Journal: Frontiers in Cell and Developmental Biology

Article Title: Sonic hedgehog is basolaterally sorted from the TGN and transcytosed to the apical domain involving Dispatched-1 at Rab11-ARE

doi: 10.3389/fcell.2022.833175

Figure Lengend Snippet: Shh is apically distributed and secreted in stable transfected MDCK cells. (A) Domain-selective biotinylation of stable transfected MDCK-Shh grown in Transwell filters. MDCK-Shh clone-1 shows Shh mainly at the apical cell surface, changing to non-polarized when cells are treated with 2 mM Na + -butyrate for 24 h to increase Shh expression. MDCK-Shh clone-2 expressing higher Shh levels than clone-1 displays Shh equally distributed among the apical and basolateral cell surface. E-cadherin and Na + /K + -ATPase basolateral distribution corroborates the polarized status of the cells. (B) Graphs show ∼80% apical cell surface distribution (n = 6) and more than 90% apical secretion of Shh in 6 h conditioned media in MDCK-Shh clone-1 (n = 3), (*** p < 0.001); (C) Polarized MDCK-Shh clone 1 cells immunostained for apical cell surface Shh in non-permeabilized cells grown in filters, as well as for total Shh (green) and E-cadherin (magenta) in cells grown in glass coverslips, as indicated. Images are confocal z-stacks maximum projections. Scale bar, 10 μm.

Article Snippet: Cell line ( Canis familiaris ) , MDCK (Madin–Darby canine kidney) II cells , ATCC provided by Enrique Rodriguez-Boulan (Weill Cornell Medical College, New York, United States) , , .

Techniques: Transfection, Expressing

Journal: Frontiers in Cell and Developmental Biology

Article Title: Sonic hedgehog is basolaterally sorted from the TGN and transcytosed to the apical domain involving Dispatched-1 at Rab11-ARE

doi: 10.3389/fcell.2022.833175

Figure Lengend Snippet: Distribution of Disp-1 in polarized MDCK cells. (A) Endogenous Disp-1 expression in MDCK cells. RT-PCR shows the expected band of 562 bp according to primers (see Materials and Methods). (B) MDCK cells grown in glass coverslips or Transwell filters for 3–4 days after reaching confluence were microinjected with expression plasmids for Shh and LDLR-GFP-Y18A, incubated for 4 h at 37°C and processed to detect each expressed protein. Indirect immunofluorescence of Shh (green) and direct imaging of LDLR-GFP-Y18A (magenta) in permeabilized cells show a similar apical and basolateral distribution, respectively, in glass coverslips and filters, validating the polarity conditions. (C) Rab11-ARE distribution in non-polarized and polarized MDCK cells. MDCK cells stably transfected with Rab11-CFP cDNA were grown on glass coverslips until confluence (left) or 3–4 days after confluence (right), then fixed, and imaged by confocal microscopy. The characteristic disperse perinuclear distribution is shown in non-polarized cells, whereas the punctate-like subapical localization is observed after 3–4 days of confluence in coverslips. (D) Distribution of Shh relative to Disp-1 expressed by plasmid microinjection. Polarized MDCK cells in glass coverslips were microinjected to coexpress Shh and Disp-1, fixed and immuno-stained by the apical side with anti-Shh (green) antibody, and then permeabilized and stained for Disp-1 with anti-HA (magenta) antibodies. Disp-1 mainly distributes underneath the apical cell surface stained by non-permeabilized anti-Shh antiody. (E) Polarized MDCK cells grown and treated as in (D) , were fixed, permeabilized, and stained for total anti-Shh (green) and anti-HA (magenta), showing similar Disp-1 and Shh distribution as in (D) . Scale bar, 10 μm.

Article Snippet: Cell line ( Canis familiaris ) , MDCK (Madin–Darby canine kidney) II cells , ATCC provided by Enrique Rodriguez-Boulan (Weill Cornell Medical College, New York, United States) , , .

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Incubation, Immunofluorescence, Imaging, Stable Transfection, Transfection, Confocal Microscopy, Plasmid Preparation, Microinjection, Staining

Journal: Frontiers in Cell and Developmental Biology

Article Title: Sonic hedgehog is basolaterally sorted from the TGN and transcytosed to the apical domain involving Dispatched-1 at Rab11-ARE

doi: 10.3389/fcell.2022.833175

Figure Lengend Snippet: Apical sorting of newly synthesized Shh is indirect through transcytosis. (A) Cell surface targeting assay of newly synthesized Shh and E-cadherin in polarized MDCK-Shh cells grown in Transwell filters. The cells were pulse-labeled with 35 S-methionine/cysteine and chased at 37°C for the indicated times by subsequent cell-surface-specific biotinylation at 4°C. S 35 -Shh is first detected at the basolateral cell surface and then gradually increased at the apical domain, while S 35 -E-cadherin remains basolateral. Graph shows the relative distribution of S 35 -Shh at different time points (30′, n = 5; 60′, n = 7; 120′, n = 4; and 180′, n = 2). (B) Cell surface targeting assay of newly synthesized GPI-anchored protein (GFP-NO-GPI) shows direct apical sorting. (C) Shh basolateral-to-apical transcytosis assay. Filter-grown MDCK-Shh cells were basolaterally labeled at 4°C with reducible biotin linkage (NHS-SS-Biotin), incubated at 37°C for 120 min and then subjected to MesNa reduction at apical or basolateral sides. Shh-biotin, but not E-cadherin–biotin, decreased by reduction at the apical side indicating Shh transcytosis. Graph shows percentage of Shh-biotin after reduction (n = 3; mean ± SEM; unpaired t -test; * p < 0.05). (D) Basolateral cell surface Shh becomes apically secreted. MDCK-Shh cells biotinylated from the basolateral side at 4°C and then incubated at 37°C for 2 h mainly release biotinylated Shh toward the apical media. Graph shows the percentage of total secreted biotinylated Shh precipitated with NeutrAvidin–Agarose beads followed by immunoblot (n = 4; mean ± SEM; unpaired t -test; *** p < 0.001).

Article Snippet: Cell line ( Canis familiaris ) , MDCK (Madin–Darby canine kidney) II cells , ATCC provided by Enrique Rodriguez-Boulan (Weill Cornell Medical College, New York, United States) , , .

Techniques: Synthesized, Labeling, Incubation, Western Blot

Journal: Frontiers in Cell and Developmental Biology

Article Title: Sonic hedgehog is basolaterally sorted from the TGN and transcytosed to the apical domain involving Dispatched-1 at Rab11-ARE

doi: 10.3389/fcell.2022.833175

Figure Lengend Snippet: Shh transcytosis. Polarized MDCK-Shh cells in Transwell filters were incubated with anti-Shh antibodies at 4°C from the basolateral (A – C) or apical (D , E) sides, shifted to 37°C for the indicated times, and detected by the secondary antibody. (A) Antibody-tagged basolateral Shh moved to the apical domain including a subapical punctate compartment, as shown by the secondary antibody (green) added after permeabilizing the cells at the indicated time points. (B) Shh (green) colocalization with endogenous Rab11 (red) after 30 and 60 min of trafficking. Graph shows the percentage of Rab11 colocalizing with Shh (mean ± SEM, n = 15 cells, unpaired t -test *** p < 0.001. (C) Apical cell surface detection of antibody-tagged basolateral Shh. Secondary antibody (red) was added to the apical side of non-permeabilized cells, which then were permeabilized and incubated with another secondary antibody (green). (D) Antibody-tagged apical Shh moved to the basolateral domain, as shown by total staining of permeabilized cells. (E) Basolateral cell surface detection of antibody-tagged apical Shh. Secondary antibody (red) was added to the basolateral side of non-permeabilized cells, which then were permeabilized and incubated with another secondary antibody (green). Scale bar, 10 μm.

Article Snippet: Cell line ( Canis familiaris ) , MDCK (Madin–Darby canine kidney) II cells , ATCC provided by Enrique Rodriguez-Boulan (Weill Cornell Medical College, New York, United States) , , .

Techniques: Incubation, Staining

Journal: Frontiers in Cell and Developmental Biology

Article Title: Sonic hedgehog is basolaterally sorted from the TGN and transcytosed to the apical domain involving Dispatched-1 at Rab11-ARE

doi: 10.3389/fcell.2022.833175

Figure Lengend Snippet: Sorting of Shh lipidation mutants. (A) Schematic Shh processing and lipidation. (B – F) Stable expression of MDCK cells indicated Shh lipidation mutants: lacking both lipids (ShhNC24S) (B) , only palmitoylated (ShhN) (C) , or only cholesteroylated (ShhNpC24S) (D) were analyzed by domain-specific cell surface biotinylation and secretion. Basolateral E-cadherin and Na + /K + ATPase transmembrane proteins and secreted fibronectin (FN) show cell polarity. (E) MDCK-ShhNpC24S cells were pulse-labeled with S 35 -methionine/cysteine and chased to detect protein arrival to each cell surface along with its polarized secretion. Graph shows the mean±SEM from two independent experiments. (F) Secretion of transcytosed ShhNpC24S. MDCK-ShhNpC24S cells biotinylated from the basolateral side at 4°C were then incubated at 37°C for 2 h, and immunoblot of secreted ShhNpC24S was performed on apical and basolateral conditioned media. Graphs of biotinylation and secretion assays (n = 3) represent mean±SEM. ** p < 0.05; *** p < 0.001, ns = no significance.

Article Snippet: Cell line ( Canis familiaris ) , MDCK (Madin–Darby canine kidney) II cells , ATCC provided by Enrique Rodriguez-Boulan (Weill Cornell Medical College, New York, United States) , , .

Techniques: Expressing, Labeling, Incubation, Western Blot

Journal: Frontiers in Cell and Developmental Biology

Article Title: Sonic hedgehog is basolaterally sorted from the TGN and transcytosed to the apical domain involving Dispatched-1 at Rab11-ARE

doi: 10.3389/fcell.2022.833175

Figure Lengend Snippet: Distribution of newly synthesized Shh when co-expressed with Disp-1 or Disp-1-CS. (A) Polarized MDCK cells in glass coverslips were microinjected to express Shh alone (upper panels), together with Disp-1 (middle panels), or Disp-1-CS (lower panels). Images of indirect immunofluorescence for Shh (green) and Disp-1 proteins (HA, magenta) are shown in maximal projections with zoomed images including basolateral (BL) views at the right. When coexpressed with Disp-1, Shh is not only distributed at the apical domain but also appears at basolateral borders of non-microinjected neighboring cells (arrow heads), reflecting its increased secretion. Meanwhile, when coexpressed with Disp-1-CS, Shh became enriched in a punctate subapical compartment (arrow heads) reminiscent of Rab11-ARE. (B) Colocalization of Rab11 with Shh and Disp-1. Polarized MDCK cells in glass coverslips were microinjected with Shh and Disp-1 plasmids, allowed for expression for 4 h at 37°C, fixed, permeabilized, and immunostained for Shh (green), Disp-1 or Disp-1-CS (magenta), and endogenous Rab11 (yellow). (C) Graphs quantified Rab11 colocalization with each protein in cells coexpressing either Disp-1 or Disp-1-CS, as indicated. Rab11 colocalized more with coexpressed Disp-1-CS than Disp-1 (left graph). Co-expressed Disp-1-CS increased Rab11 colocalization with Shh (right graph) (mean±SEM, n = 25 cells from at least three different experiments). *** p < 0.001. Scale bar, 10 μm.

Article Snippet: Cell line ( Canis familiaris ) , MDCK (Madin–Darby canine kidney) II cells , ATCC provided by Enrique Rodriguez-Boulan (Weill Cornell Medical College, New York, United States) , , .

Techniques: Synthesized, Immunofluorescence, Expressing

Journal: Frontiers in Cell and Developmental Biology

Article Title: Sonic hedgehog is basolaterally sorted from the TGN and transcytosed to the apical domain involving Dispatched-1 at Rab11-ARE

doi: 10.3389/fcell.2022.833175

Figure Lengend Snippet: High-resolution image of subapical endosomes containing Shh, Disp-1, and Rab11. Polarized MDCK cells in glass coverslips were microinjected to express Shh and Disp-1 for 4h, fixed, permeabilized, and processed for indirect immunofluorescence of Rab11 (yellow), Shh (green), and Disp-1 (magenta), and 12 confocal images of 100 nm thickness were acquired at the subapical region that include the Rab11 compartment. Deconvolved images are shown as maximum projections (upper panels) and as surface 3D-rendered reconstruction of apical planes (lower panels).

Article Snippet: Cell line ( Canis familiaris ) , MDCK (Madin–Darby canine kidney) II cells , ATCC provided by Enrique Rodriguez-Boulan (Weill Cornell Medical College, New York, United States) , , .

Techniques: Immunofluorescence

Journal: Frontiers in Cell and Developmental Biology

Article Title: Sonic hedgehog is basolaterally sorted from the TGN and transcytosed to the apical domain involving Dispatched-1 at Rab11-ARE

doi: 10.3389/fcell.2022.833175

Figure Lengend Snippet: Live-cell imaging of Shh-GFP in cells coexpressing Disp-1 or Disp-1-CS. Polarized MDCK cells in glass coverslips were microinjected to express Shh-GFP alone or together with Disp-1 or Disp-1-CS. (A) Shh-GFP shows apical distribution after 4 h of expression. (B) Polarized MDCK cells stably expressing Rab11-CFP were microinjected with Shh-GFP plasmid and after 45 min of expression at 37°C, the cells were incubated for 2 h at 20°C to arrest trafficking of protein at the TGN (time = 0) and then shifted to 37°C to reestablish exit from the TGN for 90 min. Arrow heads show basolaterally arrived Shh-GFP, while arrows point to Rab11-ARE showing colocalization with Shh-GFP very likely reflecting its transcytotic route to the apical domain. (C) Polarized MDCK cells microinjected with indicated plasmids and treated as in B to accumulate Shh-GFP at the TGN were analyzed by live-cell imaging for the indicated times. Shh-GFP detected in the border of neighboring non-expressing cells reflects its basolateral secretion and diffusion, which was enhanced by co-expressed Disp-1 but not Disp-1-CS, as more clearly seen in the overexposed 120 min image. (D) Quantification of Shh fluorescence relative intensity at the cell borders of microinjected cells and their neighbors. A line was drawn from the center of an injected cell toward the surrounding non-injected cells. Plot-profile of the line measuring the fluorescence intensity shows peaks revealing cell borders, which are depicted in the graph as intensities relative to injected cells. Scale bar, 10 μm.

Article Snippet: Cell line ( Canis familiaris ) , MDCK (Madin–Darby canine kidney) II cells , ATCC provided by Enrique Rodriguez-Boulan (Weill Cornell Medical College, New York, United States) , , .

Techniques: Live Cell Imaging, Expressing, Stable Transfection, Plasmid Preparation, Incubation, Diffusion-based Assay, Fluorescence, Injection

Journal: Frontiers in Cell and Developmental Biology

Article Title: Sonic hedgehog is basolaterally sorted from the TGN and transcytosed to the apical domain involving Dispatched-1 at Rab11-ARE

doi: 10.3389/fcell.2022.833175

Figure Lengend Snippet: Key resources table.

Article Snippet: Cell line ( Canis familiaris ) , MDCK (Madin–Darby canine kidney) II cells , ATCC provided by Enrique Rodriguez-Boulan (Weill Cornell Medical College, New York, United States) , , .

Techniques: Microinjection, Live Cell Imaging, Transfection, Construct, PCR Cloning, Stable Transfection, Expressing, Transduction, Software, Western Blot, Immunofluorescence

Journal: Cell

Article Title: Memory B cell repertoire for recognition of evolving SARS-CoV-2 spike

doi: 10.1016/j.cell.2021.07.025

Figure Lengend Snippet: SARS-CoV-2 spike-specific mAb binding profiles (A) Cells recovered from two sorting strategies, shown in dot plots as percentages of total CD19 + cells. Left: IgG + CD27 + cells from 18 donors and the subset of those that expressed S-binding BCRs. Right: cells from three donors expressing S-binding BCRs and sorted to recover principally those that did not bind RBD. (B) Summary of all productive mAbs (recombinant human IgG1) screened by ELISA (with recombinant S ectodomain trimer) and cell-surface expression assays (both 293T and yeast cells). Total numbers in the center of each of pie chart; numbers and color codes for the indicated populations shown next to each chart. To the right of the charts for the two sorting strategies are bar graphs showing frequencies of SARS-CoV-2 RBD and NTD binding mAbs for those subjects from whom at least ten paired-chain BCR sequences were recovered. (C) Binding to a panel of S proteins and SARS-CoV-2 subdomains, listed on the left, as determined by both ELISA and by association with S expressed on the surface of 293T cells or with RBD or NTD expressed on the surface of yeast cells, for S + sorted (left) and S + RBD − sorted cells (right). Left panel, 157 clones bound to S and an additional one bound to only RBD but not S. Pink indicates ELISA screens. Blue indicates cell-based screens. Each short section of a row represents an antibody. The rows labeled VH mutation and VL mutation are heatmaps of counts (excluding CDR3) from alignment by IgBLAST, with the scale indicated. (D) Dot plots of VH and VL mutation counts in mAbs that bound RBD, NTD, S2, and a “broad CoV group” that included MERS, HKU1, and OC43. ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; nonparametric Kruskal-Wallis multiple comparison. Horizontal lines show mean ± SEM. See also Figure S1 .

Article Snippet: B cells, enriched from PBMCs with human CD19 MicroBeads (Miltenyi), were incubated with 2 μg/ ml flag-tagged S protein or mixture of flag-tagged S protein (Genscript, Cat. Z03481) and His-tagged RBD ( ) on ice for 30 min.

Techniques: Binding Assay, Expressing, Recombinant, Enzyme-linked Immunosorbent Assay, Clone Assay, Labeling, Mutagenesis, Comparison

Journal: Cell

Article Title: Memory B cell repertoire for recognition of evolving SARS-CoV-2 spike

doi: 10.1016/j.cell.2021.07.025

Figure Lengend Snippet: Sorting strategy for SARS-CoV-2-specific memory B cells and characterization of monoclonal antibodies, related to Figure 1 (A) Representative flow cytometry plots showing CD19 + , CD27 + , SARS-CoV-2 S-binding B cells from a convalescent subject (C12, top row) and a pre-pandemic control (bottom row). PBMCs were pre-enriched with CD19 magnetic beads then gated on live IgD − IgM-IgG + CD27 + and finally on S (B) Representative flow cytometry plots showing S-positive, RBD-negative B cells for three convalescent subjects and a pre-pandemic control, sorted as in (A) except for the S gate. (C) Representative flow plot of mAb supernatant bound to SARS-CoV-2 S on HEK293T cells. Cells were gated on DAPI − GFP + population. (D) Representative flow plot of mAb supernatant bound to SARS-CoV-2 RBD on yeast. cMyc tag indicated yeast that expressed RBD. (E) Representative flow plot of mAb supernatant bound to SARS-CoV-2 NTD on yeast. cMyc tag indicated yeast that expressed NTD. See Figure 1 C for the screening color scheme. (F) Bar graph of Log 10 (EC 50 ) of antibodies targeting RBD, NTD and S2 using ELISA and cell-based assay. EC 50 (μg/mL), RBD (n = 23), NTD clusters (n = 15) and S2 (n = 15). ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; Paired nonparametric Wilcoxon test. Data are mean values ± SEM (G) Dot plot of Log 10 (EC 50 ) of antibodies in the indicated bins by cell-based assay. Antibodies are from subjects G32 and C41, sorted with S. Each dot represents one monoclonal antibody. EC 50 (μg/mL), 13-39 days (n = 13), 40-63 days (n = 8). No significance; nonparametric Mann-Whitney test. Data are mean values ± SEM.

Article Snippet: B cells, enriched from PBMCs with human CD19 MicroBeads (Miltenyi), were incubated with 2 μg/ ml flag-tagged S protein or mixture of flag-tagged S protein (Genscript, Cat. Z03481) and His-tagged RBD ( ) on ice for 30 min.

Techniques: Bioprocessing, Flow Cytometry, Binding Assay, Control, Magnetic Beads, Enzyme-linked Immunosorbent Assay, Cell Based Assay, MANN-WHITNEY

Journal: Cell

Article Title: Memory B cell repertoire for recognition of evolving SARS-CoV-2 spike

doi: 10.1016/j.cell.2021.07.025

Figure Lengend Snippet:

Article Snippet: B cells, enriched from PBMCs with human CD19 MicroBeads (Miltenyi), were incubated with 2 μg/ ml flag-tagged S protein or mixture of flag-tagged S protein (Genscript, Cat. Z03481) and His-tagged RBD ( ) on ice for 30 min.

Techniques: Virus, Recombinant, Enzyme-linked Immunosorbent Assay, Saline, Random Hexamer, Reverse Transcription, Transfection, Luciferase, Plasmid Preparation, Flow Cytometry, Software

Journal: Frontiers in Immunology

Article Title: B7H3-dependent myeloid-derived suppressor cell recruitment and activation in pulmonary fibrosis

doi: 10.3389/fimmu.2022.901349

Figure Lengend Snippet: Clinical significance of circulating MDSCs and association with regulatory T cells and B7H3 + cells. Regression and correlation analyses were performed for MDSC abundance in peripheral blood and its relationship to lung function. The correlations between lung function (DLO, % predicted) and the frequencies of MDSCs (A) , G-MDSCs (B) , and M-MDSCs (C) are shown. N = 62. p < 0.05 in panels A–C. (D) The frequency of M-MDSCs in samples from the IPF patients without treatment was plotted for the correlation analysis. N = 17. p < 0.05. (E) The IPF patient samples were separated into untreated and treated (with pirfenidone or nintedanib) groups, and the M-MDSC frequency was compared between these two groups. N = 22 in untreated; N = 44 in treated IPF group. *p < 0.05. (F) Circulating CD4 + CD25 + regulatory T cells were analyzed in whole blood showing a positive correlation between the frequency of whole blood total MDSC and regulatory T cells. N = 31. p < 0.001. CD4 + CD25 + T-cell correlation between G-MDSC (G) and M-MDSC (H) is shown. N = 33. p < 0.001. The frequency of B7H3 + cells was analyzed, and the correlation with MDSC (I) , G-MDSC (J) , and M-MDSC (K) is shown. N = 42 in panels I and J, and 40 in panel (K) p < 0.05 in panel (I) , p < 0.01 in panel (J) , and p < 0.0001 in panel (K) MDSCs, myeloid-derived suppressor cells; DLCO, diffusing capacity of the lungs for carbon monoxide; G-MDSCs, granulocytic myeloid-derived suppressor cells; M-MDSCs, monocytic myeloid-derived suppressor cells.

Article Snippet: To assess the importance of B7H3 in vivo , blocking antibodies to mouse B7H3 (Bio X cell, Lebanon, NH, USA; Cat# BE0124; Clone# MJ18) or its isotype control rat IgG1 were injected into the mice i.v. via tail veins, every other day starting on day 1 after BLM treatment (0.3 mg/mouse).

Techniques: Derivative Assay

Journal: Frontiers in Immunology

Article Title: B7H3-dependent myeloid-derived suppressor cell recruitment and activation in pulmonary fibrosis

doi: 10.3389/fimmu.2022.901349

Figure Lengend Snippet: B7H3-activated MDSC promoted fibroblast activation/myofibroblast differentiation and suppressed T-cell proliferation. BM-derived MDSCs were treated with sB7H3 (4 µg/ml) or SCF (0.1 µg/ml) in presence of GM-CSF (0.01 µg/ml) for 3 days followed by flow cytometric cell sorting. Sorted G-MDSCs or M-MDSCs were co-cultured with primary isolated MLF in 24-well transwell plates (ratio of MDSC : MLF = 2:1). After 48 h of co-culture, RNA from MLF was isolated and analyzed by qPCR for type I collagen (Col1a2) (A) , α-SMA (Acta2) (B) , and TGFβ1 (Tgfb1) expression (C) . Cellular RNA from sorted G-MDSCs and M-MDSCs was also extracted and similarly analyzed for expression of TGFβ1 (Tgfb1) (D) . The 18S RNA was used as internal control for normalization. The data were expressed as fold change relative to the respective control. (E) B7H3 blocking antibody (Ab) was injected intravenously into mice after BLM treatment. The lung single-cell suspensions were obtained 7 days after BLM treatment for flow cytometry analysis of MDSCs. Representative plots (pre-gated by CD45 + CD11b + cells) are shown on the left panel and the quantitative analysis of percentages and absolute cell numbers on the middle and right panels, respectively. (F) Total lung cell numbers were counted using a hemocytometer. (G) Lung tissue RNA was analyzed by qPCR for Tnfa , Col1a1 , and Acta2 on day 7 after BLM treatment. (H) BM-derived CD11b + Gr1 + MDSCs with (+) or without (−) sB7H3 activation were co-cultured with CFSE pre-labeled splenocytes in media only (Naïve T cell) or in stimulation medium containing CD3/28 Dynabeads+rmIL2 (Activated T-cell) for 3 days. CD4 + or CD8 + T-cell proliferation was assessed by counting CFSE + cells with either T-cell marker using flow cytometry. (I) Fresh BM cells were treated with sB7H3 for 72 h and analyzed for CD84 and MDSC markers. The data were shown as the percentage (left) or the absolute numbers per million BM cells (right) of G-MDSC or M-MDSC in the CD84-expressing CD11b + BM population. Mean ± SD is shown for all. N = 3–8. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001. MDSC, myeloid-derived suppressor cell; BM, bone marrow; sB7H3, soluble B7H3; SCF, stem cell factor; GM-CSF, granulocyte-macrophage colony-stimulating factor; MLF, mouse lung fibroblast; BLM, bleomycin; CFSE, carboxyfluorescein succinimidyl ester.

Article Snippet: To assess the importance of B7H3 in vivo , blocking antibodies to mouse B7H3 (Bio X cell, Lebanon, NH, USA; Cat# BE0124; Clone# MJ18) or its isotype control rat IgG1 were injected into the mice i.v. via tail veins, every other day starting on day 1 after BLM treatment (0.3 mg/mouse).

Techniques: Activation Assay, Derivative Assay, FACS, Cell Culture, Isolation, Co-Culture Assay, Expressing, Control, Blocking Assay, Injection, Flow Cytometry, Labeling, Marker

Journal: Frontiers in Immunology

Article Title: B7H3-dependent myeloid-derived suppressor cell recruitment and activation in pulmonary fibrosis

doi: 10.3389/fimmu.2022.901349

Figure Lengend Snippet: Lung scRNA-seq analysis identified B7H3-expressing cell clusters in human and mouse lung fibrosis. (A) Uniform manifold approximation and projection (UMAP) plots for all lung cells from IPF and control subjects were obtained from the IPF Cell Atlas online database ( CD276 expression was distributed in three distinct cell clusters shown in the top row). Diffusion map implementation labeled by cell type or disease status is shown in the middle row or the bottom row, respectively. (B) Level of CD276 in the lung cell clusters in IPF vs . control subjects. (C) Distribution of the expression signals for the indicated genes within the stromal cell cluster. (D) UMAP plots ( fibroXplorer.com ) of mouse lung fibroblasts identified as Dpt+ universal fibroblasts from BLM-treated lungs. Gene expression level for each gene is shown in the fibroblast sub-clusters. Lung fibroblast sub-clusters are color-coded (see left panel). (E) Pre-labeled MDSCs isolated from naïve BM were placed in the upper inserts. Cell-free CMs collected from untreated (control CM) or TGFβ-treated MLF (TGFβ-CM) cultures were incubated with B7H3 blocking antibody (Ab) or control IgG prior to placing in the lower chambers. The fluorescence intensity of the lower chamber was measured at 18 h of incubation. The data are presented as the percentages of TGFβ CMs over their respective control CMs. Mean ± SD are shown. N = 8/group. ****p < 0.0001. scRNA-seq, single-cell RNA sequencing; IPF, idiopathic pulmonary fibrosis; BLM, bleomycin; CMs, conditioned media; MLF, mouse lung fibroblast.

Article Snippet: To assess the importance of B7H3 in vivo , blocking antibodies to mouse B7H3 (Bio X cell, Lebanon, NH, USA; Cat# BE0124; Clone# MJ18) or its isotype control rat IgG1 were injected into the mice i.v. via tail veins, every other day starting on day 1 after BLM treatment (0.3 mg/mouse).

Techniques: Expressing, Control, Diffusion-based Assay, Labeling, Gene Expression, Isolation, Incubation, Blocking Assay, Fluorescence, RNA Sequencing

Journal: Frontiers in Immunology

Article Title: B7H3-dependent myeloid-derived suppressor cell recruitment and activation in pulmonary fibrosis

doi: 10.3389/fimmu.2022.901349

Figure Lengend Snippet: Schematic illustration of the proposed model for B7H3-dependent MDSC role in pulmonary fibrosis. In response to signals from injured lung, hematopoietic progenitor cells (HPCs) proliferate and give rise to myeloid precursors (MPs) under the control of TERT, GM-CSF, and other potential factors. TERT-expressing MP may govern the origination/expansion of MDSCs at intermediate stage of myeloid cell differentiation. Two subtypes of MDSC (G- and M-MDSC) were expanded and activated with the stimulation of GM-CSF/sB7H3 produced by injured lung tissue. The sB7H3-recruited and/or activated MDSCs, in turn, were able to induce resident lung fibroblast activation and/or myofibroblast differentiation through TGFβ production in a paracrine manner and with the greater impact of M-MDSC, thus promoting lung fibrosis. Lung scRNA-seq analysis-identified macrophages and fibroblasts/myofibroblasts were potential cellular sources for induced B7H3 in injured lungs. The findings suggested the potential importance of the observed elevated circulating MDSCs in IPF pathogenesis. In addition, elevated CD84 + suppressive cell-enriched M-MDSC showed some correlation with Tregs in peripheral blood of IPF patients, suggesting MDSC facilitation of immunosuppressive cell network in IPF as well. MDSC, myeloid-derived suppressor cell; TERT, telomerase reverse transcriptase; GM-CSF, granulocyte-macrophage colony-stimulating factor; G-MDSCs, granulocytic myeloid-derived suppressor cells; M-MDSCs, monocytic myeloid-derived suppressor cells; IPF, idiopathic pulmonary fibrosis.

Article Snippet: To assess the importance of B7H3 in vivo , blocking antibodies to mouse B7H3 (Bio X cell, Lebanon, NH, USA; Cat# BE0124; Clone# MJ18) or its isotype control rat IgG1 were injected into the mice i.v. via tail veins, every other day starting on day 1 after BLM treatment (0.3 mg/mouse).

Techniques: Control, Expressing, Cell Differentiation, Produced, Activation Assay, Derivative Assay, Reverse Transcription

Journal: Brain

Article Title: Activated αβ T and reduced mucosa-associated invariant T cells in LGI1- and CASPR2-encephalitis

doi: 10.1093/brain/awaf096

Figure Lengend Snippet: Single-cell transcriptomics and flow cytometry identified expansion of plasma cells as a hallmark of LGI1-/CASPR2-AIE. ( A ) Sankey diagram showing overlap between LGI1-AIE, CASPR2-AIE, non-inflammatory-disease controls (IIH in cohort 1, functional disorder in cohort 2 and healthy controls in cohort 3) across the four sample cohorts. IHC = immunohistochemistry analysis of formalin-fixed, paraffin-embedded (FFPE) autopsy brain tissue. ( B ) Uniform manifold approximation and projection (UMAP) plot depicting the cell-type clusters of CSF cells. The second cell cluster included only PBMCs and is therefore shown only in . ( C – F ) Comparison of the relative cell-type abundance between LGI1 and IIH ( C ), CASPR2 and IIH ( D ), LGI1 and MS ( E ) and CASPR2 and MS ( F ). ( G ) Flow cytometry validation: relative percentage of plasma cells (%CD3 − CD19 + CD138 + ) quantified as percentages of all lymphocytes in CSF cells of the second cohort. Statistical significance was determined by the Kruskal–Wallis test with Dunn’s post hoc test and adjusted with the Benjamini–Hochberg method. FACS = fluorescence-activated cell sorting; FND = functional neurological disorders; IIH = idiopathic intracranial hypertension; MAIT = mucosal-associated invariant T cell; MS = multiple sclerosis.

Article Snippet: Homozygous MR1-deficient mice (MR1 AIE; LGI1 n = 3, CASPR2 n = 5) and C57BL/6 mice (C57BL6 AIE; LGI1 n = 2; CASPR2 n = 5) (10–15 weeks old, male and female) were immunized twice with recombinant mouse CNTNAP2 (>95% purity) or LGI1 protein (>90% purity) (Cntnap2-3316M, LGI1-9069M, Creative Biomart) emulsified in Complete Freund’s Adjuvant and supplemented with Mycobacterium tuberculosis H37Ra (4 mg/ml).

Techniques: Single-cell Transcriptomics, Flow Cytometry, Clinical Proteomics, Functional Assay, Immunohistochemistry, Formalin-fixed Paraffin-Embedded, Comparison, Biomarker Discovery, Fluorescence, FACS

Journal: Brain

Article Title: Activated αβ T and reduced mucosa-associated invariant T cells in LGI1- and CASPR2-encephalitis

doi: 10.1093/brain/awaf096

Figure Lengend Snippet: B-lineage cells in CSF are preferentially plasmablasts, clonally expanded, and express IgG1/2 and IgG4 heavy chains in LGI1-/CASPR2-AIE. Single-cell transcriptomes of all B-cell clusters (from ) in CSF and PBMCs from LGI1, CASPR2, IIH and MS patients were subclustered and analysed. ( A ) UMAP plot with B-lineage subclusters of CSF cells from AIE patients. Cluster 4 contains only PBMCs and is therefore not shown here. Expressions of selected marker genes are shown in and . Cluster 8 is composed of ‘contaminating’ T cells. ( B ) UMAP plot illustrating the distribution of B-cell clone sizes in CSF from AIE patients. UMAP depicting the immunoglobulin subtype transcribed by CSF cells from AIE patients. ( D ) Comparison of the frequency of transcribed immunoglobulin heavy chains (IGHG1 or IGHG2 versus IGHG4) in antibody-secreting B lymphocytes (ASCs) from CSF in all AIE patients. Only samples with >30 cells were considered. Significance was tested with a Mann–Whitney U-test. ( E and F ) Visual representation of B-cell receptor (BCR) clones (and clonotypes connected by lines) in the CSF (blue) and PBMCs (red) of two representative patients with LGI1-AIE ( E ) and CASPR2-AIE ( F ). Each dot indicates the amount of identical BCRs belonging to one clone. The area of each dot is proportional to the clone size. Clonotypes (connected by lines) were defined as identical VDJ gene segments, identical CDR3 length and a CDR3 nucleotide sequence with two or fewer mismatches. Asterisks mark clones that were verified experimentally as autoantigen specific. ( G ) Circos plot highlighting BCR clones composed of mixtures of plasmablasts, plasma cells and memory B cells. The line thickness indicates the number of cells. Clones consisting of only one cell type are marked in grey. AIE = autoimmune encephalitis; PBMC = peripheral blood mononuclear cell; UMAP = uniform manifold approximation and projection; VDJ = variable–diversity–joining.

Article Snippet: Homozygous MR1-deficient mice (MR1 AIE; LGI1 n = 3, CASPR2 n = 5) and C57BL/6 mice (C57BL6 AIE; LGI1 n = 2; CASPR2 n = 5) (10–15 weeks old, male and female) were immunized twice with recombinant mouse CNTNAP2 (>95% purity) or LGI1 protein (>90% purity) (Cntnap2-3316M, LGI1-9069M, Creative Biomart) emulsified in Complete Freund’s Adjuvant and supplemented with Mycobacterium tuberculosis H37Ra (4 mg/ml).

Techniques: Marker, Comparison, MANN-WHITNEY, Clone Assay, Sequencing, Clinical Proteomics

Journal: Brain

Article Title: Activated αβ T and reduced mucosa-associated invariant T cells in LGI1- and CASPR2-encephalitis

doi: 10.1093/brain/awaf096

Figure Lengend Snippet: T-cell repertoires in CSF of LGI1-/CASPR2-AIE patients show differential changes preferentially in the CD4 TCM clusters, clonal expansion of activated CD4 TCM and CD8 TCM clusters, and blood–CSF-spanning T-cell clones. ( A ) UMAP plot based on the T-cell subclustering (of all T-cell clusters from ) of all PBMCs and CSF cells. ( B and C ) Unbiased, cluster-free analysis of differential T-cell abundance was analysed in a pairwise fashion using the DAseq tool and visualized in shades of red for increases and shades of blue for decreases; comparison of LGI1 and IIH CSF T cells ( B ) and CASPR2 and IIH CSF T cells ( C ). ( D ) T-cell clone sizes in CSF from AIE patients projected onto the UMAP plot. ( E and F ) Visual representation of T-cell receptor clones in CSF (blue) and PBMC (red) of two representative patients with LGI1-AIE ( E ) and CASPR2-AIE ( F ). In the network, each dot indicates one clone (identical VDJ genes and CDR3 regions). The area is proportional to the clone size. The pie charts indicate the percentage of CSF cells and PBMCs within each clone. AIE = autoimmune encephalitis; IIH = idiopathic intracranial hypertension; MAIT = mucosal-associated invariant T cell; NK = natural killer cell; PBMC = peripheral blood mononuclear cell; TCM = central memory T cell; UMAP = uniform manifold approximation and projection; VDJ = variable–diversity–joining.

Article Snippet: Homozygous MR1-deficient mice (MR1 AIE; LGI1 n = 3, CASPR2 n = 5) and C57BL/6 mice (C57BL6 AIE; LGI1 n = 2; CASPR2 n = 5) (10–15 weeks old, male and female) were immunized twice with recombinant mouse CNTNAP2 (>95% purity) or LGI1 protein (>90% purity) (Cntnap2-3316M, LGI1-9069M, Creative Biomart) emulsified in Complete Freund’s Adjuvant and supplemented with Mycobacterium tuberculosis H37Ra (4 mg/ml).

Techniques: Clone Assay, Comparison

Journal: Brain

Article Title: Activated αβ T and reduced mucosa-associated invariant T cells in LGI1- and CASPR2-encephalitis

doi: 10.1093/brain/awaf096

Figure Lengend Snippet: Patients with LGI1-/CASPR2-AIE show trans-compartment loss of innate-like MAIT cells and shifts in the NK cell subpopulations. ( A ) UMAP showing the subclustering of the mixed T-cell cluster (cluster 10, ). The expression levels of marker genes for each cell type shown are visualized in . ( B ) Heat map comparing selected cell-type abundances (of the subclustering shown in ) between AIE patients, IIH and MS controls across CSF and PBMC compartments. Colours indicate an increase (red) or decrease (blue), and asterisks indicate significance ( and ). ( – E ) Flow cytometry validation: cell proportions of dnTc (CD3 + CD4 − CD8 − ) , CD56dim NK cells (CD3 − CD56 dim ) ( D ) CD56bright NK cells ( E ), in the CSF (cohort 2). ( F ) Cell proportion of MAIT cells in PBMCs in another independent flow cytometry cohort (cohort 3). Frequency respective to parent gate. Gating schemes are shown in (cohort 2) and (cohort 3). AIE = autoimmune encephalitis; FND = functional neurological disorders; IIH = idiopathic intracranial hypertension; MAIT = mucosal-associated invariant T cell; MS = multiple sclerosis; NK = natural killer cell; PBMC = peripheral blood mononuclear cell.

Article Snippet: Homozygous MR1-deficient mice (MR1 AIE; LGI1 n = 3, CASPR2 n = 5) and C57BL/6 mice (C57BL6 AIE; LGI1 n = 2; CASPR2 n = 5) (10–15 weeks old, male and female) were immunized twice with recombinant mouse CNTNAP2 (>95% purity) or LGI1 protein (>90% purity) (Cntnap2-3316M, LGI1-9069M, Creative Biomart) emulsified in Complete Freund’s Adjuvant and supplemented with Mycobacterium tuberculosis H37Ra (4 mg/ml).

Techniques: Expressing, Marker, Flow Cytometry, Biomarker Discovery, Functional Assay

Journal: Brain

Article Title: Activated αβ T and reduced mucosa-associated invariant T cells in LGI1- and CASPR2-encephalitis

doi: 10.1093/brain/awaf096

Figure Lengend Snippet: MAIT cells are present in the brain of patients with CASPR2-AIE and LGI1-AIE, and their absence leads to reduced presence of autoantibodies in a murine immunization model. ( A ) Multiplexed immunofluorescence (mIF) staining of post-mortem CASPR2-AIE brain tissue, showing CD3 (red), CD8 (green), DAPI (white), CD4 (yellow) and CD161 (blue). Scale bars = 1 mm in overview; 20 μm in subpanels. ( B and C ) Box plots representing CD3 + CD161 + CD4-gdTc-CD8 +/− T cells as a percentage of CD3 + cells in the parenchyma ( B ) and meninges ( C ) of three human CASPR2- and three LGI1-AIE patients as shown in multiplex immunohistochemistry. ( D and E ) Murine immunization model using full-length LGI1/CASPR2 protein immunization (AIE) versus sham immunizations (control) of MAIT-deficient mice (MR1) and littermates (C57BL6). Serum was analysed on Day 28 for LGI1/CASPR2 antibody positivity using a cell-based assay, and the end point titre was determined. ( D ) Bar plot depicting percentage of antibody-positive mice. ( E ) Box plot showing antibody titre with respect to their disease group. Statistical significance was determined by Fisher’s exact test in D and by Wilcoxon rank test in E . AIE = autoimmune encephalitis; IHC = immunohistochemistry; MAIT = mucosal-associated invariant T cell.

Article Snippet: Homozygous MR1-deficient mice (MR1 AIE; LGI1 n = 3, CASPR2 n = 5) and C57BL/6 mice (C57BL6 AIE; LGI1 n = 2; CASPR2 n = 5) (10–15 weeks old, male and female) were immunized twice with recombinant mouse CNTNAP2 (>95% purity) or LGI1 protein (>90% purity) (Cntnap2-3316M, LGI1-9069M, Creative Biomart) emulsified in Complete Freund’s Adjuvant and supplemented with Mycobacterium tuberculosis H37Ra (4 mg/ml).

Techniques: Immunofluorescence, Staining, Multiplex Assay, Immunohistochemistry, Control, Cell Based Assay

Journal: Cell metabolism

Article Title: TLR8-mediated metabolic control of human Treg function: a mechanistic target for cancer immunotherapy

doi: 10.1016/j.cmet.2018.09.020

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Anti-human CD28 (Clone 9.3) , Bio X Cell , Cat # BE0248; RRID:AB_2687729.

Techniques: Derivative Assay, Recombinant, Reverse Transcription, Selection, Cell Based Assay, Software

Journal: Nature Communications

Article Title: Inhibition of tumor-intrinsic NAT10 enhances antitumor immunity by triggering type I interferon response via MYC/CDK2/DNMT1 pathway

doi: 10.1038/s41467-025-60293-4

Figure Lengend Snippet: A The expression of NAT10 was assessed in different stages of LUAD using the GEPIA website ( http://gepia.cancer-pku.cn/ ). B Kaplan-Meier survival curve comparing the high- and low-NAT10 expression groups (optimal cut-off) in the TCGA-LUAD cohort. C Kaplan-Meier survival curve comparing the high- and low-NAT10 expression groups in 37 patients with lung cancer. NAT10 expression was quantified using immunohistochemistry and Image Pro Plus. Statistical significance was determined using the log-rank test. D ROC curves for survival prediction with corresponding AUC values. The area under the curve (AUC) was calculated, and the statistical significance of AUC comparison between groups was determined using the DeLong test. E , F Tumor weight and growth curves for C57BL/6 N mice inoculated with TC1 ( E ) or MCA205 tumor cells ( F ). 2 × 10 6 WT cells were subcutaneously inoculated into the back of C57BL/6 N mice; n = 5 mice per group. Mice received Remodelin or saline via oral gavage for the first 5 days at a dose of 100 mg/kg. Tumor size was measured daily using calipers to generate growth curves. Tumor growth curves were analyzed by two-way ANOVA with the tumor size at the final day used for significance testing. From left to right, ** P = 0.004; *** P < 0.001; ** P = 0.0015; *** P < 0.001, respectively. G , H Tumor weight and growth curves for nude/nude mice inoculated with TC1 ( G ) or MCA205 tumor cells ( H ). 2 × 10 6 WT cells were subcutaneously inoculated into the back of C57BL/6 N mice; n = 5 mice per group. Mice received Remodelin or saline via oral gavage for the first 5 days at a dose of 100 mg/kg. I Analysis of immune cell infiltration using the CIBERSORT algorithm between high- and low-NAT10 expression groups in the TCGA-LUAD cohort. J Immunohistochemical analysis of NAT10 expression and CD8 + T cell infiltration in patient-derived lung cancer samples (n = 37). CD8 + T cell counts in the high- and low-NAT10 expression groups are presented on the right. The arrow indicates CD8 + T cells; Scale bar: 50 µm; * P = 0.0484. Unless specified otherwise, the data are presented as means ± SEM (error bar) and compared using the two-sided Student’s t test; ns, no significance; Source data are provided as a Source Data file.

Article Snippet: Nat10 coding DNA sequence was cloned into dCAS9-VP64-GFP (Addgene, catalog 61422).

Techniques: Expressing, Immunohistochemistry, Comparison, Saline, Immunohistochemical staining, Derivative Assay

Journal: Nature Communications

Article Title: Inhibition of tumor-intrinsic NAT10 enhances antitumor immunity by triggering type I interferon response via MYC/CDK2/DNMT1 pathway

doi: 10.1038/s41467-025-60293-4

Figure Lengend Snippet: A Gene Set Enrichment Analysis (GSEA) was conducted on the differentially expressed genes between WT and sgNAT10 TC1 tumor tissues ( n = 3 biologically independent samples). Three positively regulated ‘hallmark’ signatures were identified: interferon-alpha response, interferon-gamma response, and inflammatory response (left panel). The gene list was ranked based on the signed likelihood ratio (from log2 fold change [log2FC]) comparing sgNAT10 tumors versus WT TC1 tumors (right panel). B Heatmaps illustrating core biological pathways, such as antigen presentation machinery (APM) and CD8 + T effector cells (Teff), and depicting gene expression (color-coded by log2FC) in columns. C Heatmaps depicting biological pathways related to cell cycle and illustrating gene expression (color-coded by log2FC) in columns. D Multichannel imaging and image analysis were employed to investigate immune cell infiltration in the tumor microenvironment. C57BL/6 N mice were subcutaneously transplanted with either WT or sgNAT10 TC1 tumor cells. On day 8, tumor tissues were subjected to a six-color immunofluorescence analysis. The arrow indicates CD8 + T cells, DCs and Treg cells; n = 3 biologically independent samples; *** P < 0.0001. E C57BL/6 N mice ( n = 5 mice per group) were subcutaneously inoculated with 2×10^6 WT or sgNAT10 TC1 tumor cells. They were intravenously administered with 200 µg of anti-CD8 antibodies per mouse on days -1, 3, and 5. Red arrows indicate the time points of anti-CD8 antibody injections. Tumor growth was monitored at specified time points, starting on day 0. Tumor growth curves were analyzed by two-way ANOVA with the tumor size at the final day used for significance testing; *** P = 0.0002. F , G Flow cytometry was used to analyze the proportions of major immune cell populations in TC1 ( F ) and MCA205 ( G ) tumor tissues ( n = 5 mice per group). Tumor tissues from C57BL/6 N mice, transplanted as described in ( E ), underwent flow cytometry to identify IFN-γ + CD8 + T and GZMB + CD8 + T cells; *** P = 0.0005; * P = 0.0103; * P = 0.0124; ** P = 0.0015. H mRNA expression levels of CD8a, IFN-γ, GZMA, GZMB, Cxcl19, and Cxcl10 genes were analyzed using RT-qPCR in TC1 (left panel) and MCA205 (right panel) tumor tissue. Tumor tissues from C57BL/6 N mice transplanted as described in ( E ) underwent RT-qPCR analysis. Data are presented as fold changes relative to WT tumor ( n = 5 mice per group). From left to right, * P = 0.03; *** P < 0.001; *** P < 0.001; *** P < 0.001; * P = 0.038; ** P = 0.0077; ** P = 0.0036; ** P = 0.0069; *** P < 0.001; * P = 0.0284; * P = 0.049; * P = 0.0283; respectively. I ELISpot assay was conducted to measure IFN-γ secretion in TC1 (left panel) and MCA205 (right panel) tumors. Tumor tissues from C57BL/6 N mice ( n = 5 mice per group) transplanted as described in ( E ) underwent ELISpot analysis. The number of spots was quantified using an ELISpot reader. The results are expressed as spot-forming units (SFU); ** P = 0.0018 (left); *** P = 0.0003 (right). J , K FACS analysis was performed to assess the proliferation of CD8 + ( J ) and CD4 + ( K ) T cells co-cultured with TC1 and MCA205 tumor cells, with or without NAT10 deficiency. The percentage of proliferating (CFSE -low ) cells among all labeled CD4 + or CD8 + T cells is shown on the right of ( J ) and ( K ) ( n = 3 biologically independent samples). From left to right, *** P < 0.001; *** P < 0.001; ** P = 0.0057; ** P = 0.0018; respectively. Unless specified otherwise, the data are presented as means ± SEM (error bar) and compared using the two-sided Student’s t test. Source data are provided as a Source Data file.

Article Snippet: Nat10 coding DNA sequence was cloned into dCAS9-VP64-GFP (Addgene, catalog 61422).

Techniques: Immunopeptidomics, Gene Expression, Imaging, Immunofluorescence, Flow Cytometry, Expressing, Quantitative RT-PCR, Enzyme-linked Immunospot, Cell Culture, Labeling

Journal: Nature Communications

Article Title: Inhibition of tumor-intrinsic NAT10 enhances antitumor immunity by triggering type I interferon response via MYC/CDK2/DNMT1 pathway

doi: 10.1038/s41467-025-60293-4

Figure Lengend Snippet: A The highly enriched motif within ac4C peaks was analyzed using acRIPseq. B The proportion of ac4C peak distribution in the TSS, 5’UTR, start codon, stop codon, and 3’UTR regions across the entire set of mRNA transcripts. C Density distribution of ac4C peaks across mRNA transcripts. D Seven candidate genes, including Phf2, Myc, Wwc2, Kmt2a, Gigyf1, Timeless, and Nufip2, were identified using acRIP-seq and label-free quantitative proteomics. E The expression levels of MYC in sgNAT10 TC1 and MCA205 tumor cells were analyzed by Western blotting. F The peaks of myc in WT and sgNAT10 TC1 cells from acRIP-seq data were visualized using the IGV software. G Schematic representation of the positions of ac4C motifs in Myc mRNA (upper panel). The ac4C sites in the 3’UTR of Myc mRNA were mutated to eliminate ac4C sites as much as possible. The lower panel shows the schematic representation of the mutated 3’UTR of the pEZX-MT06 vector for studying the roles of ac4C in Myc mRNA stability. H Effect of NAT10 on pEZX-MT06-Myc reporter. TC1 tumor cells were cultured in 24-well plates and transfected with Lipofectamine 3000 reagent according to the manufacturer’s instructions. Specifically, 100 ng/well of pEZX-MT06-Myc and either 0, 150, or 300 ng/well of VP64-NAT10 or empty vector were co-transfected. Additionally, Renilla luciferase plasmids (30 ng/well) were co-transfected as a normalization control for transcription efficiency. Luciferase activity was measured 24 h after transfection. The results are presented as relative luciferase activity (luciferase activity normalized to Renilla activity); *** P < 0.001; *** P < 0.001. I Anti-NAT10 antibody-based RIP-PCR analysis of Myc mRNA in TC1 cells. J The mRNA levels of MYC were detected in sgNAT10 TC1 cells after treatment with Act-D. The statistical method used was two-way ANOVA; ** P = 0.0023. Unless specified otherwise, the data are presented as means ± SEM (error bar). Source data are provided as a Source Data file.

Article Snippet: Nat10 coding DNA sequence was cloned into dCAS9-VP64-GFP (Addgene, catalog 61422).

Techniques: Quantitative Proteomics, Expressing, Western Blot, Software, Plasmid Preparation, Cell Culture, Transfection, Luciferase, Control, Activity Assay

Journal: Nature Communications

Article Title: Inhibition of tumor-intrinsic NAT10 enhances antitumor immunity by triggering type I interferon response via MYC/CDK2/DNMT1 pathway

doi: 10.1038/s41467-025-60293-4

Figure Lengend Snippet: A The FPKM of individual genes of the CDK family from RNAseq data originating from WT and sgNAT10 TC1 tumor cells. Heatmap depicting the CDKs and illustrating gene expression (color-coded by log2FC) ( n = 3 biologically independent samples); ** P = 0.0065. B The FPKM of individual genes of the DNMT family from RNAseq data originating from WT and sgNAT10 TC1 tumor cells. Heatmap depicting DNMTs and illustrating gene expression (color-coded by log2FC) ( n = 3 biologically independent samples); *** P = 0.0004. C Western blotting of DNMT1, CDK2, and NAT10 in matched WT, sgNAT10 TC1 (upper panel), and MCA205 (lower panel) tumor cells. β-actin was used as a loading control. D Representative immunofluorescence staining of dsRNA in WT, sgNAT10, sgCDK2, sgNAT10 Myc-rescued, and sgNAT10 Cdk2-rescued TC1 tumor cells was detected using confocal microscopy. Antibody J2 targeted dsRNA (labeled in red). The corresponding statistical diagrams are shown on the right. Statistical analysis was conducted using one-way ANOVA ( n = 15 biologically independent samples); *** P < 0.001; ** P = 0.0055. E Representative immunofluorescence staining of dsRNA in WT, sgNAT10, sgCDK2, sgNAT10 Myc-rescued, and sgNAT10 Cdk2-rescued MCA205 tumor cells was detected using confocal microscopy. The corresponding statistical diagrams are shown on the right. Statistical analysis was conducted using one-way ANOVA ( n = 15 biologically independent samples); *** P < 0.001; ** P = 0.0057. F Protein expression levels of NAT10 and RIG-I in vector, sgNAT10, and sgNAT10/RIG-I TC1 tumor cells determined by Western blotting (upper panel). mRNA expression levels of Ifnb1, Stat1, Tlr3, Ddx58, Ccl5, Ccl7, Tap1, and Mx2 by RT-PCR in vector, sgNAT10, and sgNAT10/RIG-I TC1 tumor cells ( n = 3 biologically independent samples). From left to right, all *** indicate P < 0.001; * P = 0.0451. Unless specified otherwise, the data are presented as means ± SEM (error bar) and compared using the two-sided Student’s t test. Source data are provided as a Source Data file.

Article Snippet: Nat10 coding DNA sequence was cloned into dCAS9-VP64-GFP (Addgene, catalog 61422).

Techniques: Gene Expression, Western Blot, Control, Immunofluorescence, Staining, Confocal Microscopy, Labeling, Expressing, Plasmid Preparation, Reverse Transcription Polymerase Chain Reaction

Journal: Nature Communications

Article Title: Inhibition of tumor-intrinsic NAT10 enhances antitumor immunity by triggering type I interferon response via MYC/CDK2/DNMT1 pathway

doi: 10.1038/s41467-025-60293-4

Figure Lengend Snippet: A The diagram of PEI/PC7A and its size distribution. B Confocal image showing the uptake of PEI/PC7A. TC1 tumor cells were cultured in chamber slides overnight, and then added with 20 nM FAM-labeled siRNA for 4 h. Cells were stained with 50 nM Lyso-Tracker Red (Beyotime, catalog C1046) and 10 µg/mL Hoechst (Beyotime, catalog C1022) for 30 min. Immunofluorescence images were acquired using a Nikon A1 fluorescence microscope. C The mRNA expression levels of NAT10 were measured using RT-PCR in TC1 tumor cells with or without siRNA. 2×10 5 TC1 tumor cells were seeded in 12-well plates overnight. The medium was then replaced with Opti-MEM, and PEI/PC7A was added with a final siRNA concentration of 20 nM (n = 3 biologically independent samples). The data are compared using the two-sided Student’s t test; **P = 0.006. D Protein expression levels of NAT10 were determined by Western blotting in TC1 (left panel) and MCA205 (right panel) tumor cells treated with or without PEI/PC7A/siNAT10 nanoparticles. E Tumor weight for C57BL/6 N mice ( n = 5 mice per group) inoculated with TC1 tumor cells treated with Remodelin or PEI/PC7A/siNAT10 nanoparticles. TC1 tumor cells were inoculated subcutaneously into C57BL/6 N mice. Mice received Remodelin via oral gavage for the first 7 days at a dose of 100 mg/kg. PEI/PC7A containing siRNA (5 nmol/kg) was dissolved in PBS and injected into the tumor on days 4, 7, and 9. Tumor tissues were harvested after sacrificing the mice. Representative images are shown in the left panel. Statistical significance was determined using One-way ANOVA; from left to right, ** P = 0.0006; * P = 0.0183. F Tumor weight for C57BL/6 N mice ( n = 5 mice per group) inoculated with TC1 tumor cells treated with PEI/PC7A/siRNA nanoparticles and/or anti-PD-1 antibodies. TC1 tumor cells were inoculated subcutaneously into C57BL/6 N mice. PEI/PC7A/siNAT10 nanoparticles or saline were injected into the tumor on days 4, 7, and 9. On day 8, mice were treated with IgG control or anti-PD-1 antibodies. Statistical significance was determined using One-way ANOVA; from left to right, *** P < 0.001; ** P = 0.0092. G Representative immunofluorescence staining of CD8 + T cells in TC1 tumor tissues. Tumor tissues from C57BL/6 N mice ( F ) were subjected to immunostaining analysis for CD8 + T cells (red) and nucleus (blue). CD8 + T cells were quantified by counting positive signals in 3 randomly selected fields (20×) per tumor section using Image J. Statistical analysis was conducted using One-way ANOVA, Scale bar, 100 µm; n = 15 biologically independent samples. Statistical significance was determined using One-way ANOVA; from left to right, *** P < 0.001; *** P = 0.0007. H FACS analysis of the proportions of IFN-γ + CD8 + immune cells in TC1 tumor tissues. Tumor tissues from C57BL/6 N mice ( F ) were subjected to FACS analysis for IFN-γ + CD8 + immune cell populations (n = 5 mice per group). Statistical significance was determined using One-way ANOVA; from left to right, *** P = 0.0007; ** P = 0.0046. I Diagram illustrating how tumor-intrinsic NAT10 orchestrates immune evasion and regulates antitumor immunity. Tumor-intrinsic NAT10 directly acetylated Myc mRNA, enhancing Myc transcription and subsequently promoting CDK2 expression, which in turn upregulates DNMT1 and drives cell proliferation. However, inhibition of NAT10 downregulates the MYC/CDK2/DNMT1 pathway, leading to increased formation of dsRNA and triggering RIG-I-mediated IFN-I response. This activation of the innate immune response enhances CD8 + T cell mediated antitumor immunity, offering a potential therapeutic avenue for boosting immune surveillance in cancer. Unless specified otherwise, the data are presented as means ± SEM (error bar). Source data are provided as a Source Data file.

Article Snippet: Nat10 coding DNA sequence was cloned into dCAS9-VP64-GFP (Addgene, catalog 61422).

Techniques: Cell Culture, Labeling, Staining, Immunofluorescence, Fluorescence, Microscopy, Expressing, Reverse Transcription Polymerase Chain Reaction, Concentration Assay, Western Blot, Injection, Saline, Control, Immunostaining, Inhibition, Activation Assay

Journal: The Journal of Experimental Medicine

Article Title: Role for NF-κB in herpes encephalitis pathology in mice genocopying an inborn error of IRF3-IFN immunity

doi: 10.1084/jem.20250064

Figure Lengend Snippet: The hIRF3 R285Q/mIRF3 R278Q mutation impairs type I IFN responses in microglia and confers susceptibility to HSE-like disease. (A) Human iPSC-derived microglia, neurons, and astrocytes were generated from patient fibroblasts or control iPSC. Created with BioRender. (B–D) IFNB1 expression in (B) microglia, (C) astrocytes, and (D) cortical neurons 24 h after infection with HSV-1 at MOI 1.0. HSE pt., HSE patient. (E) Alignment of human and murine IRF3 around the region harboring R285 in WT human IRF3. (F–I) Ifnb1 and Isg15 expression after HSV-1 infection in murine microglia and neurons from WT and transgenic mice carrying the IRF3 R278Q mutation. Microglia (F and G) and neurons (H and I) 24 h after infection with HSV-1 at MOI 1.0. All in vitro experiments were performed in triplicates and independently repeated at least three times. Expression data were normalized to β-actin and shown as fold change compared with the UI control. (J–O) Mice were infected in the cornea with HSV-1 McKrea (2 × 10 6 PFU/eye), and HSE-like disease development was followed over time until reaching humane endpoint or recovering 100% of starting weight. (J) % weight change. (K) Symptom score. (L) Survival curve (UI, n = 7; WT, n = 15; Irf3 WT/R278Q , n = 15; Irf3 R278Q/R278Q , n = 16; Irf3 −/− n = 10). Dead animals were censored in the graphs and thus represented in the graphs with weight and symptom score at time of death. (M) Representative MR images performed on day 5 after infection. Red dotted line and white arrows indicate lesions. (N) Lesion volumes quantified blinded. (O and P) BBB disruption/integrity was assessed visibly by Evans blue perfusion of mice 5 days after HSV-1 infection. Representative microscope images of Evans blue dye leakage in brain stems from UI and HSV-1–infected WT and IRF3 R278Q/R278Q mice were obtained from (O) uncut ventral position (2× objective) and (P) coronal slides cut in 5 mm thickness (3.2× objective). Red circles indicate area of Evans blue passive diffusion into lesion sites. n = 3–7 mice per group. In vivo survival experiments were independently repeated three times, and MR-imaging experiment was repeated two times. Statistical analyses of cell culture experiments (B–D and F–I) were analyzed by two-tailed two-way ANOVA for difference of means, followed by two-tailed unpaired t test of means, error bars; SD. Disease development (weight change and symptom score) were compared between the groups using a mixed-effects analysis with Geisser-Greenhouse correction for multiple interacting variables (time and genotype). Survival was analyzed using log-rank Mantel–Cox test (L). Error bars; SEM. Lesion volumes (N) were analyzed by two-tailed one-way ANOVA followed by unpaired t test, error bars; SD. P values <0.05 were considered statistically significant, **P < 0.01, and ***P < 0.001.

Article Snippet: Quantitative PCR was performed using the following TaqMan Gene Expression Assays (Applied Biosystems): ACTB (Hs01060665_g1), 18S (Hs03003631_g1), IFNB (Hs01077958_s1), IL6 (Hs00174131_m1), TNFA (Hs00174128_m1), IL1B (Hs01555410), MX1 (Hs00895598_m1), CXCL10 (Hs00171042), and ISG15 (Hs01921425). mRNA levels of interest were normalized to the housekeeping gene ACTB or 18S (as indicated) using the ΔΔCt method.

Techniques: Mutagenesis, Derivative Assay, Generated, Control, Expressing, Infection, Transgenic Assay, In Vitro, Disruption, Microscopy, Diffusion-based Assay, In Vivo, Imaging, Cell Culture, Two Tailed Test

Journal: The Journal of Experimental Medicine

Article Title: Role for NF-κB in herpes encephalitis pathology in mice genocopying an inborn error of IRF3-IFN immunity

doi: 10.1084/jem.20250064

Figure Lengend Snippet: Generation of human iPSC-derived microglia, cortical neurons, and astrocytes. (A–H) Confocal microscopy images of iPSCs and derived astrocytes, microglia, and cortical neurons from a healthy control donor and a pediatric HSE patient heterozygous for the IRF3 R285Q amino acid substitution stained with cell type–specific markers. (A and D) iPSCs: NANOG and OCT4 (both green); (B and E) astrocytes: S100 (red) and GFAP (green); (C and F) microglia: TREM2 and Iba1 (both green); (G and H) cortical neurons: MAP2, β-III tubulin (both green), synaptophysin, and TBR1 (both red); nuclei were identified by DAPI staining. Scale bar, 50 μm. (I and J) Comparison of IFNB response to HSV-1 infection in microglia from two different iPSC lines and two different patient-derived iPSC clones measured by RT-qPCR. Commercially available iPSC lines 015A and BIONC (I) and patient-derived iPSC clones C4 and C6 (J). (K) IFNB expression in microglia after stimulation with polyIC (25 μg/ml) and cGAMP (100 μg/ml). (L and M) ISG15 expression in microglia 4 and 24 h after infection with HSV-1 at MOI 1.0. (N and O) ISG15 expression in cortical neurons infected 24 h with HSV-1 at MOI 1.0 or stimulated for 4 h with polyIC (25 μg/ml) and cGAMP (100 μg/ml). Expression data were normalized to β-actin and shown as fold change compared with the UI control. Statistical analyses of gene expression in CNS cell cultures (K–O) were analyzed by two-tailed two-way ANOVA for difference of means, followed by an unpaired t test of means, error bars; SD. P values <0.05 were considered statistically significant, **P < 0.01, and ***P < 0.001.

Article Snippet: Quantitative PCR was performed using the following TaqMan Gene Expression Assays (Applied Biosystems): ACTB (Hs01060665_g1), 18S (Hs03003631_g1), IFNB (Hs01077958_s1), IL6 (Hs00174131_m1), TNFA (Hs00174128_m1), IL1B (Hs01555410), MX1 (Hs00895598_m1), CXCL10 (Hs00171042), and ISG15 (Hs01921425). mRNA levels of interest were normalized to the housekeeping gene ACTB or 18S (as indicated) using the ΔΔCt method.

Techniques: Derivative Assay, Confocal Microscopy, Control, Staining, Comparison, Infection, Clone Assay, Quantitative RT-PCR, Expressing, Gene Expression, Two Tailed Test

Journal: The Journal of Experimental Medicine

Article Title: Role for NF-κB in herpes encephalitis pathology in mice genocopying an inborn error of IRF3-IFN immunity

doi: 10.1084/jem.20250064

Figure Lengend Snippet: Generation and characterization of transgenic mice carrying the IRF3 R278Q allele and susceptibility to infections with HSV-2 and IAV. (A) Mice carrying the patient-specific mIRF3 R278Q amino acid substitution were made using CRISPR microinjection in C57Bl6/J zygotes. The CRISPR guide used was 5′-GTG​GGA​GTG​GCC​TAG​GCG​CTG​GG-3′. (B) Litter size of Irf3 R278Q/R278Q and Irf3 −/− pubs bred at the Aarhus University animal core facility in 2024 compared with average litter size of C57Bl6/JRj mice bred by Janvier. (C) Weight of C57Bl6/JRj, Irf3 WT/R278Q , Irf3 R278Q/R278Q , and Irf3 −/− mice at experiment start (square, female; triangle, male). (D) WB analysis of IRF3 protein and phosphorylation of IRF3 Ser379 in lysates of BMDMs from WT, Irf3 WT/R278Q , Irf3 R278Q/R278Q , and Irf3 −/− mice stimulated with 100 μg/ml cGAMP for 2 h. (E and F) Ifnb and Isg15 gene expression response of murine astrocyte cultures to HSV-1 infection at MOI 1.0 for 24 h. (G–L) Ifnb and Isg15 gene expression response to stimulation with PRR agonists poly-IC (25 μg/ml) or cGAMP (100 μg/ml) for 4 h. Murine astrocyte (G and H), murine microglia (I and J), and murine neurons (K and L). CNS cell culture gene expression was measured by RT-qPCR, and data were normalized to β-actin ( Actb ) and are represented as fold change normalized to expression in UI control. All in vitro experiments were performed in triplicates and independently repeated at least three times. Statistical analyses of gene expression in CNS cell cultures (E–L) were analyzed by two-tailed two-way ANOVA for difference of means, followed by an unpaired t test of means, error bars; SD. (M–X) WT, Irf3 WT/R278Q , Irf3 R278Q/R278Q , and Irf3 −/− mice were infected with (M–T) HSV-2 by the vaginal route or (U–X) IAV via the nasal route and were followed for disease development over time until reaching humane endpoint or recovering 100% of starting weight. (M, Q, and U) % weight change. (N and R) Symptom score. (O, S, and V) Survival curve. Dead animals were censored in the graphs and thus represented in the graphs with weight and symptom score at time of death. HSV-2 longitudinal (M–O) (WT, n = 8; Irf3 R278Q/R278Q , n = 8; Irf3 −/− n = 8), (Q–S) (WT, n = 8; Irf3 WT/R278Q , n = 8; Irf3 R278Q/R278Q , n = 8), and IAV longitudinal (U and V) (WT, n = 11; Irf3 R278Q/R278Q , n = 11; Irf3 −/− , n = 7; UI, n = 6). Viral load was assessed by (P and T) HSV-2 TCID50% assay of vaginal washes on day 2 after infection; (P) WT, n = 8; Irf3 R278Q/R278Q , n = 7; Irf3 −/− n = 7; and (T) WT, n = 8; Irf3 WT/R278Q , n = 8; or (X) IAV M-Protein gene transcripts in lung homogenates on day 4 postnasal inhalation infection measured by RT-PCR (WT, n = 5; Irf3 R278Q/R278Q , n = 5; Irf3 −/− n = 5). Disease development (M, N, Q, R, and U) was compared between the groups using a mixed-effects analysis with Geisser-Greenhouse correction for multiple interacting variables (time and genotype). Error bars; SEM. Survival (O, S, and V) was analyzed using log-rank Mantel–Cox test. Viral load (P, T, and X) was analyzed by two-tailed two-way ANOVA for difference of means, followed by an unpaired t test of means, error bars; SD. P values <0.05 were considered statistically significant, *P < 0.05, **P < 0.01, and ***P < 0.001. Source data are available for this figure: .

Article Snippet: Quantitative PCR was performed using the following TaqMan Gene Expression Assays (Applied Biosystems): ACTB (Hs01060665_g1), 18S (Hs03003631_g1), IFNB (Hs01077958_s1), IL6 (Hs00174131_m1), TNFA (Hs00174128_m1), IL1B (Hs01555410), MX1 (Hs00895598_m1), CXCL10 (Hs00171042), and ISG15 (Hs01921425). mRNA levels of interest were normalized to the housekeeping gene ACTB or 18S (as indicated) using the ΔΔCt method.

Techniques: Transgenic Assay, CRISPR, Microinjection, Phospho-proteomics, Gene Expression, Infection, Cell Culture, Quantitative RT-PCR, Expressing, Control, In Vitro, Two Tailed Test, TCID50 Assay, Reverse Transcription Polymerase Chain Reaction

Journal: The Journal of Experimental Medicine

Article Title: Role for NF-κB in herpes encephalitis pathology in mice genocopying an inborn error of IRF3-IFN immunity

doi: 10.1084/jem.20250064

Figure Lengend Snippet: Comparative analysis of systemic and CNS responses to HSV-1 infection in vivo and in vitro . (A–C) Analysis of viral replication on day 4 after HSV-1 ocular infection (2 × 10 6 PFU/eye) of WT ( n = 12) and Irf3 WT/R278Q heterozygous ( n = 12) mice. UI controls were included (WT UI, n = 3; Irf3 WT/R278Q UI, n = 3). Viral titer in (A) eyes, (B) TG, and (C) brain stem homogenates quantified by plaque assay. (D–I) Systemic cytokine levels measured in serum from WT and Irf3 R278Q/R278Q mice on day 5 after HSV-1 infection. Data points represent cytokine level (pg/ml) in serum from individual mice measured by mesoscale. (J–N) CNS response in WT and Irf3 R278Q/R278Q mice to systemic LPS stimulation in vivo . Gene expression of Ifnb , Tnfa , Il1b , Il6 , and Ccl2 in whole-brain homogenates from mice treated with 5 mg/kg LPS or saline by i.p. injection. Gene expression was measured by RT-qPCR, and data were normalized to β-actin ( Actb ). (O) Validation of microglia depletion by qPCR of Iba1 expression in MBCs treated with 0.5 μM PLX5622 (PLX) or untreated (UT). (P and Q) Expression of Ccl2 in WT mixed brain cultures treated with (P) 0.5 μM PLX5622 (PLX) or mock treated for microglia depletion, or (Q) NF-κB activation inhibitors BMS-345541 2 µM, PDTC 25 µM, or saline, and infected with HSV-1 at MOI 1.0 for 24 h. (R and S) Isg15 and Cxcl10 infection-dose response analysis in murine microglia analyzed by RT-qPCR 24 h after infection with HSV-1 at increasing MOI. For all panels where statistical analyses were performed, the analysis was two-tailed two-way ANOVA for difference of means, followed by two-tailed unpaired t test of means, error bars; SD. P values <0.05 were considered statistically significant. *P < 0.05, **P < 0.01, and ***P < 0.001.

Article Snippet: Quantitative PCR was performed using the following TaqMan Gene Expression Assays (Applied Biosystems): ACTB (Hs01060665_g1), 18S (Hs03003631_g1), IFNB (Hs01077958_s1), IL6 (Hs00174131_m1), TNFA (Hs00174128_m1), IL1B (Hs01555410), MX1 (Hs00895598_m1), CXCL10 (Hs00171042), and ISG15 (Hs01921425). mRNA levels of interest were normalized to the housekeeping gene ACTB or 18S (as indicated) using the ΔΔCt method.

Techniques: Infection, In Vivo, In Vitro, Plaque Assay, Gene Expression, Saline, Injection, Quantitative RT-PCR, Biomarker Discovery, Expressing, Activation Assay, Two Tailed Test

Journal: The Journal of Experimental Medicine

Article Title: Role for NF-κB in herpes encephalitis pathology in mice genocopying an inborn error of IRF3-IFN immunity

doi: 10.1084/jem.20250064

Figure Lengend Snippet: Elevated proinflammatory cytokine levels in the brain of Irf3 R278Q/R278Q mice upon HSV-1 infection. (A–F) Expression of Ifnb , Mx1 , Tnfa , Il1b , Il6 , and Ccl2 in brain stems from WT or Irf3 R278Q/R278Q mice on days 1–4 after infection, measured by RT-qPCR. UI, uninfected control. WT, n = 5–7; Irf3 R278Q/R278Q , n = 5–12. (G–J) Mesoscale analysis of cytokine levels (TNFα, CCL2, and IFNγ) (G–I) and HSV-1 titer in brain stem homogenates on day 5 after infection quantified by plaque assay (J) (WT UI, n = 4, WT, n = 9; Irf3 R278Q/R278Q UI, n = 4; Irf3 R278Q/R278Q , n = 8). (K) Expression of Tnfa in brain stems from WT ( n = 7), Irf3 −/− ( n = 5), Irf3 R278Q/R278Q ( n = 9), and Irf3 WT/R278Q ( n = 6) mice on day 5 after HSV-1 infection, measured by RT-qPCR. (L–N) Ifnb, Tnfa , and Il6 response 16 h after infection with 1.0 MOI HSV-1 in MBCs treated with 0.5 μM PLX5622 (PLX) for microglia depletion. (O and P) Tnfa and Il6 response 16 h after infection with 1.0 MOI HSV-1 in MBCs treated with NF-κB inhibitors BMS-345541 (2 μM), PDTC (25 μM), or saline. UI controls were included. (Q and S) Ifnb and Tnfa mRNA levels in murine microglia from WT, Irf3 WT/R278Q , and Irf3 R278Q/R278Q mice 24 h after HSV-1 infection at increasing virus MOI as indicated. (R and T) IFNB1 and TNFA mRNA levels in iPSC-derived microglia from the IRF3 WT/R285Q HSE patient and controls 24 h after HSV-1 infection at increasing virus MOI as indicated. Expression data were normalized to β-actin and shown as fold change compared with the UI control. All in vitro experiments were performed in triplicates and independently repeated at least three times. Cytokine expression kinetics were compared between the groups using a mixed-effects analysis with Geisser-Greenhouse correction for multiple interacting variables (time and genotype) (A–F), error bars; SEM. Statistical analyses of cytokine and virus levels in brain stem homogenates (G–J and L–T) were analyzed by two-tailed two-way ANOVA for difference of means, followed by an unpaired t test of means, error bars; SD. CNS cell experiments (K) were analyzed with a two-tailed one-way ANOVA for difference of means followed by an unpaired t test of means. P values <0.05 were considered statistically significant, *P < 0.05, **P < 0.01, and ***P < 0.001. UT, untreated; MOI, multiplicity of infection.

Article Snippet: Quantitative PCR was performed using the following TaqMan Gene Expression Assays (Applied Biosystems): ACTB (Hs01060665_g1), 18S (Hs03003631_g1), IFNB (Hs01077958_s1), IL6 (Hs00174131_m1), TNFA (Hs00174128_m1), IL1B (Hs01555410), MX1 (Hs00895598_m1), CXCL10 (Hs00171042), and ISG15 (Hs01921425). mRNA levels of interest were normalized to the housekeeping gene ACTB or 18S (as indicated) using the ΔΔCt method.

Techniques: Infection, Expressing, Quantitative RT-PCR, Control, Plaque Assay, Saline, Virus, Derivative Assay, In Vitro, Two Tailed Test

Journal: PLoS ONE

Article Title: Subcomplex Iλ Specifically Controls Integrated Mitochondrial Functions in Caenorhabditis elegans

doi: 10.1371/journal.pone.0006607

Figure Lengend Snippet: RNAi-generated hypomorphic C. elegans strains for 28 nDNA-encoded complex I subunits and 2 complex I assembly factors were studied by a gene knockdown approach in strains exposed for 3 generations to RNAi.

Article Snippet: Genomic DNA-based GeneService RNAi clones presented no similar problem.

Techniques: Knockdown

Journal: PLoS ONE

Article Title: Subcomplex Iλ Specifically Controls Integrated Mitochondrial Functions in Caenorhabditis elegans

doi: 10.1371/journal.pone.0006607

Figure Lengend Snippet: (a) Identification of RC complexes in N2 (wildtype) mitochondria. (b) BNG electrophoresis of mitochondria isolated from RNAi-generated complex I subunit and assembly factor knockdown strains. All lanes contain 200 mg isolated mitochondrial protein, 3:1 Triton X:protein ratio, 8∶1 Dye/Triton X ratio, 4–12% gradient. Quantitation of individual complex content in each RNAi strain relative to wildtype is provided in .

Article Snippet: Genomic DNA-based GeneService RNAi clones presented no similar problem.

Techniques: Electrophoresis, Isolation, Generated, Knockdown, Quantitation Assay

Journal: Developmental biology

Article Title: Sperm-Oocyte Contact Induces Outside-In Signaling via PYK2 Activation

doi: 10.1016/j.ydbio.2017.05.016

Figure Lengend Snippet: PYK2 recruitment at the site of sperm-oocyte contact. Zona-free oocytes were incubated with a limiting concentration of sperm and samples were fixed at 30 (A,A’), 45 (B, C), and 60 (D) m.p.i., then processed for confocal immunofluorescence. The distribution of anti- PYK2 protein (green) is shown in the top panels, while f-actin detected by alexa 568-phalloidin (red) is shown in the middle row. Sperm chromatin was detected with DRAQ5 (blue) and the combined images containing all three channels are displayed in the bottom row. Specificity of the anit-PYK2 antibody is seen in column (E) where a pyk2−/− oocyte collected at 45 m.p.i. was labeled under identical conditions. Magnification is indicated by the bar’ which represents 5µm.

Article Snippet: An eGFP-linked dominant-negative construct encoding the N-terminal ERM domain (aa1–370) of PYK2 was amplified from the human PYK2 transcript variant 1 cDNA (Origene, Rockville, MD) using the following primers: (forward; CCCAAGCTTATGTCTGGGGTGTCCGAGCCC); (reverse; CCCAAGCTTGCTGTTCCGCTTCTCACCATCTT) which contained a Hind III site used to ligate the product into the N-terminal cloning site of pEGFP-N1 (Clontech, Mountain View, CA).

Techniques: Incubation, Concentration Assay, Immunofluorescence, Labeling

Journal: Developmental biology

Article Title: Sperm-Oocyte Contact Induces Outside-In Signaling via PYK2 Activation

doi: 10.1016/j.ydbio.2017.05.016

Figure Lengend Snippet: PYK2 activation at the site of sperm-oocyte contact. Zona-free oocytes incubated with sperm for 30 minutes and processed for immunofluorescence as above, were labeled with anti PYK2 PY579 (green), alexa 568-phalloidin (red), and DRAQ5 (blue). The position of an aggregation of phosphorylated (activated) PYK2 and f-actin in close proximity to one of the bound sperm is indicated by the arrows. Magnification is indicated by the bar, which represents 10 µm.

Article Snippet: An eGFP-linked dominant-negative construct encoding the N-terminal ERM domain (aa1–370) of PYK2 was amplified from the human PYK2 transcript variant 1 cDNA (Origene, Rockville, MD) using the following primers: (forward; CCCAAGCTTATGTCTGGGGTGTCCGAGCCC); (reverse; CCCAAGCTTGCTGTTCCGCTTCTCACCATCTT) which contained a Hind III site used to ligate the product into the N-terminal cloning site of pEGFP-N1 (Clontech, Mountain View, CA).

Techniques: Activation Assay, Incubation, Immunofluorescence, Labeling

Journal: Developmental biology

Article Title: Sperm-Oocyte Contact Induces Outside-In Signaling via PYK2 Activation

doi: 10.1016/j.ydbio.2017.05.016

Figure Lengend Snippet: Frequency of PYK2 and actin foci formation at sperm binding/fusion sites

Article Snippet: An eGFP-linked dominant-negative construct encoding the N-terminal ERM domain (aa1–370) of PYK2 was amplified from the human PYK2 transcript variant 1 cDNA (Origene, Rockville, MD) using the following primers: (forward; CCCAAGCTTATGTCTGGGGTGTCCGAGCCC); (reverse; CCCAAGCTTGCTGTTCCGCTTCTCACCATCTT) which contained a Hind III site used to ligate the product into the N-terminal cloning site of pEGFP-N1 (Clontech, Mountain View, CA).

Techniques: Binding Assay

Journal: Developmental biology

Article Title: Sperm-Oocyte Contact Induces Outside-In Signaling via PYK2 Activation

doi: 10.1016/j.ydbio.2017.05.016

Figure Lengend Snippet: PYK2 recruitment to sperm binding sites does not require sperm–oocyte fusion. Zona-free CF-1 oocytes were pre-loaded with DRAQ5, then washed and incubated in KSOMaa + 15mg/ml BSA at pH 6.1 or at pH 7.3, as indicated under the X-axis. Capacitated sperm were added and samples were fixed at 20, 30, and 40 minutes post-insemination. For dye diffusion analysis, groups of 10 oocytes collected at each time point were fixed in formaldehyde to maintain membrane integrity and immediately imaged by confocal microscopy with the 633nm laser to identify sperm heads that had accumulated DRAQ5 from the oocyte. Duplicate samples for immunofluorescence detection of PYK2 were fixed in 2% formaldehyde with picric acid, and processed through immunolabeling of PYK2. The percent of oocytes that had fused with at least one sperm is indicated by white bars. The percent of oocytes that exhibited PYK2 foci in close proximity to bound sperm is indicated by grey bars. Values along the Y axis represent the mean of 4 experiments +/− SEM.

Article Snippet: An eGFP-linked dominant-negative construct encoding the N-terminal ERM domain (aa1–370) of PYK2 was amplified from the human PYK2 transcript variant 1 cDNA (Origene, Rockville, MD) using the following primers: (forward; CCCAAGCTTATGTCTGGGGTGTCCGAGCCC); (reverse; CCCAAGCTTGCTGTTCCGCTTCTCACCATCTT) which contained a Hind III site used to ligate the product into the N-terminal cloning site of pEGFP-N1 (Clontech, Mountain View, CA).

Techniques: Binding Assay, Incubation, Diffusion-based Assay, Membrane, Confocal Microscopy, Immunofluorescence, Immunolabeling

Journal: Developmental biology

Article Title: Sperm-Oocyte Contact Induces Outside-In Signaling via PYK2 Activation

doi: 10.1016/j.ydbio.2017.05.016

Figure Lengend Snippet: Recruitment of PYK2 at sperm binding sites of oocytes cultured at pH 6.1. Zona-free oocytes were pre-loaded with DRAQ5, then washed and incubated in KSOMaa + 15mg/ml BSA at pH 6.1, as in Fig 3. Capacitated sperm were added and samples were fixed with 2% formaldehyde containing picric acid at 20 (A), 30 (B), and 40 (C) minutes post-insemination, then prepared for immunofluorescence detection of PYK2. PYK2 protein detected by alexa 488-anti-rabbit IgG is represented in the green channel (top row), while f-actin detected by alexa 568-phalloidin is seen in the red channel (middle row). Sperm chromatin labeled with DRAQ5 is seen in the blue channel. Sperm binding sites where PYK2 accumulation was observed are indicated by the arrows. Magnification is indicated by the bar, which represents 10µm.

Article Snippet: An eGFP-linked dominant-negative construct encoding the N-terminal ERM domain (aa1–370) of PYK2 was amplified from the human PYK2 transcript variant 1 cDNA (Origene, Rockville, MD) using the following primers: (forward; CCCAAGCTTATGTCTGGGGTGTCCGAGCCC); (reverse; CCCAAGCTTGCTGTTCCGCTTCTCACCATCTT) which contained a Hind III site used to ligate the product into the N-terminal cloning site of pEGFP-N1 (Clontech, Mountain View, CA).

Techniques: Binding Assay, Cell Culture, Incubation, Immunofluorescence, Labeling

Journal: Developmental biology

Article Title: Sperm-Oocyte Contact Induces Outside-In Signaling via PYK2 Activation

doi: 10.1016/j.ydbio.2017.05.016

Figure Lengend Snippet: Sperm bound to zona-free oocytes during IVF

Article Snippet: An eGFP-linked dominant-negative construct encoding the N-terminal ERM domain (aa1–370) of PYK2 was amplified from the human PYK2 transcript variant 1 cDNA (Origene, Rockville, MD) using the following primers: (forward; CCCAAGCTTATGTCTGGGGTGTCCGAGCCC); (reverse; CCCAAGCTTGCTGTTCCGCTTCTCACCATCTT) which contained a Hind III site used to ligate the product into the N-terminal cloning site of pEGFP-N1 (Clontech, Mountain View, CA).

Techniques:

Journal: Developmental biology

Article Title: Sperm-Oocyte Contact Induces Outside-In Signaling via PYK2 Activation

doi: 10.1016/j.ydbio.2017.05.016

Figure Lengend Snippet: Role of PYK2 in gamete fusion and sperm incorporation. The timing and extent of sperm-oocyte fusion was quantified in WT (white bars) and pyk2−/− (grey bars) oocytes pre-loaded with DRAQ5 as in Fig. 3. Samples of oocytes were collected at 60, 90, and 120 m.p.i. to correlate with the sperm incorporation timecourse (below). Sperm heads bound to the oocyte surface that accumulated DRAQ5 from the oocyte were considered to have fused with the oocyte plasma membrane (panel A). Values represent the mean of 4 experiments including 116 WT oocytes and 126 pyk2−/− oocytes. The timing and extent of sperm incorporation was quantified in separate experiments (Panel B) where WT (white bars) and pyk2−/− (grey bars) oocytes were fixed and labeled with DRAQ 5 to label all sperm heads and with alexa 568-phalloidin to label the cortical actin layer. Sperm heads that were located within the oocyte cytoplasm and which showed evidence of nuclear decondensation were considered to be incorporated. Values in panel B represent the mean of 5 groups including 123 WT oocytes and 133 pyk2−/− oocytes +/− SEM. (*) f-test indicated that the WT and pyk2−/− means were significantly different (P=0.01).

Article Snippet: An eGFP-linked dominant-negative construct encoding the N-terminal ERM domain (aa1–370) of PYK2 was amplified from the human PYK2 transcript variant 1 cDNA (Origene, Rockville, MD) using the following primers: (forward; CCCAAGCTTATGTCTGGGGTGTCCGAGCCC); (reverse; CCCAAGCTTGCTGTTCCGCTTCTCACCATCTT) which contained a Hind III site used to ligate the product into the N-terminal cloning site of pEGFP-N1 (Clontech, Mountain View, CA).

Techniques: Clinical Proteomics, Membrane, Labeling

Journal: Developmental biology

Article Title: Sperm-Oocyte Contact Induces Outside-In Signaling via PYK2 Activation

doi: 10.1016/j.ydbio.2017.05.016

Figure Lengend Snippet: Role of PYK2 in actin polymerization at sperm-oocyte binding sites. Oocytes in which PYK2 was suppressed by different methods were incubated with capacitated sperm, then fixed at 45 m.p.i. to determine whether they could respond to sperm binding by accumulation of t-actin in the cortical actin layer. The distribution of actin at sites of sperm contact was detected by labeling with alexa 568-phalloidin to detect t-actin (red) and DRAQ5 to detect sperm DNA (blue). PYK2 activity was suppressed in WT oocytes by three independent methods. The effect of chemical inhibition is shown in panels A and B, where oocytes were treated with 0.1% DMSO as a solvent control (A) or with the inhibitor PF0454799 at 10uM for 30 minutes, then washed prior to addition of sperm (B). The effect of the dominant-negative PERM fusion construct was tested by injecting oocytes with cRNA encoding eGFP as a control (C), or with cRNA encoding the inhibitory PERM-eGFP construct (D). Panels E and F demonstrate the effect of pyk2 knockout on the response of oocytes to bound sperm with examples of sperm bound to a WT oocyte (E) and a pyk2 −/− oocyte (F). Magnification is indicated by the bar which represents 5 µm.

Article Snippet: An eGFP-linked dominant-negative construct encoding the N-terminal ERM domain (aa1–370) of PYK2 was amplified from the human PYK2 transcript variant 1 cDNA (Origene, Rockville, MD) using the following primers: (forward; CCCAAGCTTATGTCTGGGGTGTCCGAGCCC); (reverse; CCCAAGCTTGCTGTTCCGCTTCTCACCATCTT) which contained a Hind III site used to ligate the product into the N-terminal cloning site of pEGFP-N1 (Clontech, Mountain View, CA).

Techniques: Binding Assay, Incubation, Labeling, Activity Assay, Inhibition, Solvent, Control, Dominant Negative Mutation, Construct, Knock-Out

Journal: Developmental biology

Article Title: Sperm-Oocyte Contact Induces Outside-In Signaling via PYK2 Activation

doi: 10.1016/j.ydbio.2017.05.016

Figure Lengend Snippet: PYK2 is required for enhanced actin polymerization at a subset of sperm-oocyte binding sites. Zona-free oocytes collected from WT and PYK2 −/− females were incubated with capacitated sperm for 45 minutes as described in “Materials and Methods” then fixed and labeled with alexa 568-phalloidin to detect f-actin (red) and DRAQ5 to detect sperm DNA (blue). The distribution of bound sperm and f-actin in the oocyte cortex was recorded by Z-stack confocal imaging and quantified by linescan analysis as described in “Materials and Methods”. Panel A demonstrates the distribution of sperm heads (labeled S31, 33, 34, 35 and 36) detected by DRAQ5 fluorescence in the blue channel (Y axis, upper trace) around the perimeter of a representative optical section through a WT oocyte. The corresponding alexa 568-phalloidin fluorescence is expressed in the red channel (Y axis, lower trace). Instances where sperm binding sites are associated with increased alexa 568-fluorescence are indicated by arrows. “actin cap” represents the thickening of the cortical actin layer that normally occurs over the MII spindle. Panel B demonstrated the relative integrated alexa 568-phalloidin fluorescence (Y axis) calculated for each sperm binding site (n=123) from 7 WT oocytes and (n=134) from 7 pyk2−/− oocytes. “0” representing no change relative to the adjacent cortex and positive values representing an increase in fluorescence intensity relative to the adjacent cortex. Panels C and D display the number of sperm binding sites associated with given levels of relative integrated alexa 568-phalloidin fluorescence (X axis).

Article Snippet: An eGFP-linked dominant-negative construct encoding the N-terminal ERM domain (aa1–370) of PYK2 was amplified from the human PYK2 transcript variant 1 cDNA (Origene, Rockville, MD) using the following primers: (forward; CCCAAGCTTATGTCTGGGGTGTCCGAGCCC); (reverse; CCCAAGCTTGCTGTTCCGCTTCTCACCATCTT) which contained a Hind III site used to ligate the product into the N-terminal cloning site of pEGFP-N1 (Clontech, Mountain View, CA).

Techniques: Binding Assay, Incubation, Labeling, Imaging, Fluorescence

Journal: Developmental biology

Article Title: Sperm-Oocyte Contact Induces Outside-In Signaling via PYK2 Activation

doi: 10.1016/j.ydbio.2017.05.016

Figure Lengend Snippet: F-actin accumulation at sperm binding sites on WT and pyk2 −/− oocytes

Article Snippet: An eGFP-linked dominant-negative construct encoding the N-terminal ERM domain (aa1–370) of PYK2 was amplified from the human PYK2 transcript variant 1 cDNA (Origene, Rockville, MD) using the following primers: (forward; CCCAAGCTTATGTCTGGGGTGTCCGAGCCC); (reverse; CCCAAGCTTGCTGTTCCGCTTCTCACCATCTT) which contained a Hind III site used to ligate the product into the N-terminal cloning site of pEGFP-N1 (Clontech, Mountain View, CA).

Techniques: Binding Assay, Fluorescence

Journal: Cell metabolism

Article Title: TLR8-mediated metabolic control of human Treg function: a mechanistic target for cancer immunotherapy

doi: 10.1016/j.cmet.2018.09.020

Figure Lengend Snippet: (A) Gene expression levels of glucose transporters (Glut1 and Glut3) and the key enzymes in glycolysis (HK2, GPI, PFK1, TPI, ENO1, PKM2 and LDHα) in different T cell subsets. Th1, Th2 and Th17 cells were polarized from naïve T cells purified from healthy donors in the presence of related polarization cytokine conditions. nTreg cells were directly purified from PBMCs of healthy donors. Total RNA was isolated from each cell type and analyzed by real-time PCR. Expression levels of each gene were normalized to β-actin expression level and adjusted to the levels in naïve CD4+ T cells (served as 1). Data shown are mean ± SD from four independent donors. (B) Gene expression levels of key enzymes in cholesterol synthesis (HMGCR, HMGCS1, SQLE, and IDI1), as well as fatty acid oxidation (CPT-1) and synthesis (ACC1 and FASN) in different T cell subsets. Cell preparations and assays were identical to (A). (C) and (D) Tumor-derived CD4+ Treg and γδ Treg cells had higher gene expression levels of glucose transporters and the key enzymes in glycolysis (in C) and lipid metabolism (in D) than those of naïve CD4+ and Th1 cells. Tumor-derived Treg cells: CD4 TregE1 is a melanoma-specific Treg cells and γδ Treg31 & 76 cells are derived from TILs of breast cancer patients. Relative mRNA expression level of each gene was determined by real-time PCR, normalized to β-actin expression and then adjusted to the level in naïve CD4+ T cells. (E) nTreg cells produced higher amounts of the key metabolites involved in the glycolysis and tricarboxylic acid cycle than other T cell subsets. Th1, Th2, Th17 and nTreg cells were prepared as (A). The cell lysates from different T cell subsets were extracted and analyzed using a LCtriple quadruple mass spectrometry for determination of cellular glucose metabolites. Metabolite levels are normalized to naïve CD4 cell group. Relative levels of intermediate metabolites in the glycolysis and TCA-cycle pathways are shown as mean ± SD from representative of three independent T cell subsets with similar results. (F) and (G) Inhibition of glycolysis and lipid metabolism dramatically blocked Treg cell suppressive capacity on T cell proliferation (in F) and prevented Treg-induced responder T cell senescence (in G). nTreg cells were pretreated with pharmacological glucose transporter, glycolysis and lipid metabolism inhibitors for 48 hours, including phloretin (2 μM), 2-DG (1 mM), LND (125 μM), and 3BrPA (30 μM), etomoxir (100 μM), C75 (5 μM), orlistat (10 μM), 25-HC (0.25 μg/ml), simvastatin (2 μM), respectively. Naïve CD4+ T cells were then co-cultured with inhibitor-pretreated or untreated Treg cells for 3 days. Proliferation of co-cultured naïve T cells stimulated by anti-CD3 antibody was determined by [3H]-thymidine incorporation assays, and SA-β-Gal expression in treated T cells was also determined. Data shown are mean ± SD from representative of three independent experiments with similar results.* p<0.05 and ** p<0.01, compared with the medium only group.

Article Snippet: Anti-human CD3 (Clone OKT-3) , Bio X Cell , Cat# BE0001–2; RRID:AB_1107632.

Techniques: Gene Expression, Purification, Isolation, Real-time Polymerase Chain Reaction, Expressing, Derivative Assay, Produced, Mass Spectrometry, Inhibition, Cell Culture

Journal: Cell metabolism

Article Title: TLR8-mediated metabolic control of human Treg function: a mechanistic target for cancer immunotherapy

doi: 10.1016/j.cmet.2018.09.020

Figure Lengend Snippet: (A) Gene expression levels of glucose transporters and the key enzymes in glycolysis in different T cell subsets after stimulation with anti-CD3 antibody. Cell subset preparations and assays were identical to Figure 1. Total RNA was isolated from each cell type and analyzed by real-time PCR. Expression levels of each gene were normalized to β-actin expression levels and adjusted to the levels in naïve CD4 cells (served as 1). Data shown are mean ± SD from four independent healthy donors. (B) Comparisons of gene expression levels of key enzymes involved in glucose metabolism in different T cell subsets before and after anti-CD3 stimulations. Anti-CD3 activated Treg cells displayed strong desire for glucose metabolism compared with effector T cells. T cells were stimulated with or without anti-CD3 for 8 hours and total RNA was isolated from each cell type and analyzed by real-time PCR. Expression levels of each gene were normalized to β-actin expression levels and adjusted to the levels in naïve CD4+ T cells (served as 1). Data shown are mean ± SD from four independent healthy donors. *p<0.05 and **p<0.01, compared with the Treg results before anti-CD3 activation. #p<0.01, compared with the other T cell subsets with anti-CD3 activation. (C) Treg cells had higher glucose uptake than other T cell subsets no matter activation status. Cell subset preparations were identical to Figure 1. T cell subsets were stimulated with/without anti-CD3 antibody for 24 hours, and glucose uptake was determined by the flow cytometry after addition of 2-NBDG for 15 min. Results shown are a representative from three independent experiments. (D) Treg cells produced more L-lactate than other T cell subsets. Cell subset preparations and stimulations were identical to Figure 1. The L-lactate levels in the culture supernatants were determined by the Glycolysis cell-based assay kit. Results shown are mean ± SD from the summary of three independent experiments. **p<0.01, compared with the levels in naïve CD4 T cells. #p<0.01, compared with the other T cell subsets. (E) Activated tumor-derived CD4 Treg and γδ Treg cells also have high gene expression levels of glucose transporters and the key enzymes in glycolysis compared with those of activated Th1 cells. Cell preparations and assays are identical to (B). Data shown are mean ± SD from three independent experiments with similar results.

Article Snippet: Anti-human CD3 (Clone OKT-3) , Bio X Cell , Cat# BE0001–2; RRID:AB_1107632.

Techniques: Gene Expression, Isolation, Real-time Polymerase Chain Reaction, Expressing, Activation Assay, Flow Cytometry, Produced, Cell Based Assay, Derivative Assay

Journal: Cell metabolism

Article Title: TLR8-mediated metabolic control of human Treg function: a mechanistic target for cancer immunotherapy

doi: 10.1016/j.cmet.2018.09.020

Figure Lengend Snippet: (A) Significantly increased SA-β-Gal+ T cell populations were induced in anti-CD3-activated naïve CD4+ and CD8+ T cells cultured in the medium with different concentrations of glucose for 3 days. Data shown are mean ± SD of T cells from three individual healthy donors. Normal medium with 11 mM glucose served as a control. (B) Addition of high concentration of glucose markedly rescued responder T cell senescence induced by nTreg cells and tumor-derived Treg cells. Anti-CD3 activated CD4+ T cells were co-cultured with Treg cells for 3 days with different concentrations of glucose. SA-β-Gal expression in responder CD4+ T cells was determined. Data shown are mean ± SD from three independent experiments. **p<0.01, compared with the naïve CD4 only group. #p<0.01, compared with the Tregtreated with normal concentration of glucose (11mM) group. (C) and (D) TLR8 ligand Poly-G3 treatment significantly reversed Treg suppressive capacity on T cell proliferation (in C) and prevented Treg-induced responder T cell senescence (in D). Different types of Treg cells were co-cultured with naïve CD4+ T cells in the presence or absence of Poly-G3 (3 μg/ml) or Poly-T3 (control) for 3 days. Proliferation of cocultured naïve T cells stimulated by anti-CD3 antibody was determined by [3H]-thymidine incorporation assays (in C), and SA-β-Gal expression in treated naïve T cells was determined (in D). Data shown are mean ± SD from representative of three independent experiments with similar results. **p<0.01, compared with the respective medium only and Poly-T3 treatment groups. (E) Alterations of genes involved in glucose metabolism were identified and ranked in nTreg cells after treatment with Poly-G3 at 24 hours. Gene alterations were normalized to log2 expression level. Human nTreg cells were isolated from PBMCs of two healthy donors and treated with Poly-G3 for different time points. Total RNA was purified and pooled, and transcriptome analyses of Treg cells were performed using the Illumina wholegenome Human HT-12 BeadChips. (F) Poly-G3 treatment increased glucose levels in the culture medium of both nTreg and tumor-derived Treg cells. Different types of Treg cells and naïve CD4+ T cells were cultured in the presence or absence of Poly-G3 or Poly-T3 (Control) for 3 days, and glucose levels in the culture medium were determined. **p<0.01, compared with the None and Poly-T3 treatment groups. (G) and (H) Poly-G3 treatment significantly decreased glucose uptake by nTreg and tumorderived Treg cells. Glucose uptake was determined by the flow cytometry with addition of 2-NBDG for 15 min after 3 day culture. Results shown in histogram (H) are mean ± SD from four independent experiments. *p<0.05 and **p<0.01, compared with the respective medium only and control Poly-T3 treatment groups.

Article Snippet: Anti-human CD3 (Clone OKT-3) , Bio X Cell , Cat# BE0001–2; RRID:AB_1107632.

Techniques: Cell Culture, Control, Concentration Assay, Derivative Assay, Expressing, Isolation, Purification, Flow Cytometry

Journal: Cell metabolism

Article Title: TLR8-mediated metabolic control of human Treg function: a mechanistic target for cancer immunotherapy

doi: 10.1016/j.cmet.2018.09.020

Figure Lengend Snippet: (A) and (B) Poly-G3 treatment down-regulated gene (in A) and protein (in B) expressions of Glut1 and Glut3 in human Treg cells. Treg and control CD4+CD25− effector cells were treated with Poly-G3 (3 μg/ml) for 48 hours. Total RNA was isolated from the T cells and analyzed by real-time PCR. The expression levels of each gene were normalized to β-actin expression levels and adjusted to the levels in untreated T cells (in A). Treated nTreg cells were also determined for Glut1 and Glut3 protein expression using the flow cytometry analysis (in B). Data shown in histograms are representative of average of three independent experiments ± SD. *p<0.05 and **p<0.01, compared with the medium only group. (C) Decreased Glut1 and Glut3 protein expression was induced by Poly-G3 treatment in nTreg cells but not in control CD4+ T cells after 3-day culture. Glut1 and Glut3 (green) expression was determined by an indirect immunofluorescence assay with a confocal microscopy. Scale bar, 50 μm. Results shown in the right histograms are mean ± SD of fluorescence intensity (MFI) quantifications of glucose transporters from three independent experiments. *p<0.05 and **p<0.01, compared with the medium only group. (D) Poly-G3 treatment down-regulated Glut1 and Glut3 membrane expression and promoted its intracellular translocation in nTreg cells. Cell treatment and procedure were identical to (C). Percentages of glucose transporter expression in cell membrane or intracellular were counted and shown in the right histograms. Scale bar, 25 μm. Results are mean ± SD of positive cells from three independent experiments. **p<0.01, compared with the medium only group. (E) and (F) Inhibition of glucose transport significantly promoted the Poly-G3-mediated reversal of Treg suppression on responder T cell proliferation (in E) and induction of cell senescence (in F). nTreg cells were pretreated with or without glucose transporter inhibitor phloretin (2 μM) for 2 days, and then co-cultured with naive CD4+ T cells in the presence or absence of Poly-G3 (3 μg/ml) for 3 days. Proliferation of co-cultured naïve T cells stimulated with anti-CD3 antibody was determined by [3H]-thymidine incorporation assays (in E), and SA-β-Gal expression in treated T cells was determined (in F). Data shown are mean ± SD from three independent experiments with similar results. **p<0.01 between the comparison groups.

Article Snippet: Anti-human CD3 (Clone OKT-3) , Bio X Cell , Cat# BE0001–2; RRID:AB_1107632.

Techniques: Control, Isolation, Real-time Polymerase Chain Reaction, Expressing, Flow Cytometry, Immunofluorescence, Confocal Microscopy, Fluorescence, Membrane, Translocation Assay, Inhibition, Cell Culture, Comparison

Journal: Cell metabolism

Article Title: TLR8-mediated metabolic control of human Treg function: a mechanistic target for cancer immunotherapy

doi: 10.1016/j.cmet.2018.09.020

Figure Lengend Snippet: (A) Poly-G3 treatment significantly down-regulated gene expression levels of key glycolytic enzymes in both nTreg and tumor-derived Treg cells. Different types of human Treg cells and control effector CD4+ T cells were treated with or without Poly-G3 or Poly-T3 for 48 hours. Total RNA was isolated from the T cells and analyzed by real-time PCR. The expression levels of each gene were normalized to β-actin expression levels and adjusted to the levels in untreated T cells (medium). Data shown in nTreg and control CD4+ T cells are mean ± SD from four independent donors. Data for CD4 TregE1 and γδ Treg31 are averages of three independent experiments. *p<0.05 and **p<0.01, compared with the medium only group. (B) and (C) Blockage of glycolysis in nTreg cells using specific pharmacological inhibitors dramatically enhanced the effects of Poly-G3-mediated reversal of Treg suppression on responder T cell proliferation (in B) and induction of cell senescence (in C). nTreg cells were pretreated with glycolysis inhibitors, including 2-DG (1 mM), LND (125 μM), and 3-BrPA (30 μM), respectively for 48 hours. Naïve CD4+ T cells were then co-cultured with inhibitor-pretreated or untreated Treg cells for 3 days in the presence or absence of Poly-G3. Proliferation of co-cultured naïve T cells stimulated with anti-CD3 antibody was determined by [3H]-thymidine incorporation assays (in B), and SA-β-Gal expression in treated T cells was determined (in C). Data shown are mean ± SD from representative of three independent experiments with similar results. **p<0.01 and #p<0.01, compared with the respective medium only group. (D) TLR8 signaling activation decreased the key metabolites involved in glycolysis and TCA in nTreg cells. nTreg cells were cultured in T cell medium in the presence of Poly-G3 or Poly-T3 for 72 hours. Glucose metabolites from the nTreg cell lysates were analyzed using a LC-triple quadruple mass spectrometry, and metabolite levels are normalized to medium group. Relative levels of intermediate metabolites in the glycolysis and TCA-cycle pathways are shown. Data shown are mean ± SD from representative of three independent nTreg cells with similar results. *p<0.05 and **p<0.01, compared with the medium only group.

Article Snippet: Anti-human CD3 (Clone OKT-3) , Bio X Cell , Cat# BE0001–2; RRID:AB_1107632.

Techniques: Gene Expression, Derivative Assay, Control, Isolation, Real-time Polymerase Chain Reaction, Expressing, Cell Culture, Activation Assay, Mass Spectrometry

Journal: Cell metabolism

Article Title: TLR8-mediated metabolic control of human Treg function: a mechanistic target for cancer immunotherapy

doi: 10.1016/j.cmet.2018.09.020

Figure Lengend Snippet: (A) Significant alterations in 24 genes involved in the mTOR signaling pathway were identified and ranked in nTreg cells after treatment with or without TLR8 ligand Poly-G3 at 24 hours. Gene alterations were normalized to log2 expression level. Human nTreg cells were isolated from PBMCs of two healthy donors and treated with Poly-G3 for different time points. Total RNA was purified and transcriptome analyses of Treg cells were performed using the Illumina whole-genome Human HT-12 BeadChips. (B) Suppression of phosphorylation and subsequent activation of mTOR signaling in Treg cells treated with Poly-G3. Treg cells were treated with or without Poly-G3 (3 μg/ml) for 30 minutes and then phosphorylated mTOR, p70S6K, and 4E-BP1 in Treg cells were determined by the flow cytometry. Protein levels shown in the right histograms are summarized as the mean ± SD from three independent experiments. **p<0.01 compared with the medium only group. (C) Blockage of p38 signaling prevented TLR8-mediated inhibition of mTOR signaling. nTreg cells were treated with p38 inhibitor SB203580 (10 μM) in the presence or absence of Poly-G3 (3 μg/ml) for 30 minutes and then phosphorylated mTOR and p70S6K in Treg cells were determined by the flow cytometry. Results shown in the right histogram are summarized as the mean ± SD from three independent experiments. **p<0.01 compared with the other treatment groups. (D) and (E) Blockage of mTOR signaling with mTOR inhibitor rapamycin partially reversed Treg suppression and promoted the Poly-G3-mediated reversal of Treg suppressive activities on responder T cell proliferation (in D) and induction of cell senescence (in E). nTreg cells were pretreated with or without rapamycin (300 nM) for 1 day, and then co-cultured with naive CD4+ T cells in the presence or absence of Poly-G3 (3 μg/ml) for 3 days. Proliferation of co-cultured naïve T cells stimulated by anti-CD3 antibody was determined by [3H]-thymidine incorporation assays (in D), and SAβ-Gal expression in treated T cells was determined (in E). Data shown are mean ± SD from representative of three independent experiments. **p<0.01 between the comparison groups. (F) and (G) Activation of mTOR signaling with Retro-RHEB transfection promoted Treg suppression and prevented the Poly-G3-mediated reversal of Treg suppressive activities on responder T cell proliferation (in F) and induction of cell senescence (in G). Activated nTreg cells were infected with retrovirus carrying RHEB gene or control vector for 48 hours. Infected Treg cells were then co-cultured with naive CD4+ T cells in the presence or absence of Poly-G3 (3 μg/ml) for 3 days. Proliferation and SA-β-Gal expression of cocultured naïve T cells were determined as above. Data shown are mean ± SD from three independent experiments with similar results. *p<0.05 and **p<0.01 between the comparison groups. (H) Relative expression levels of HIF1α in different T cell subsets before and after anti-CD3 stimulations. TCR-activated Treg cells showed significantly elevated HIF1α expression compared with that of effector T cells. T cells were stimulated with or without anti-CD3 for 8 hours and total RNA was isolated from each cell type and analyzed by real-time PCR. Expression level of HIF1α was normalized to β-actin expression and adjusted to the level in naïve CD4+ T cells (served as 1). Data shown are mean ± SD from four independent healthy donors. (I) Activated tumor-derived CD4+ Treg and γδ Treg cells also had higher HIF1α gene expression than activated Th1 cells. Cell treatment and assays were the same as in (H). Data shown are mean ± SD from three independent experiments with similar results. (J) and (K) Poly-G3 treatment down-regulated HIF1α mRNA expression in human Treg cells. nTreg and tumorderived Treg cells, and control CD4+ T cells were treated with Poly-G3 (3 μg/ml) or Poly-T3 for 48 hours. Total RNA was isolated from the T cells and analyzed by real-time PCR. The gene expression levels of HIF1α were normalized to β-actin expression levels and adjusted to the levels in untreated T cells. Data shown in histograms are representative of mean ± SD from three independent experiments. *p<0.05 and **p<0.01, compared with the medium only group. (L) and (M) Inhibition of HIF1α signaling alleviated Treg suppression and significantly promoted the Poly-G3-mediated reversal of Treg suppressive activities on responder T cell proliferation (in L) and induction of cell senescence (in M). nTreg cells were pretreated with or without HIF1α inhibitors YC-1 (5 μM) or 2-ME (10 μM) for 1 day, and then co-cultured with naive CD4+ T cells in the presence or absence of Poly-G3 (3 μg/ml) for 3 days. Proliferation and SA-β-Gal expression of co-cultured naïve T cells were determined as above. Data shown are mean ± SD from three independent experiments with similar results. *p<0.05 and #p<0.01, compared with the respective medium only group. (N) and (O) Activation of HIF1α signaling in nTreg cells dramatically augmented Treg suppression and blocked the effects of Poly-G3-mediated reversal of Treg suppression on responder T cell proliferation (in N) and induction of cell senescence (in O). nTreg cells were pretreated with or without HIF1α activator DMOG (0.1mM) for 1 day and then co-cultured with naive CD4+ T cells in the presence or absence of Poly-G3 (3 μg/ml) for 3 days. Proliferation and SA-β-Gal expression of cocultured naïve T cells were determined. Data shown are mean ± SD from representative of three independent experiments with similar results. *p<0.05 and **p<0.01, between the comparison groups.

Article Snippet: Anti-human CD3 (Clone OKT-3) , Bio X Cell , Cat# BE0001–2; RRID:AB_1107632.

Techniques: Expressing, Isolation, Purification, Phospho-proteomics, Activation Assay, Flow Cytometry, Inhibition, Cell Culture, Comparison, Transfection, Infection, Control, Plasmid Preparation, Real-time Polymerase Chain Reaction, Derivative Assay, Gene Expression

Journal: Cell metabolism

Article Title: TLR8-mediated metabolic control of human Treg function: a mechanistic target for cancer immunotherapy

doi: 10.1016/j.cmet.2018.09.020

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Anti-human CD3 (Clone OKT-3) , Bio X Cell , Cat# BE0001–2; RRID:AB_1107632.

Techniques: Derivative Assay, Recombinant, Reverse Transcription, Selection, Cell Based Assay, Software