Journal: The Journal of Biological Chemistry

Article Title: Sterol carrier protein-2 deficiency attenuates diet-induced dyslipidemia and atherosclerosis in mice

doi: 10.1074/jbc.RA118.002290

Figure Lengend Snippet: Effects of SCP2 deficiency on cholesterol accumulation in and cholesterol efflux from macrophages. Thioglycolate-elicited macrophages were isolated from C57BL/6 (WT) and SCP2−/− mice and incubated with AcLDL (25 μg/ml) for 48 h. A and B, following two washes with PBS, cells were either fixed and stained with Oil Red O (A) or used for total lipid extraction and cholesterol mass measurement (B). Total cholesterol mass was normalized to total cellular protein, and data (mean ± S.D., n = 6) are presented as nanomoles per milligram of protein. C, total protein extracts of macrophages were subjected to Western blot analyses to assess SR-A expression; β-actin was used as a loading control. D, for measurement of cholesterol efflux, cells were loaded with AcLDL and labeled with [3H]-cholesterol for 48 h. Following a 24-h equilibration, cholesterol efflux to 10% FBS in the growth medium was monitored over time. Data (mean ± S.D., n = 6) are presented as percent efflux. *, p < 0.05.

Article Snippet: Quantitative RT-PCR was used to measure mRNA levels using a TaqMan assay (Hs00920780_m1), and the protein levels were measured by Western blot analyses using primary antibody 23006-1-AP (Proteintech Group), which recognizes both SCP2 and SCPx.

Techniques: Isolation, Incubation, Staining, Mass Measurement, Western Blot, Expressing, Labeling

Effects of SCP2 deficiency on biliary bile acid and cholesterol secretion. A and B, gall bladder bile was collected at the time of euthanasia, and the total volume was noted. Biliary bile acids (BA), cholesterol, and phospholipids (PL) were estimated as described under “Experimental procedures.” Data are presented as total bile acids (nanomoles) or FC (micrograms) in the bile normalized to total phospholipids (micrograms) in A and B, respectively.

Journal: The Journal of Biological Chemistry

Article Title: Sterol carrier protein-2 deficiency attenuates diet-induced dyslipidemia and atherosclerosis in mice

doi: 10.1074/jbc.RA118.002290

Figure Lengend Snippet: Effects of SCP2 deficiency on biliary bile acid and cholesterol secretion. A and B, gall bladder bile was collected at the time of euthanasia, and the total volume was noted. Biliary bile acids (BA), cholesterol, and phospholipids (PL) were estimated as described under “Experimental procedures.” Data are presented as total bile acids (nanomoles) or FC (micrograms) in the bile normalized to total phospholipids (micrograms) in A and B, respectively.

Article Snippet: Quantitative RT-PCR was used to measure mRNA levels using a TaqMan assay (Hs00920780_m1), and the protein levels were measured by Western blot analyses using primary antibody 23006-1-AP (Proteintech Group), which recognizes both SCP2 and SCPx.

Techniques:

( A ) Gene arrangement of Ahg943 compared to Ahg558 and Ahg786 in the G. joobiniege G7 genome and the distribution of the conserved domain. The nucleotide numbers of the chromosomal region used for gene arrangement are presented above both ends of each DNA fragment based on the genomic data of G. joobiniege G7. Each ORF is indicated by an arrow with a stop codon at the arrowhead. The NCBI accession number is marked in each arrow with the annotated function in the lower row. Similar to Ahg558 and Ahg786, Ahg943 (WP_017446943.1) has a long conserved domain (cd08992) of the GH117 family spanning between N-61 and D-389 with an e-value of 3.96 xe -164 . Three putative catalytic residues, D-88, H-292, and E-293, are represented by triangles. ( B ) Phylogenetic tree of α-neoagarooligosaccharide hydrolases, including Ahg943. A phylogenetic tree was constructed by comparing 11 α-neoagarooligosaccharide hydrolases, including Ahg943, identified so far through the neighbor-joining method in MEGA 6. The tree was constructed to have branch lengths in the same units as the evolutionary distances used to infer phylogenetic trees. Sequence ID of each protein is indicated in parentheses. ( C ) Comparison of secondary structure of Ahg943 with ZgAhgB. Two-dimensional structures of Ahg943 and ZgAhgB were constructed using the NetSurfP-2.0 program server ( http://www.cbs.dtu.dk/services/NetSurfP/ ) for comparison. Two proteins were aligned depending on their amino acid sequence using Clustal Omega ( https://www.ebi.ac.uk/Tools/msa/clustalo/ ). The secondary structure of the protein is indicated at the top of Ahg943 and the bottom of ZgAhgB. The alpha-helix structure is shown as a thick line, and the beta-strand is shown as an arrow. The conserved residues constituting the active site are depicted with boxes.

Journal: Journal of Microbiology and Biotechnology

Article Title: Molecular Characterization of a Novel 1,3-α-3,6-Anhydro-L-Galactosidase, Ahg943, with Cold- and High-Salt-Tolerance from Gayadomonas joobiniege G7

doi: 10.4014/jmb.2008.08017

Figure Lengend Snippet: ( A ) Gene arrangement of Ahg943 compared to Ahg558 and Ahg786 in the G. joobiniege G7 genome and the distribution of the conserved domain. The nucleotide numbers of the chromosomal region used for gene arrangement are presented above both ends of each DNA fragment based on the genomic data of G. joobiniege G7. Each ORF is indicated by an arrow with a stop codon at the arrowhead. The NCBI accession number is marked in each arrow with the annotated function in the lower row. Similar to Ahg558 and Ahg786, Ahg943 (WP_017446943.1) has a long conserved domain (cd08992) of the GH117 family spanning between N-61 and D-389 with an e-value of 3.96 xe -164 . Three putative catalytic residues, D-88, H-292, and E-293, are represented by triangles. ( B ) Phylogenetic tree of α-neoagarooligosaccharide hydrolases, including Ahg943. A phylogenetic tree was constructed by comparing 11 α-neoagarooligosaccharide hydrolases, including Ahg943, identified so far through the neighbor-joining method in MEGA 6. The tree was constructed to have branch lengths in the same units as the evolutionary distances used to infer phylogenetic trees. Sequence ID of each protein is indicated in parentheses. ( C ) Comparison of secondary structure of Ahg943 with ZgAhgB. Two-dimensional structures of Ahg943 and ZgAhgB were constructed using the NetSurfP-2.0 program server ( http://www.cbs.dtu.dk/services/NetSurfP/ ) for comparison. Two proteins were aligned depending on their amino acid sequence using Clustal Omega ( https://www.ebi.ac.uk/Tools/msa/clustalo/ ). The secondary structure of the protein is indicated at the top of Ahg943 and the bottom of ZgAhgB. The alpha-helix structure is shown as a thick line, and the beta-strand is shown as an arrow. The conserved residues constituting the active site are depicted with boxes.

Article Snippet: G. joobiniege G7 (ATCC BAA-2321 = DSM25250 T = KCTC23721 T ) was used as a genomic source for ahg943 (NCBI reference sequence: WP_017446943) [ ].

Techniques: Construct, Sequencing, Comparison

Yeast strains used in this study

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: δ-COP contains a helix C-terminal to its longin domain key to COPI dynamics and function

doi: 10.1073/pnas.1603544113

Figure Lengend Snippet: Yeast strains used in this study

Article Snippet: Ret2LD2α T158K ( BY4743 Spore ) MAT a his3 ∆ 1 leu2 ∆ 0 met15 ∆ 0 ura3 ∆ 0; YFR051c::kanMX4; p415 ret2LD2 α T158K This study Open in a separate window Yeast strains used in this study table ft1 table-wrap mode="anchored" t5 Table S2. caption a7 No. Plasmids Addgene ID Database ID Source 1. p415 CHI 1 73863 Z1280 This study 2. p415 CHI 2 73864 Z1281 This study 3. p415 CHI 3 73865 Z1283 This study 4. p415 CHI 4 73866 Z1284 This study 5. p415 CHI 5 73867 Z1285 This study 6. p415 CHI 6 73868 Z1286 This study 7. p415 CHI 7 73869 Z1287 This study 8. p415 CHI 8 73870 Z1288 This study 9. pRS303 Bt δCOP 73871 AE1540 This study 10. p415 Ret2 73872 AE1541 This study 11. p415 Ret2LD2α 73873 AE1518 This study 12. p415 δCLD2α 73874 AE1519 This study 13. p415 Ret2LD 73875 AE1520 This study 14. p415 δCLD 73876 AE1521 This study 15. p415 Ret2LD+δC2α 73877 AE1516 This study 16. p415 δCLD+Ret2-2α 73878 AE1523 This study 17. p415 CHI 9 73879 AF1551 This study 18. p415 CHI 10 73880 AF1553 This study 19. p415 CHI 12 73881 AF1557 This study 20. p415 CHI 13 73882 AH1658 This study 21. p415 CHI 14 73883 AH1660 This study 22. p415 CHI 15 73884 AH1662 This study 23. p415 Ret2 I145A 73885 AI1732 This study 24. p415 Ret2 I148A 73886 AI1733 This study 25. p415 Ret2 I149A 73887 AI1734 This study 26. p415 Ret2 I155A 73888 AI1735 This study 27. pGEX6P1- Mst7-Erp1CT 73920 This study 28. pGEX6P1-GCN4cc-Erp1CT 73921 This study 29. pGEX6P1- Mst7-Erp2CT 73922 This study 30. pGEX6P1-GCN4cc-Erp2CT 73923 This study 31. p415 Ret2LD2α Q146F 75259 This study 32. p415 Ret2LD2α N152T 75260 This study 33. p415 Ret2LD2α K153Q 75261 This study 34. p415 Ret2LD2α T158K 75262 This study 35. p416 PMP2-YFP-LRKRS — M650 14 36. p416 PMP2-YFP-KKXX — N654 14 37. p416 PMP2-YFP-NVRNRRK — R890 14 38. p416 PMP2-YFP-KKK — M643 14 39. p416 PMP2-YFP-AAXX — N655 14 40. p416 PMP2-YFP-Task3C44T — S901 27 41. pGEX6P1-MST27-LRKRS — F291 14 42. pGEX6P1-MST27-KKXX — O732 14 Open in a separate window Plasmids used in this study

Techniques:

Plasmids used in this study

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: δ-COP contains a helix C-terminal to its longin domain key to COPI dynamics and function

doi: 10.1073/pnas.1603544113

Figure Lengend Snippet: Plasmids used in this study

Article Snippet: Ret2LD2α T158K ( BY4743 Spore ) MAT a his3 ∆ 1 leu2 ∆ 0 met15 ∆ 0 ura3 ∆ 0; YFR051c::kanMX4; p415 ret2LD2 α T158K This study Open in a separate window Yeast strains used in this study table ft1 table-wrap mode="anchored" t5 Table S2. caption a7 No. Plasmids Addgene ID Database ID Source 1. p415 CHI 1 73863 Z1280 This study 2. p415 CHI 2 73864 Z1281 This study 3. p415 CHI 3 73865 Z1283 This study 4. p415 CHI 4 73866 Z1284 This study 5. p415 CHI 5 73867 Z1285 This study 6. p415 CHI 6 73868 Z1286 This study 7. p415 CHI 7 73869 Z1287 This study 8. p415 CHI 8 73870 Z1288 This study 9. pRS303 Bt δCOP 73871 AE1540 This study 10. p415 Ret2 73872 AE1541 This study 11. p415 Ret2LD2α 73873 AE1518 This study 12. p415 δCLD2α 73874 AE1519 This study 13. p415 Ret2LD 73875 AE1520 This study 14. p415 δCLD 73876 AE1521 This study 15. p415 Ret2LD+δC2α 73877 AE1516 This study 16. p415 δCLD+Ret2-2α 73878 AE1523 This study 17. p415 CHI 9 73879 AF1551 This study 18. p415 CHI 10 73880 AF1553 This study 19. p415 CHI 12 73881 AF1557 This study 20. p415 CHI 13 73882 AH1658 This study 21. p415 CHI 14 73883 AH1660 This study 22. p415 CHI 15 73884 AH1662 This study 23. p415 Ret2 I145A 73885 AI1732 This study 24. p415 Ret2 I148A 73886 AI1733 This study 25. p415 Ret2 I149A 73887 AI1734 This study 26. p415 Ret2 I155A 73888 AI1735 This study 27. pGEX6P1- Mst7-Erp1CT 73920 This study 28. pGEX6P1-GCN4cc-Erp1CT 73921 This study 29. pGEX6P1- Mst7-Erp2CT 73922 This study 30. pGEX6P1-GCN4cc-Erp2CT 73923 This study 31. p415 Ret2LD2α Q146F 75259 This study 32. p415 Ret2LD2α N152T 75260 This study 33. p415 Ret2LD2α K153Q 75261 This study 34. p415 Ret2LD2α T158K 75262 This study 35. p416 PMP2-YFP-LRKRS — M650 14 36. p416 PMP2-YFP-KKXX — N654 14 37. p416 PMP2-YFP-NVRNRRK — R890 14 38. p416 PMP2-YFP-KKK — M643 14 39. p416 PMP2-YFP-AAXX — N655 14 40. p416 PMP2-YFP-Task3C44T — S901 27 41. pGEX6P1-MST27-LRKRS — F291 14 42. pGEX6P1-MST27-KKXX — O732 14 Open in a separate window Plasmids used in this study

Techniques:

Comparison of  miR-30c-5p  and miR-92a-3p expression levels. Means ± SD of 2 independent extractions. p < 0.05.

Journal: Current Issues in Molecular Biology

Article Title: Differential Digestive Stability of Food-Derived microRNAs: The Case of miR-30c-5p and miR-92a-3p in Polyfloral Honey

doi: 10.3390/cimb46070443

Figure Lengend Snippet: Comparison of miR-30c-5p and miR-92a-3p expression levels. Means ± SD of 2 independent extractions. p < 0.05.

Article Snippet: The PCR analyses were carried out using the miR-30c-5p 478008_mir (5′–UGUAAACAUCCUACACUCUCAGC–3′) and miR-92a-3p 47827_mir (5′–UAUUGCACUUGUCCCGGCCUGU–3′) primers.

Techniques: Comparison, Expressing

Inverted Ct Values of miR-30c-5p ( A ) and miR-92a-3p ( B ) in polyfloral honey and its digest. Bars are the means of 3 independent extractions. * Significantly lower at p < 0.05 (independent t -test). miR-30c-5p—unpasteurized, p = 0.011 (combined, p = 0.008). miR-92a-3p—pasteurized, p = 0.038; unpasteurized, p = 0.005 (combined, p < 0.001).

Journal: Current Issues in Molecular Biology

Article Title: Differential Digestive Stability of Food-Derived microRNAs: The Case of miR-30c-5p and miR-92a-3p in Polyfloral Honey

doi: 10.3390/cimb46070443

Figure Lengend Snippet: Inverted Ct Values of miR-30c-5p ( A ) and miR-92a-3p ( B ) in polyfloral honey and its digest. Bars are the means of 3 independent extractions. * Significantly lower at p < 0.05 (independent t -test). miR-30c-5p—unpasteurized, p = 0.011 (combined, p = 0.008). miR-92a-3p—pasteurized, p = 0.038; unpasteurized, p = 0.005 (combined, p < 0.001).

Article Snippet: The PCR analyses were carried out using the miR-30c-5p 478008_mir (5′–UGUAAACAUCCUACACUCUCAGC–3′) and miR-92a-3p 47827_mir (5′–UAUUGCACUUGUCCCGGCCUGU–3′) primers.

Techniques: