Journal: Journal of Cancer

Article Title: Strategic Trastuzumab Mediated Crosslinking Driving Concomitant HER2 and HER3 Endocytosis and Degradation in Breast Cancer

doi: 10.7150/jca.32470

Figure Lengend Snippet: Crosslinking-specific alterations in HER2 levels, activation and downstream signalling are detected in HER2 + breast cancer cells following induction of Tz:HER2-crosslinking and the enhanced ERK activation is a consequence not a driver of crosslinking enhanced Tz:HER2 endocytosis . SKBR3 cells and BT474 cells were either untreated (control) or incubated with Tz diluent control 30 min followed by SA alone for 1 hr, Tz alone for 30 min (+ 1 hr SA diluent control), or Tz for 30 min followed by SA for 1 hr (Tz+SA) then chased for a further 6 hr in CIM. Cell lysates were collected from three independent experiments, representative blots are shown. A) Western blotting was performed for HER2, pHER2 (Tyr-1248), P-AKT (Ser-473), total AKT, P-ERK (Thr-202/Tyr-204) and total ERK. B) Band intensities were quantified using ImageJ software. Mean from 3 independent experiments is shown, error bars represent SE, *p≤0.05, **p≤0.01, ***p≤0.001, ****p≤0.0001. The data demonstrate that crosslinking reduced levels of HER2 and induced activation of ERK in both cell lines and reduced the proportion of HER2 phosphorylated at Tyr-1248 in SKBR3 cells. C) SKBR3 cells were, in the continuous presence of 20 nM trametinib or diluent control, either untreated (control) or incubated with Tz diluent control 30 min followed by SA alone for 1 hr, Tz alone for 30 min (+ 1 hr SA diluent control), or Tz for 30 min followed by SA for 1 hr (Tz+SA) followed by a 6 hr chase in CIM. D) Band intensities were quantified using ImageJ software. Mean from 3 independent experiments is shown, error bars represent SE, *p≤0.05 . Data show that there was no significant difference in crosslinking-enhanced downregulation of HER2 in the presence of MEK/ERK inhibition. E) Confocal microscopy analysis of ERK activation dependency of crosslinked Tz:HER2 internalisation. Cells were incubated, in the presence of 20 nM trametinib or diluent control, with Tz for 30 min and imaged (left column). Cells were then incubated for 1 hr with either diluent control (middle column) or SA (right column). Following treatments cells were chased in complete imaging medium for 6 hr and imaged. Scale bar = 50 µm. Data demonstrate that inhibiting MEK/ERK did not significantly alter crosslinking-enhanced internalisation of Tz.

Article Snippet: SKBR3 (ER - , HER2 + ), BT474 (ER + , HER2 + ) and BT474 clone 5 (ER + , HER2 + , Tz resistant) and MCF7 (ER + , HER2 - ) human breast cancer cells were obtained directly from LCG Standards, UK supplier of authenticated American Type Culture Collection (ATCC) cells.

Techniques: Activation Assay, Control, Incubation, Western Blot, Software, Inhibition, Confocal Microscopy, Imaging

Journal: Journal of Cancer

Article Title: Strategic Trastuzumab Mediated Crosslinking Driving Concomitant HER2 and HER3 Endocytosis and Degradation in Breast Cancer

doi: 10.7150/jca.32470

Figure Lengend Snippet: Crosslinking-specific reduction in HER3 in HER2 + breast cancer cells is induced by Tz:HER2-crosslinking . SKBR3 and BT474 cells were either untreated (control) or incubated with Tz diluent control 30 min followed by SA alone for 1 hr, Tz alone for 30 min (+ 1 hr SA diluent control), or Tz for 30 min followed by SA for 1 hr (Tz+SA). Following treatments the cells were chased in CIM for 6 hr. Cell lysates were collected from three independent experiments A) Western blotting was performed for HER3, EGFR and β-tubulin (representative blot shown) and b) band intensities were quantified using ImageJ software. Mean from 3 independent experiments shown, error bars depict SE, *p≤0.05, **p≤0.01, ****p≤0.0001 . The data revealed that HER3, but not EGFR, was specifically reduced by HER2 targeted crosslinking.

Article Snippet: SKBR3 (ER - , HER2 + ), BT474 (ER + , HER2 + ) and BT474 clone 5 (ER + , HER2 + , Tz resistant) and MCF7 (ER + , HER2 - ) human breast cancer cells were obtained directly from LCG Standards, UK supplier of authenticated American Type Culture Collection (ATCC) cells.

Techniques: Control, Incubation, Western Blot, Software

Journal: Journal of Cancer

Article Title: Strategic Trastuzumab Mediated Crosslinking Driving Concomitant HER2 and HER3 Endocytosis and Degradation in Breast Cancer

doi: 10.7150/jca.32470

Figure Lengend Snippet: Enhanced uptake of Tz:HER2 induced by crosslinking is reduced by inhibiting clathrin dependent and independent endocytosis. A) Confocal microscopy analysis of endocytic pathways governing internalisation of Tz-HER2 membrane clusters. SKBR3 cells were transfected with GFP (control) siRNA or sequences targeting AP2M1, caveolin-1 (CAV1) or flotillin-1 (FLOT1) to impair clathrin-dependent and -independent endocytic pathways respectively. Transfected cells (48 hr) were incubated with Tz for 30 min and imaged (left column). Cells were then incubated for 1 hr with either diluent control (middle column) or streptavidin (SA, right column). Following treatments cells were chased in complete imaging medium for 6 hr and imaged. Scale bar = 50 µm, red arrows depict increased membrane retention of Tz. Data show that SA induced crosslinking promoted HER2 internalisation compared with diluent controls under all conditions, however, in AP2M1, CAV1 and FLOT1 depleted cells clustering-induced internalisation was significantly reduced compared with controls. B) Western blotting control data using lysates of the cells imaged in (A). Immunoblots show successful depletion of AP2M1, CAV1 and FLOT1.

Article Snippet: SKBR3 (ER - , HER2 + ), BT474 (ER + , HER2 + ) and BT474 clone 5 (ER + , HER2 + , Tz resistant) and MCF7 (ER + , HER2 - ) human breast cancer cells were obtained directly from LCG Standards, UK supplier of authenticated American Type Culture Collection (ATCC) cells.

Techniques: Confocal Microscopy, Membrane, Transfection, Control, Incubation, Imaging, Western Blot

Journal: Journal of Cancer

Article Title: Strategic Trastuzumab Mediated Crosslinking Driving Concomitant HER2 and HER3 Endocytosis and Degradation in Breast Cancer

doi: 10.7150/jca.32470

Figure Lengend Snippet: Crosslinking induces remodelling at the plasma membrane of SKBR3 cells. Cells were either untreated (control) or incubated with Tz alone for 30 min (+ 10 min SA diluent control), or Tz for 30 min followed by SA for 10 min (Tz+SA). Cells were fixed, dehydrated, sputter coated and imaged by SEM. Two cell phenotypes were observed in response to crosslinking (bottom row): 1) broadened/flattened microvilli and 2) plasma membrane ruffles indicative of macropinocytosis . Scale bar = 1 µm.

Article Snippet: SKBR3 (ER - , HER2 + ), BT474 (ER + , HER2 + ) and BT474 clone 5 (ER + , HER2 + , Tz resistant) and MCF7 (ER + , HER2 - ) human breast cancer cells were obtained directly from LCG Standards, UK supplier of authenticated American Type Culture Collection (ATCC) cells.

Techniques: Clinical Proteomics, Membrane, Control, Incubation

Journal: Journal of Cancer

Article Title: Strategic Trastuzumab Mediated Crosslinking Driving Concomitant HER2 and HER3 Endocytosis and Degradation in Breast Cancer

doi: 10.7150/jca.32470

Figure Lengend Snippet: Tz internalisation and crosslinking-enhanced downregulation of HER2 is actin dependent. A) Confocal microscopy analysis of actin dependency of crosslinked Tz:HER2 internalisation. SKBR3 cells were incubated, in the presence of 5 µM CytD or diluent control, with Tz for 30 min. They were then incubated for 1 hr with either diluent control (middle column) or SA (right column) ± CytD. Following treatments cells were chased in complete imaging medium (containing CytD or diluent control) for 6 hr and imaged. Scale bar = 50 µm. Data demonstrate that disruption of filamentous actin inhibited internalisation of Tz and prevented crosslinking from enhancing Tz endocytosis. B) SKBR3 cells were, in the continuous presence of 5 µM CytD or diluent control, either untreated (control) or incubated with Tz diluent control 30 min followed by SA alone for 1 hr, Tz alone for 30 min (+ 1 hr SA diluent control), or Tz for 30 min followed by SA for 1 hr (Tz+SA). C) Band intensities were quantified using ImageJ software. Mean from 3 independent experiments is shown, error bars represent SE, *p≤0.05, **p≤0.01, ***p≤0.001. Data show that disruption of filamentous actin prevented crosslinking-induced downregulation of HER2 and restricted ERK activation.

Article Snippet: SKBR3 (ER - , HER2 + ), BT474 (ER + , HER2 + ) and BT474 clone 5 (ER + , HER2 + , Tz resistant) and MCF7 (ER + , HER2 - ) human breast cancer cells were obtained directly from LCG Standards, UK supplier of authenticated American Type Culture Collection (ATCC) cells.

Techniques: Confocal Microscopy, Incubation, Control, Imaging, Disruption, Software, Activation Assay

Journal: Journal of Cancer

Article Title: Strategic Trastuzumab Mediated Crosslinking Driving Concomitant HER2 and HER3 Endocytosis and Degradation in Breast Cancer

doi: 10.7150/jca.32470

Figure Lengend Snippet: Crosslinking does not enhance lysosomal targeting of Tz in a Tz-resistant breast cancer cell line and consequently does not induce HER2 downregulation or ERK activation. BT474 clone 5 (acquired Tz resistant) cells were either untreated (control) or incubated with Tz diluent control 30 min followed by SA alone for 1 hr, Tz alone for 30 min (+ 1 hr SA diluent control), or Tz for 30 min followed by SA for 1 hr (Tz+SA) then a 6 hr chase in CIM. For microscopy experiments lysosomes were labelled by dextran pulse-chase prior to antibody treatment. A) Confocal microscopy showing no significant difference in colocalisation between Tz and lysosomes ± SA crosslinking. B) Western blotting was performed for HER2, P-ERK and total ERK (representative blot shown) and C) band intensities were quantified using ImageJ software. Mean from 3 independent experiments is shown, error bars represent SE, ****p≤0.0001. Data revealed no difference in HER2 downregulation or ERK activation in Tz-resistant cells treated with Tz alone or Tz+SA crosslinking.

Article Snippet: SKBR3 (ER - , HER2 + ), BT474 (ER + , HER2 + ) and BT474 clone 5 (ER + , HER2 + , Tz resistant) and MCF7 (ER + , HER2 - ) human breast cancer cells were obtained directly from LCG Standards, UK supplier of authenticated American Type Culture Collection (ATCC) cells.

Techniques: Activation Assay, Control, Incubation, Microscopy, Pulse Chase, Confocal Microscopy, Western Blot, Software

Journal: eLife

Article Title: The translation elongation factor eEF1A1 couples transcription to translation during heat shock response

doi: 10.7554/eLife.03164

Figure Lengend Snippet: ( A ) Knock down of HSF1 or eEF1A1 by DsiRNA does not affect overall protein synthesis. Pulse-chase experiment with [ 35 S]-methionine in mock transfected cells (−), or cells knocked down for HSF1 (H), or eEF1A1 (E). Cells were kept at 37°C (C) or heat-shocked for 45 min at 40°C followed by a 30 min incubation at 40°C with 50 μCi/ml of [ 35 S] (HS). Numbers at the left indicate molecular weight in kDa. ( B ) Inhibition of HSF1 or eEF1A1 does not affect normal cell growth. Quantification of cell viability by the MTT assay was performed on mock-transfected cells (Si:NT) or cells depleted of eEF1A1 or HSF1 under normal cell growth conditions. ns = Non significant differences with Si:NT cells. DOI: http://dx.doi.org/10.7554/eLife.03164.004

Article Snippet: ChIP analysis were performed as described by Antibodies were: rabbit or mouse IgG (Sigma, Grand Island, NY, USA), RNAPII (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Santa Cruz, Dallas, Texas, USA), RNAPII S2 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Abcam, Cambridge, MA, USA), eEF1A (4 μg of Antibody for 80 μg of relative amount of chromatin A260) (Designed in Nudler lab and produced in rabbits and purified by Prosci incorporated), HSF1 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Enzo life sciences, Farmigdale, NY, USA), or Flag (2 μg of Antibody for 80 μg of relative amount of chromatin A260) (Sigma, Sigma, Grand Island, NY, USA).

Techniques: Knockdown, Pulse Chase, Transfection, Incubation, Molecular Weight, Inhibition, MTT Assay

Journal: eLife

Article Title: The translation elongation factor eEF1A1 couples transcription to translation during heat shock response

doi: 10.7554/eLife.03164

Figure Lengend Snippet: ( A ) Knock down of eEF1A1 decreases HSP70 protein expression upon heat shock. Western blots of HSP70, eEF1A1, HSF1, and GAPDH from total cell lysates of MDA-MB231 cells transfected with siRNA (pair A) against eEF1A1 or HSF1, or mock-transfected (Si:NT with no target). Control (C)—unstressed cells kept at 37°C. Heat shock (HS)—cells kept for 1 hr at 43°C followed by 6 hr of recovery at 37°C. ( B ) HSF1- or eEF1A1-knocked down cells are less thermo-tolerant. Cell death was quantified by FACS analysis after propidium iodide staining. Thermotolerance was induced in mock-transfected (Si:NT) or eEF1A1/HSF1-depleted cells by two heat treatments (1 hr at 43°C, 12 hr at 37°C, and 1 hr at 45°C), followed by 12 hr of recovery. Data from three independent experiments are presented as the mean ± SEM. *p < 0.05. ( C ) Knock down of eEF1A1 decreases HSP70 mRNA expression during heat shock. Total RNA from heat shocked MDA-MB231 cells was reverse-transcribed with random hexamer primers followed by quantification of GAPDH and HSP70 mRNAs by QPCR. HSP70 mRNA values were normalized to that of GAPDH. Bars represent the amount of HSP70 mRNA in cells depleted of eEF1A1 relative to that obtained for mock-transfected cells (Si:NT). 1 is the value of HSP70 mRNA in Si:NT cells at 1 hr of heat shock. Data from three independent experiments are presented as the mean ± SEM. *p < 0.05. ( D ) eEF1A1 controls RNAPII occupancy at the HSP70 gene after stress as determined by ChIP-QPCR. Schematic of the HSPA1A locus is shown at the top. Arrowheads indicate the regions amplified by QPCR. Panels show the effect of eEF1A1 knock down (si:eEF1A1) on RNAPII occupancy relative to input Ct value under non-heat shock conditions (control) and after 30 min of heat shock. The relative value for the IgG is indicated for each of the PCR fragments on top of the plot. Values below that of the IgG mean non-specific binding. Mock-transfected cells (Si:NT). By comparison, GAPDH showed no change with si;eEF1A1. Data from three independent experiments are presented as the mean ± SEM. (*p < 0.05). ( E ) eEF1A1 mediates HSP70 transcription upon HS. MEFs were infected with a lentivirus expressing Cherry-eEF1A1. eEF1A1 expression was knocked down by siRNA. At 30 min after HS, cells were fixed and HSP70 mRNA detected by FISH. Nuclei were stained with DAPI. Merged images show Cherry-eEF1A1 in red, HSP70 TS in gray and nucleus in blue. White arrows indicate cells knocked down of eEF1A1. Bar = 10 microns. ( F ) eEF1A1 mediates HSP70 transcription upon HS. Plots are the quantification of the intensity of HSP70 transcription, per cell or per TS, detected by FISH and quantified by airlocalize. A total of seventy cells per condition were analyzed from three independent experiments. NT = non-transfected cells. eEF1A1 = cells transfected with siRNA for eEF1A1. DOI: http://dx.doi.org/10.7554/eLife.03164.003

Article Snippet: ChIP analysis were performed as described by Antibodies were: rabbit or mouse IgG (Sigma, Grand Island, NY, USA), RNAPII (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Santa Cruz, Dallas, Texas, USA), RNAPII S2 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Abcam, Cambridge, MA, USA), eEF1A (4 μg of Antibody for 80 μg of relative amount of chromatin A260) (Designed in Nudler lab and produced in rabbits and purified by Prosci incorporated), HSF1 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Enzo life sciences, Farmigdale, NY, USA), or Flag (2 μg of Antibody for 80 μg of relative amount of chromatin A260) (Sigma, Sigma, Grand Island, NY, USA).

Techniques: Knockdown, Expressing, Western Blot, Transfection, Control, Staining, Reverse Transcription, Random Hexamer, ChIP-qPCR, Amplification, Binding Assay, Comparison, Infection

Journal: eLife

Article Title: The translation elongation factor eEF1A1 couples transcription to translation during heat shock response

doi: 10.7554/eLife.03164

Figure Lengend Snippet: ( A ) Knock down of eEF1A1 decreases HSP70 protein expression upon heat shock. Western blots of HSP70, eEF1A1, HSF1, and GAPDH from total cell lysates of MBS-MEF cells transfected with siRNA (pair B) against eEF1A1 or mock-transfected (Si:NT with no target). Control (C)—unstressed cells kept at 37°C. Heat shock (HS)—cells kept for 1 hr at 43°C followed by 2 hr of recovery (short induction) or 6 hr of recovery (long induction) at 37°C. Low panels—ponceau staining of the membranes. Numbers indicate molecular weight. Plots show the relative fluorescence intensity of bands as compared to mock-transfected non-stressed cells. ( B ) Knock down of eEF1A1 decreases HSP70 mRNA expression during HS. Total RNA from heat shocked MDA-MB231 cells was reverse-transcribed with random hexamer primers followed by quantification of GAPDH and HSP70 mRNAs by QPCR. HSP70 mRNA values were normalized to that of GAPDH. Bars represent the amount of HSP70 mRNA in cells depleted of eEF1A1 relative to that obtained for mock-transfected cells (Si:NT). 1 is the value of HSP70 mRNA in Si:NT cells at 1 hr of heat shock. Data from three independent experiments are presented as the mean ± SEM, *p < 0.05. ( C ) eEF1A1 controls RNAPII occupancy at the HSP70 promoter after stress as determined by ChIP-QPCR. Panels show the effect of eEF1A1 knock down (si:eEF1A1) on RNAPII occupancy relative to the input Ct value after 30 min of heat shock. The relative value for the IgG is indicated for each of the PCR fragments on top of the plot. Values below that of the IgG mean non-specific binding. Mock-transfected cells (Si:NT). Data from two independent experiments are presented as the mean ± SEM. ( D ) eEF1A1 mediates HSP70 transcription upon HS. MEFs were infected with a lentivirus expressing Cherry-eEF1A1. eEF1A1 expression was knocked down by siRNA. At 30 min after HS cells were fixed and HSP70 mRNA detected by FISH. Nucleus stained with DAPI. Yellow arrows indicate TS. Bar = 10 microns. ( E ) eEF1A1 mediates HSP70 transcription upon HS. Plots are the quantification of the intensity of HSP70 transcription, per cell or per TS, detected by FISH and quantified by airlocalize. A total of 25 cells per condition were analyzed from three independent experiments. NT = non-transfected cells. eEF1A1 = cells transfected with siRNA for eEF1A1. DOI: http://dx.doi.org/10.7554/eLife.03164.005

Article Snippet: ChIP analysis were performed as described by Antibodies were: rabbit or mouse IgG (Sigma, Grand Island, NY, USA), RNAPII (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Santa Cruz, Dallas, Texas, USA), RNAPII S2 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Abcam, Cambridge, MA, USA), eEF1A (4 μg of Antibody for 80 μg of relative amount of chromatin A260) (Designed in Nudler lab and produced in rabbits and purified by Prosci incorporated), HSF1 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Enzo life sciences, Farmigdale, NY, USA), or Flag (2 μg of Antibody for 80 μg of relative amount of chromatin A260) (Sigma, Sigma, Grand Island, NY, USA).

Techniques: Knockdown, Expressing, Western Blot, Transfection, Control, Staining, Molecular Weight, Fluorescence, Reverse Transcription, Random Hexamer, ChIP-qPCR, Binding Assay, Infection

Journal: eLife

Article Title: The translation elongation factor eEF1A1 couples transcription to translation during heat shock response

doi: 10.7554/eLife.03164

Figure Lengend Snippet: ( A ) Knock down of eEF1A1 decreases the production of HSP70 in NSC-34 cells (mouse neuroblastoma/spinal cord fusion cell line). The panel indicates expression of eEF1A1 and HSP70 normalized to GAPDH in heat-shocked samples transfected with eEF1A1 siRNAs and the scrambled non-targeting negative control. Two different RNAi were used to inhibit eEF1A1 isoform (pair C): 1A1-a UGACAAUCCAGAACAGGAGCGUAGC; 1A1-b AAGUGGAGGGUAGUCAGAGAAGCUC. Cells were transfected with separate siRNAs (Invitrogen) using siLentFect (Bio-Rad), allowed to recover for 24 hr, incubated at 43°C for 2 hr, and then recovered again for 16 hr. Control cells remained at 37°C for the duration of the experiment. Western-blots were analyzed separately for each siRNA and the values related to those of scrambled control. Data are the mean ± SEM is from three independent experiments. ( B ) Knock down of eEF1A1 suppresses HSP70 protein induction upon heat shock. The panels show western blots of HSP70, eEF1A1, HSF1, and GAPDH from total cell lysates of WI38 human fibroblast cells mock-transfected (Si:NT) or knocked down of eEF1A1. Cells were heat-shocked for 1 hr at 43°C followed by 6 hr of recovery at 37°C. ( C ) Knock down of eEF1A1 decreases HSP27 protein induction upon heat shock. The panels show SDS-PAGE and immunoblots of HSP27, eEF1A, and GAPDH from total cell lysates of mock-transfected (Si:NT) MDA-MB231 cells or cells depleted of eEF1A. Cells were heat-shocked for 1 hr at 43°C followed by 6 hr of recovery at 37°C. ( D ) Knock down of eEF1A1 diminishes HSP70 mRNA expression during heat shock. Total RNA from heat-shocked WI38 cells was reverse-transcribed with random primers followed by quantification of GAPDH and HSP70 mRNAs by QPCR. HSP70 mRNA values were normalized to that of GAPDH. Bars represent the mean ± SEM amount of HSP70 mRNA from three different experiments in cells depleted of eEF1A1 relative to that detected in mock-transfected cells (Si:NT = 1). *p < 0.05. ( E ) Knock down of eEF1A1 diminishes HSP27 mRNA expression during heat shock. Total RNA from heat-shocked MDA-MB-231 cells was reverse-transcribed with random primers followed by quantification of GAPDH and HSP27 mRNAs by QPCR. HSP70 mRNA values were normalized to that of GAPDH. Bars represent the mean ± SEM amount of HSP27 mRNA in cells depleted of eEF1A1 relative to that detected in mock-transfected cells (Si:NT = 1). *p < 0.05. ( F ) eEF1A1 controls transcription of various heat shock genes. Knock down of eEF1A1 compromises mRNA induction of several major heat-shock genes during heat shock. Total RNA from heat-shocked or unstressed MDA-MB231 cells was reverse-transcribed with random primers followed by quantification of GAPDH and the indicated mRNAs by QPCR. mRNA values were normalized to that of GAPDH. Bars represent the amount of HSP mRNAs in cells inhibited of eEF1A1 relative to that in mock-transfected cells (Si:NT = 1) at 2 hr of heat shock. Means ± SEM are from three independent experiments. *p < 0.05. ( G ) Role of eEF1A1 in HSR is independent of its role in translation elongation. Quantification of induction of HSP70 mRNA by RT-QPCR after 1 hr of heat shock or treatment with the translation inhibitors cycloheximide (CHX, 50 μg/ml) or doxycycline (DOX, 5 μg/ml) in mock transfected cells or cells knocked down of eEF1A. Data are the mean ± SEM comparing mock transfected with Si:eEF1A1. *p < 0.05 and **p < 0.01. DOI: http://dx.doi.org/10.7554/eLife.03164.006

Article Snippet: ChIP analysis were performed as described by Antibodies were: rabbit or mouse IgG (Sigma, Grand Island, NY, USA), RNAPII (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Santa Cruz, Dallas, Texas, USA), RNAPII S2 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Abcam, Cambridge, MA, USA), eEF1A (4 μg of Antibody for 80 μg of relative amount of chromatin A260) (Designed in Nudler lab and produced in rabbits and purified by Prosci incorporated), HSF1 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Enzo life sciences, Farmigdale, NY, USA), or Flag (2 μg of Antibody for 80 μg of relative amount of chromatin A260) (Sigma, Sigma, Grand Island, NY, USA).

Techniques: Knockdown, Expressing, Transfection, Negative Control, Incubation, Control, Western Blot, SDS Page, Reverse Transcription, Quantitative RT-PCR

Journal: eLife

Article Title: The translation elongation factor eEF1A1 couples transcription to translation during heat shock response

doi: 10.7554/eLife.03164

Figure Lengend Snippet: ( A ) eEF1A1, but not eEF1A2, mediates HSP70 induction upon heat shock. The levels of HSP70 mRNA with respect to GAPDH were determined by RT-QPCR after 1 hr of heat shock in mock-transfected cells (si: nt) or cells knocked down of eEF1A1 or eEF1A2. The HSP70 mRNA level is taken as 100% in mock transfected cells. Data are the mean ± SEM from three experiments. *p < 0.05. ( B ) Knocking down eEF1A2, does not decrease HSP70 protein induction in NSC-34 cells (mouse neuroblastoma/spinal cord fusion cell line). Panel indicates expression of eEF1A2 and HSP70 normalized to GAPDH in heat-shocked samples transfected with eEF1A2 siRNAs and the scrambled non-targeting negative control. Two different RNAi were used to inhibit eEF1A2 isoform: 1A2-a UUAACGGACACAUUCUUCACAUUGA; 1A2-b CAAUCUUGUACACAUCCUGCAGAGG. Cells were transfected with separate siRNAs (Invitrogen) using siLentFect (Bio-Rad), allowed to recover for 24 hr, incubated at 43°C for 2 hr, and then recovered again for 16 hr. Control cells remained at 37°C for the duration of the experiment. Western-blots were analyzed separately for each siRNA and the values related to those of scrambled control. Data are the mean ± SEM is from three independent experiments. ( C ) Motor neurons express eEF1A2, but not eEF1A1. Immunofluorescence imaging of eEF1A1 (red) and eEF1A2 (green) in the mouse spinal cord shows non-overlapping cytoplasmic staining. eEF1A2 is present only in motor neurons (white arrow). eEF1A1 is present only in smaller interneurons and white matter (glia cells) (yellow arrow). Right panel shows the magnified area (white box in left image). Images were captured at 40x magnification. DOI: http://dx.doi.org/10.7554/eLife.03164.007

Article Snippet: ChIP analysis were performed as described by Antibodies were: rabbit or mouse IgG (Sigma, Grand Island, NY, USA), RNAPII (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Santa Cruz, Dallas, Texas, USA), RNAPII S2 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Abcam, Cambridge, MA, USA), eEF1A (4 μg of Antibody for 80 μg of relative amount of chromatin A260) (Designed in Nudler lab and produced in rabbits and purified by Prosci incorporated), HSF1 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Enzo life sciences, Farmigdale, NY, USA), or Flag (2 μg of Antibody for 80 μg of relative amount of chromatin A260) (Sigma, Sigma, Grand Island, NY, USA).

Techniques: Quantitative RT-PCR, Transfection, Expressing, Negative Control, Incubation, Control, Western Blot, Immunofluorescence, Imaging, Staining

Journal: eLife

Article Title: The translation elongation factor eEF1A1 couples transcription to translation during heat shock response

doi: 10.7554/eLife.03164

Figure Lengend Snippet: ( A ) Schematic of the HSPA1A locus is shown at the top. Plot shows the occupancy of RNAPII relative to input Ct value in eEF1A1 depleted (Si:eEF1A1) and mock-transfected human fibroblast WI38 cells (Si:NT) as determined by ChIP-QPCR. The values for the IgG control are indicated for each PCR fragment. Media ± SEM values lower than those numbers mean no occupancy. ( B ) Nuclear run-on analysis of HSPA1A and GAPDH transcription in heat shocked (43°C, 20 min) control fibroblasts (NT) or eEF1A1-knocked down cells (eEF1A1) with two unrelated siRNAs (pair A or pair B). Numbers on the left represent the hybridization probe position. Numbers on the right represent % of run-on transcripts in eEF1A1-knocked down cells as compared to mock-transfected cells. ( C ) eEF1A1 controls RNAPII occupancy at the HSP70 promoter after stress as determined by ChIP-QPCR. Panels show the effect of eEF1A1 knock down (si:eEF1A1 [pair B]) on RNAPII occupancy relative to the input Ct value under non-HS conditions (C) or after 30 min of heat shock (HS) on HSP70 and GAPDH promoters. Mock-transfected cells (Si:NT). Data from two independent experiments are presented as the mean ± SEM. DOI: http://dx.doi.org/10.7554/eLife.03164.008

Article Snippet: ChIP analysis were performed as described by Antibodies were: rabbit or mouse IgG (Sigma, Grand Island, NY, USA), RNAPII (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Santa Cruz, Dallas, Texas, USA), RNAPII S2 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Abcam, Cambridge, MA, USA), eEF1A (4 μg of Antibody for 80 μg of relative amount of chromatin A260) (Designed in Nudler lab and produced in rabbits and purified by Prosci incorporated), HSF1 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Enzo life sciences, Farmigdale, NY, USA), or Flag (2 μg of Antibody for 80 μg of relative amount of chromatin A260) (Sigma, Sigma, Grand Island, NY, USA).

Techniques: Transfection, ChIP-qPCR, Control, Hybridization, Knockdown

Journal: eLife

Article Title: The translation elongation factor eEF1A1 couples transcription to translation during heat shock response

doi: 10.7554/eLife.03164

Figure Lengend Snippet: ( A ) Panels show Western blots of eEF1A1, Flag and GAPDH from total cell lysates of immortalized MEFs infected with a lentivirus expressing eEF1A1 fused to Cherry and Flag on its N terminus. Wt indicate non-infected cells, sorted are cells sorted to get a homogenous population expressing cherry-eEF1A. Image shows the expression of Cherry-eEF1A1 by fluorescence microscopy after fixation. ( B ) Percentage of cells with active TS for HSP70 detected by FISH. Data represent median ± SEM from four independent experiments. Time in minutes indicate the length MEF cells were at 43°C before fixation and FISH. TS were counted after microscopy. ( C ) Percentage of TS for HSP70 detected by FISH. Date represent media ± SEM from four independent experiments. Time in minutes indicate the length MEF cells were heated at 43°C before fixation and FISH. DOI: http://dx.doi.org/10.7554/eLife.03164.009

Article Snippet: ChIP analysis were performed as described by Antibodies were: rabbit or mouse IgG (Sigma, Grand Island, NY, USA), RNAPII (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Santa Cruz, Dallas, Texas, USA), RNAPII S2 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Abcam, Cambridge, MA, USA), eEF1A (4 μg of Antibody for 80 μg of relative amount of chromatin A260) (Designed in Nudler lab and produced in rabbits and purified by Prosci incorporated), HSF1 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Enzo life sciences, Farmigdale, NY, USA), or Flag (2 μg of Antibody for 80 μg of relative amount of chromatin A260) (Sigma, Sigma, Grand Island, NY, USA).

Techniques: Western Blot, Infection, Expressing, Fluorescence, Microscopy

Journal: eLife

Article Title: The translation elongation factor eEF1A1 couples transcription to translation during heat shock response

doi: 10.7554/eLife.03164

Figure Lengend Snippet: ( A ) eEF1A1 enhances HSF1 DNA binding upon heat shock. Mock-transfected, eEF1A1 or HSF1-knocked down MDA-MB231 cells were heat-shocked for 30 min at 43°C and analyzed by HSF1-HSE EMSA (top panel). 10 μg of total protein were loaded in the EMSA. HSF1, eEF1A1, and GAPDH levels were determined by immunoblotting (lower panel). ( B ) eEF1A1 is required for HSF1 promoter binding in vivo. ChIP-QPCR was performed on mock-transfected (Si:NT) or eEF1A1-knocked down (Si:eEF1A1) cells. Panel shows the effect of eEF1A1 depletion on HSF1 occupancy at the HSP70 promoter (relative to the input Ct value) under non-heat shock conditions (C) and after 30 min of heat shock (HS). The reference value for IgG control is indicated on top of the plot. Values below those numbers mean non-specific binding. Data from three independent experiments are represented as the mean ± SEM. (*p < 0.05). ( C ) Stress-induced formation of the eEF1A1-HSF1 complex in vivo. Extracts from unstressed (C) or heat-shocked (HS) MDA-MB231 cells IPed with eEF1A1 antibody or IgG. IP samples or total protein (Input) were subjected to SDS-PAGE and immunoblotting. ( D ) eEF1A1-HSF1 complex formation at HSE. Panels show the super-shift of HSF1-HSE EMSA caused by specified antibodies. MDA-MB231 cells were heat-shocked for 20 min at 43°C (HS). Extracts were incubated with antibodies to HSF1, HSF2 (positive control), or eEF1A1 antibodies, or IgG (mock). HSE-HSF1 indicates specific binding of HSF1 to labeled HSE; NS—a non-specific band. ( E ) Direct binding of eEF1A1 to HSP70 promoter DNA. Radiolabeled fragment of the region −141 to −91 of the human HSP70 promoter was incubated with purified eEF1A1 (lanes 1–3), chased with fivefold molar excess of cold oligonucleotide (lanes 4 and 5), or mutant fragment of the same region (lane 6). Arrows mark the specific eEF1A1 shift. ( F ) eEF1A1 binds the HSP70 promoter before and after stress. Mock transfected or eEF1A1-knocked down (Si:eEF1A) MDA-MB231 cells were kept at 37°C or heat-shocked (HS) for 20 min at 43°C. Chromatin IP with eEF1A1 or IgG antibodies and amplified by PCR for the HSP70 (HSPA1A) and GAPDH promoters. Relative value of the control IgG vs input for HSPA1A is 0.04 and for GAPDH is 0.05. Data from three independent experiments are presented as the mean ± SEM. *p < 0.05. DOI: http://dx.doi.org/10.7554/eLife.03164.010

Article Snippet: ChIP analysis were performed as described by Antibodies were: rabbit or mouse IgG (Sigma, Grand Island, NY, USA), RNAPII (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Santa Cruz, Dallas, Texas, USA), RNAPII S2 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Abcam, Cambridge, MA, USA), eEF1A (4 μg of Antibody for 80 μg of relative amount of chromatin A260) (Designed in Nudler lab and produced in rabbits and purified by Prosci incorporated), HSF1 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Enzo life sciences, Farmigdale, NY, USA), or Flag (2 μg of Antibody for 80 μg of relative amount of chromatin A260) (Sigma, Sigma, Grand Island, NY, USA).

Techniques: Binding Assay, Transfection, Western Blot, In Vivo, ChIP-qPCR, Control, SDS Page, Incubation, Positive Control, Labeling, Purification, Mutagenesis, Chromatin Immunoprecipitation, Amplification

Journal: eLife

Article Title: The translation elongation factor eEF1A1 couples transcription to translation during heat shock response

doi: 10.7554/eLife.03164

Figure Lengend Snippet: ( A ) Stress-induced formation of the eEF1A1-HSF1 complex in vivo. Extracts from unstressed ( C ) or heat-shocked (HS) MDA-MB231 cells IP with HSF1 antibody or IgG. IP samples or total protein (Input) were subjected to SDS-PAGE and immunoblotting. ( B ) RNA-dependent formation of the eEF1A-HSF1-HSE complex is specific to heat shock. Top panel shows the super-shift of HSF1-HSE EMSA caused by specified antibodies. MDA-MB-231 cells were heat shocked for 20 min at 43°C (HS) or treated with 80 μM arsenite for 2 hr (right panel). Cell extracts were incubated with HSF1 or eEF1A1 antibodies or IgG (mock). In parallel, cells were also treated with RNAse A prior to EMSA (lower panel). ( C ) Chromatin from MDA-MB231 cells was IP with eEF1A1 and IgG antibodies and amplified by PCR targeting the HSP27 promoter region. Control—cells kept at 37°C, HS—cells heat shocked at 43°C for 30 min. Values below IgG number mean no occupancy. DOI: http://dx.doi.org/10.7554/eLife.03164.011

Article Snippet: ChIP analysis were performed as described by Antibodies were: rabbit or mouse IgG (Sigma, Grand Island, NY, USA), RNAPII (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Santa Cruz, Dallas, Texas, USA), RNAPII S2 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Abcam, Cambridge, MA, USA), eEF1A (4 μg of Antibody for 80 μg of relative amount of chromatin A260) (Designed in Nudler lab and produced in rabbits and purified by Prosci incorporated), HSF1 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Enzo life sciences, Farmigdale, NY, USA), or Flag (2 μg of Antibody for 80 μg of relative amount of chromatin A260) (Sigma, Sigma, Grand Island, NY, USA).

Techniques: In Vivo, SDS Page, Western Blot, Incubation, Amplification, Control

Journal: eLife

Article Title: The translation elongation factor eEF1A1 couples transcription to translation during heat shock response

doi: 10.7554/eLife.03164

Figure Lengend Snippet: eEF1A1 localizes to HSP70 TS upon HS. TIGs (human fibroblast cell line) cells were infected with a lentivirus that expresses Cherry-eEF1A1. After 30 min of HS cells were fixed and subjected to FISH to the HSP70 mRNA. Nucleus stained with DAPI. Merged images show HSP70 FISH in green and cherry-eEF1A1 in red. Yellow arrows indicate TS for HSP70 where cherry-eEF1A1 was also detected. Inset location indicated by white arrowheads. n = total number of cells analyzed from three independent experiments. (%) = percentage of TS with colocalization for eEF1A1. Bar = 10 microns. DOI: http://dx.doi.org/10.7554/eLife.03164.013

Article Snippet: ChIP analysis were performed as described by Antibodies were: rabbit or mouse IgG (Sigma, Grand Island, NY, USA), RNAPII (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Santa Cruz, Dallas, Texas, USA), RNAPII S2 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Abcam, Cambridge, MA, USA), eEF1A (4 μg of Antibody for 80 μg of relative amount of chromatin A260) (Designed in Nudler lab and produced in rabbits and purified by Prosci incorporated), HSF1 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Enzo life sciences, Farmigdale, NY, USA), or Flag (2 μg of Antibody for 80 μg of relative amount of chromatin A260) (Sigma, Sigma, Grand Island, NY, USA).

Techniques: Infection, Staining

Journal: eLife

Article Title: The translation elongation factor eEF1A1 couples transcription to translation during heat shock response

doi: 10.7554/eLife.03164

Figure Lengend Snippet: ( A ) eEF1A1 localizes to HSP70 TS upon HS. MEFs were infected with a lentivirus expressing Cherry-eEF1A1. At the indicated times after HS, cells were fixed and HSP70 mRNA detected by FISH. Nucleus stained with DAPI. Merged images show HSP70 FISH in green and cherry-eEF1A1 in red. The nascent mRNA signal is much brighter than the Cherry-eEF1A1 because there were many nascent chains each detected with 48 probes (48 fluors), compared to a single fluorescent protein for eEF1A1, further diminished by fixation. Yellow arrows indicate TS for HSP70 where Cherry-eEF1A1 was also detected. Inset location indicated by white arrowheads. n = total number of cells analyzed from three independent experiments. (%) = percentage of TS with co-localization for eEF1A1. Bar = 10 microns. ( B ) eEF1A1 localizes in nuclear dots. MEFs were infected with a lentivirus expressing Cherry-eEF1A1. At 1 hr of HS cells were fixed and FISH was carried out to detect β-actin mRNA. Nucleus DAPI stained. Merged images show HSP70 FISH in green and Cherry-eEF1A1 in red. Arrowhead = inset location. Note that nuclear localization of Cherry-eEF1A1 does not coincide with the β-actin mRNA TS. ( C ) Quantification of co-localization between eEF1A1 and HSP70 TS. Percentages of co-localization were quantified by airlocalize software at the indicated HS times. Average of three different experiments. Total n = (80–90) cells per time point. ( D ) DRB decreases RNAPIIS2 and eEF1A1 occupancy within the HSP70 gene in HS cells. Data are the mean ± SEM from three independent experiments. MEF cells expressing eEF1A1 tagged with Cherry and Flag were kept under normal growth conditions (control) or heat-shocked for 40 min at 43°C (HS) or treated with 100 µM DRB for 15 min followed by HS (HS+DRB). ChIP was performed using antibodies for RNAPII phosphorylated at Ser2 (RNAPS2) and Flag eEF1A1 followed by QPCR with the indicated primers. ( E ) eEF1A1 binds RNAPII during heat shock. Extracts from unstressed (C) or heat-shocked (HS) MDA-MB231 cells were IP with an eEF1A1 antibody or IgG (mock). IP samples or total protein (Input) were subjected to SDS-PAGE and immunoblotting with RNAPII and eEF1A1 antibodies. (*) Indicates the hyperphosphorylated form of RNAPII. DOI: http://dx.doi.org/10.7554/eLife.03164.012

Article Snippet: ChIP analysis were performed as described by Antibodies were: rabbit or mouse IgG (Sigma, Grand Island, NY, USA), RNAPII (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Santa Cruz, Dallas, Texas, USA), RNAPII S2 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Abcam, Cambridge, MA, USA), eEF1A (4 μg of Antibody for 80 μg of relative amount of chromatin A260) (Designed in Nudler lab and produced in rabbits and purified by Prosci incorporated), HSF1 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Enzo life sciences, Farmigdale, NY, USA), or Flag (2 μg of Antibody for 80 μg of relative amount of chromatin A260) (Sigma, Sigma, Grand Island, NY, USA).

Techniques: Infection, Expressing, Staining, Software, Control, SDS Page, Western Blot

Journal: eLife

Article Title: The translation elongation factor eEF1A1 couples transcription to translation during heat shock response

doi: 10.7554/eLife.03164

Figure Lengend Snippet: MEFs were infected with a lentivirus expressing Cherry-eEF1A1. At the indicated times after HS cells were fixed and HSP70 mRNA detected by FISH. Nucleus stained with DAPI. Merged images show HSP70 FISH in green and cherry-eEF1A1 in red. Yellow arrows indicate TS for HSP70 where cherry-eEF1A1 was also detected. Inset location indicated by white arrowheads. n = total number of cells analyzed from three independent experiments. (%) = percentage of TS with colocalization for eEF1A1. Bar = 10 microns. DOI: http://dx.doi.org/10.7554/eLife.03164.014

Article Snippet: ChIP analysis were performed as described by Antibodies were: rabbit or mouse IgG (Sigma, Grand Island, NY, USA), RNAPII (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Santa Cruz, Dallas, Texas, USA), RNAPII S2 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Abcam, Cambridge, MA, USA), eEF1A (4 μg of Antibody for 80 μg of relative amount of chromatin A260) (Designed in Nudler lab and produced in rabbits and purified by Prosci incorporated), HSF1 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Enzo life sciences, Farmigdale, NY, USA), or Flag (2 μg of Antibody for 80 μg of relative amount of chromatin A260) (Sigma, Sigma, Grand Island, NY, USA).

Techniques: Infection, Expressing, Staining

Journal: eLife

Article Title: The translation elongation factor eEF1A1 couples transcription to translation during heat shock response

doi: 10.7554/eLife.03164

Figure Lengend Snippet: The upper panels show immortalized MEFs expressing Cherry-eEF1A1 treated for FISH without adding any probe. Cells were heated for 40 min at 43°C before fixation. Nucleus stained with DAPI. Yellow arrows indicate dots of cherry-eEF1A accumulation in the nucleus. The lower panels show FISH for HSP70 mRNA in inmortalized MEFs non-expressing Cherry-eEF1A1. Cells were heated for 40 min at 43°C before fixation and FISH. Yellow arrows indicate HSP70 TS. DOI: http://dx.doi.org/10.7554/eLife.03164.015

Article Snippet: ChIP analysis were performed as described by Antibodies were: rabbit or mouse IgG (Sigma, Grand Island, NY, USA), RNAPII (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Santa Cruz, Dallas, Texas, USA), RNAPII S2 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Abcam, Cambridge, MA, USA), eEF1A (4 μg of Antibody for 80 μg of relative amount of chromatin A260) (Designed in Nudler lab and produced in rabbits and purified by Prosci incorporated), HSF1 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Enzo life sciences, Farmigdale, NY, USA), or Flag (2 μg of Antibody for 80 μg of relative amount of chromatin A260) (Sigma, Sigma, Grand Island, NY, USA).

Techniques: Expressing, Staining

Journal: eLife

Article Title: The translation elongation factor eEF1A1 couples transcription to translation during heat shock response

doi: 10.7554/eLife.03164

Figure Lengend Snippet: ( A ). Data are the mean ± SEM from three independent experiments. MEF cells expressing eEF1A1 tagged with Cherry and Flag were kept under normal growth conditions (control) or heat-shocked for 40 min at 43°C (HS) or treated with 100 μM DRB for 15 min followed by HS (HS+DRB). ChIP was performed using antibodies for total RNAPII followed by QPCR with primers for the indicated regions. ( B ) DRB decreases eEF1A1 occupancy within the HSP70 gene upon HS. Data are the mean ± SEM from three independent experiments. Transformed MEFs were mock treated and kept under normal growth conditions (control) or heat-shocked for 40 min at 43°C (HS) or treated with 100 μM DRB for 15 min followed by HS (HS+DRB). ChIP was performed using antibodies for eEF1A1 and Flag (in Flag–cells) or IgG followed by QPCR with the indicated primers. DOI: http://dx.doi.org/10.7554/eLife.03164.016

Article Snippet: ChIP analysis were performed as described by Antibodies were: rabbit or mouse IgG (Sigma, Grand Island, NY, USA), RNAPII (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Santa Cruz, Dallas, Texas, USA), RNAPII S2 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Abcam, Cambridge, MA, USA), eEF1A (4 μg of Antibody for 80 μg of relative amount of chromatin A260) (Designed in Nudler lab and produced in rabbits and purified by Prosci incorporated), HSF1 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Enzo life sciences, Farmigdale, NY, USA), or Flag (2 μg of Antibody for 80 μg of relative amount of chromatin A260) (Sigma, Sigma, Grand Island, NY, USA).

Techniques: Expressing, Control, Transformation Assay

Journal: eLife

Article Title: The translation elongation factor eEF1A1 couples transcription to translation during heat shock response

doi: 10.7554/eLife.03164

Figure Lengend Snippet: ( A ) eEF1A1 binds chromatin-associated HSP70 mRNA. Native ChIP samples were IPed using anti-eEF1A1 antibodies and reverse transcribed followed by HSP70 mRNA quantification. Data are represented as mean ± SEM from three independent experiments. ( B ) eEF1A1 interacts with the HSP70 mRNA in vivo as detected by RNA-IP. The panel shows the RT-PCR products of HSP70 and GAPDH mRNA from control (C) and heat-shocked (HS) cells after IP with indicated antibodies. IgG indicates the mock control. Input is total RNA. ( C ) Interaction between the HSP70 mRNA 3′UTR and eEF1A1 as detected by RNA-EMSA. 4 μg of purified eEF1A1 were incubated with 105 cpm of the 3′UTR or 5′UTR of HSP70 mRNA or a 200 nt fragment of the β-actin ORF radiolabeled by in vitro transcription. Only the 3′UTR of HSP70 mRNA was shifted by eEF1A1 (red line) and further super-shifted by 4 μg of antibody against eEF1A1 (red star). ( D ) Knock down of eEF1A1 diminishes HSP70 mRNA stability. Actinomycin D (Ac) was added 30 min after the onset of heat shock. The level of HSP70 and GAPDH mRNA at this time was taken as 100%. Data are represented as mean ± SEM from three experiments. *p < 0.05. ( E ) eEF1A1-mediates luciferase expression cloned in a HSP70 backbone plasmid. Mock transfected (si:NT) or eEF1A1-knocked down (si:EF) MDA-MB231 cells were transfected with plasmids expressing the SV40- or HSP70-driven luciferase gene fused to the HSP70 3′UTR, and a SV40-renilla luciferase plasmid used as a control. Luciferase activity was measured in cells heat-shocked for 1 hr at 43°C followed by 4 hr of recovery at 37°C. The values were normalized to those of renilla in the same cellular extracts. Bars represent luciferase activity in eEF1A1-deficient cells relative to that obtained for mock-transfected cells. Data are represented as mean ± SEM from three experiments. *p < 0.05. DOI: http://dx.doi.org/10.7554/eLife.03164.017

Article Snippet: ChIP analysis were performed as described by Antibodies were: rabbit or mouse IgG (Sigma, Grand Island, NY, USA), RNAPII (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Santa Cruz, Dallas, Texas, USA), RNAPII S2 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Abcam, Cambridge, MA, USA), eEF1A (4 μg of Antibody for 80 μg of relative amount of chromatin A260) (Designed in Nudler lab and produced in rabbits and purified by Prosci incorporated), HSF1 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Enzo life sciences, Farmigdale, NY, USA), or Flag (2 μg of Antibody for 80 μg of relative amount of chromatin A260) (Sigma, Sigma, Grand Island, NY, USA).

Techniques: Reverse Transcription, In Vivo, Reverse Transcription Polymerase Chain Reaction, Control, Purification, Incubation, In Vitro, Knockdown, Luciferase, Expressing, Clone Assay, Plasmid Preparation, Transfection, Activity Assay

Journal: eLife

Article Title: The translation elongation factor eEF1A1 couples transcription to translation during heat shock response

doi: 10.7554/eLife.03164

Figure Lengend Snippet: ( A ) Knock down of eEF1A1 diminishes HSP70 mRNA stability. Actinomycin D (Ac) was added 30 min after the onset of heat shock. The level of HSP70 and GAPDH mRNA at this time point was taken as 100%. Data are represented as mean ± SEM from two experiments. ( B ) eEF1A1 binds to stem-loop 2 of the HSP70 3′UTR as determined by EMSA. Indicated concentrations of purified eEF1A1 were incubated with 20 kcpm of in vitro transcribed, end labeled HSPA1A 3′UTR RNA (∼0.1 pmol/µl) for 30 min at room temperature. Probe Wt refers to HSPA1A 3′UTR sequence, ΔSL1 is the deletion of nt 7–34, ΔSL2 is the deletion of nt 83–93, 151–158, ΔSL3 is the deletion of nt 217–226, 246–255. M-fold predicted structure for HSPA1A 3′UTR is shown. The stem-loops are marked SL1, SL2, and SL3. The deletion regions are indicated by red rectangles. ( C ) Determination of the dissociation constant for eEF1A1-HSP70 3′UTR. Experiment was performed as in B . DOI: http://dx.doi.org/10.7554/eLife.03164.018

Article Snippet: ChIP analysis were performed as described by Antibodies were: rabbit or mouse IgG (Sigma, Grand Island, NY, USA), RNAPII (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Santa Cruz, Dallas, Texas, USA), RNAPII S2 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Abcam, Cambridge, MA, USA), eEF1A (4 μg of Antibody for 80 μg of relative amount of chromatin A260) (Designed in Nudler lab and produced in rabbits and purified by Prosci incorporated), HSF1 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Enzo life sciences, Farmigdale, NY, USA), or Flag (2 μg of Antibody for 80 μg of relative amount of chromatin A260) (Sigma, Sigma, Grand Island, NY, USA).

Techniques: Knockdown, Purification, Incubation, In Vitro, Labeling, Sequencing

Journal: eLife

Article Title: The translation elongation factor eEF1A1 couples transcription to translation during heat shock response

doi: 10.7554/eLife.03164

Figure Lengend Snippet: ( A ) eEF1A1 mediates HSP70 mRNA export upon HS. MEFs were infected with a lentivirus expressing Cherry-eEF1A1. eEF1A1 expression was knocked down by siRNA. At 120 min after HS cells were fixed and HSP70 mRNA detected by FISH. Nucleus stained with DAPI. Merged images show cherry-eEF1A1 in red and nucleus in blue. Gray image shows HSP70 mRNA FISH. Bar = 10 microns. ( B ) HSP70 mRNA retention in the nucleus of eEF1A1-knocked down cells. The plot shows total (T) and nuclear (N) HSP70 mRNA in control (Si:NT) or eEF1A1-knocked down cells after heat shock. RNA from HeLa cells was RT with random primers followed by quantification of GAPDH and HSP70 mRNAs by QPCR. Total or nuclear HSP70 mRNA was normalized to that of total GAPDH. Data are represented as the mean ± SEM from three independent experiments. *p < 0.05. ( C ) Knock down of eEF1A1 suppresses binding of TPR1 to HSP70 mRNA. HSP70 mRNA was co-IPed with antibodies against eEF1A1 or TPR1 from heat-shocked HeLa cells knocked down of eEF1A1 or mock transfected. Total and IP RNA was RT with random primers and GAPDH and HSP70 mRNAs were quantified by QPCR. Total and IP HSP70 mRNA was normalized against total GAPDH mRNA. Data are represented as the mean ± SEM from three experiments. ( D ) MEFs were infected with a lentivirus expressing Cherry-eEF1A1. At 120 min of HS, cells were fixed and HSP70 mRNA detected by FISH. Nucleus stained with DAPI. Merged images show HSP70 FISH in green and cherry-eEF1A1 in red. Yellow arrowheads indicate areas with high density of HSP70 mRNA and brighter signal for cherry-eEF1A1. ( E ) eEF1A1 contributes to loading of HSP70 mRNA into polysomes. RNA collected from light and heavy polysome fractions was reverse-transcribed with random primers followed by quantification of GAPDH and HSP70 mRNAs by QPCR. Values relate to those obtained from total RNA (Input). Data are presented as the mean ± SEM from three independent experiments. DOI: http://dx.doi.org/10.7554/eLife.03164.019

Article Snippet: ChIP analysis were performed as described by Antibodies were: rabbit or mouse IgG (Sigma, Grand Island, NY, USA), RNAPII (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Santa Cruz, Dallas, Texas, USA), RNAPII S2 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Abcam, Cambridge, MA, USA), eEF1A (4 μg of Antibody for 80 μg of relative amount of chromatin A260) (Designed in Nudler lab and produced in rabbits and purified by Prosci incorporated), HSF1 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Enzo life sciences, Farmigdale, NY, USA), or Flag (2 μg of Antibody for 80 μg of relative amount of chromatin A260) (Sigma, Sigma, Grand Island, NY, USA).

Techniques: Infection, Expressing, Staining, Control, Knockdown, Binding Assay, Transfection, Reverse Transcription

Journal: eLife

Article Title: The translation elongation factor eEF1A1 couples transcription to translation during heat shock response

doi: 10.7554/eLife.03164

Figure Lengend Snippet: ( A and B ) eEF1A1 mediates HSP70 mRNA export upon HS. MEFs were infected with a lentivirus expressing Cherry-eEF1A1. eEF1A1 expression was knocked down by siRNA (pair A for A and pair B for B). At 120 min after HS cells were fixed and HSP70 mRNA detected by FISH. Nucleus stained with DAPI. Merged images show cherry-eEF1A1 in red and nucleus in blue. Gray image shows HSP70 mRNA FISH. Bar = 10 microns. Yellow arrowheads indicate areas with high density of HSP70 mRNA and brighter signal for cherry-eEF1A1. ( C ) Extracts from unstressed ( C ) or heat-shocked (HS) MDA-MB231 cells (60 min at 43°C) were IPed with eEF1A1 antibody or IgG. IP samples or total protein (Input) were subjected to SDS-PAGE and immunoblotting with the indicated antibodies. ( D ) MDA-MB-231 cells were mock-transfected (Si:NT) or knocked-down eEF1A1 (Si:eEF1A1). 48 hr after transfection cells were heat-shocked at 43°C for 30 min and left for recovery at 37°C for 30 min. Cell lysates were laid on 10–55% sucrose gradients and sedimented for 2 hr at 30,000 rpm (43). This allows the separation of larger ribosome-associated mRNAs from translationally inactive sub-polysomal mRNAs. Gradients were collected in 750 μl fractions (the vertical lines in the figure indicate each fraction). Collection was done in an ISCO fraction collector while monitoring the absorbance at 254 nm (y axis). The positions of absorbance peaks corresponding to monosome (40S, 60S, and 80S), and polysomes 1 (2-, 3-, 4-ribosomes per mRNA molecule) and polysomes 2 (5-, 6-, 7-ribosomes per RNA molecule) are indicated. Cells knocked-down for eEF1A1 showed the same polysome profile as Si:NT cells. DOI: http://dx.doi.org/10.7554/eLife.03164.020

Article Snippet: ChIP analysis were performed as described by Antibodies were: rabbit or mouse IgG (Sigma, Grand Island, NY, USA), RNAPII (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Santa Cruz, Dallas, Texas, USA), RNAPII S2 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Abcam, Cambridge, MA, USA), eEF1A (4 μg of Antibody for 80 μg of relative amount of chromatin A260) (Designed in Nudler lab and produced in rabbits and purified by Prosci incorporated), HSF1 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Enzo life sciences, Farmigdale, NY, USA), or Flag (2 μg of Antibody for 80 μg of relative amount of chromatin A260) (Sigma, Sigma, Grand Island, NY, USA).

Techniques: Infection, Expressing, Staining, SDS Page, Western Blot, Transfection

Journal: eLife

Article Title: The translation elongation factor eEF1A1 couples transcription to translation during heat shock response

doi: 10.7554/eLife.03164

Figure Lengend Snippet: The cartoon summarizes the results of this study, implicating eEF1A1 at each stage of HSPs induction. Prior to stress, eEF1A1 resides mostly in the cytoplasm where it is an essential component of the translation machinery (top left quadrant). Upon heat shock (bottom left quadrant), a fraction of eEF1A1 is detected in the HSP70 locus where it recruits HSF1 to an HSP70 promoter, thus activating transcription. eEF1A1 interacts with elongating RNAP II and binds the 3′UTR of HSP70 mRNA to stabilize the transcript and to export it to cytoplasm for efficient translation. By synchronizing all the major steps of HSP70 gene expression, eEF1A1 renders the process of HSR exceptionally robust and coordinated. In cells knocked down for eEF1A1 HSP70 remain at low levels even when cells are stressed (right hand quadrants). DOI: http://dx.doi.org/10.7554/eLife.03164.021

Article Snippet: ChIP analysis were performed as described by Antibodies were: rabbit or mouse IgG (Sigma, Grand Island, NY, USA), RNAPII (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Santa Cruz, Dallas, Texas, USA), RNAPII S2 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Abcam, Cambridge, MA, USA), eEF1A (4 μg of Antibody for 80 μg of relative amount of chromatin A260) (Designed in Nudler lab and produced in rabbits and purified by Prosci incorporated), HSF1 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Enzo life sciences, Farmigdale, NY, USA), or Flag (2 μg of Antibody for 80 μg of relative amount of chromatin A260) (Sigma, Sigma, Grand Island, NY, USA).

Techniques: Gene Expression