cebpd Search Results


gene exp cebpd hs00270931 s1  (Thermo Fisher)
94
Thermo Fisher gene exp cebpd hs00270931 s1
Gene Exp Cebpd Hs00270931 S1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp cebpd hs00270931 s1/product/Thermo Fisher
Average 94 stars, based on 1 article reviews
gene exp cebpd hs00270931 s1 - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier
mus musculus cebpd  (Vector Biolabs)
96
Vector Biolabs mus musculus cebpd
a Schematic of the experimental procedure showing the genes expression in L02 cells <t>after</t> <t>adenovirus-mediated</t> TRIM26 overactivation (Ad TRIM26 ). b – g Volcano plot; average protein expression ratio of 3 replicates (log 2 transformed) between 0.5 mM palmitate+1.0 mM oleic acid (PAOA)-induced AdGFP- or Ad TRIM26 -transfected L02 cells was plotted against p -value by Student’ s t test (−log 10 transformed). Cutoff of P < 0.05 and 1.2-fold change were marked by black dotted lines, respectively. The figure shows the total number of proteins identified as well as the number of up- and downregulated proteins ( b ), principal component analysis (PCA) analysis ( c ), heatmap ( d ), KEGG pathway & wiki-pathway analysis ( e ), Sankey diagram enrichment ( f ) and GO biological process analysis; data was plotted against p -value by Student’ s t test (−log 10 transformed) with cutoff of P < 0.05 and 1.2-fold change ( g ) in AdGFP-transfected or Ad TRIM26 -transfected L02 cells with PAOA co-treatment showing that TRIM26 affects lipid metabolism and inflammatory responses. h Circle diagram analysed by GeneMANIA further showing <t>TRIM26-CEBPD</t> protein interaction network in Homo sapiens and Mus musculus .
Mus Musculus Cebpd, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mus musculus cebpd/product/Vector Biolabs
Average 96 stars, based on 1 article reviews
mus musculus cebpd - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier
c ebpδ  (Rockland Immunochemicals)
91
Rockland Immunochemicals c ebpδ
a Schematic of the experimental procedure showing the genes expression in L02 cells <t>after</t> <t>adenovirus-mediated</t> TRIM26 overactivation (Ad TRIM26 ). b – g Volcano plot; average protein expression ratio of 3 replicates (log 2 transformed) between 0.5 mM palmitate+1.0 mM oleic acid (PAOA)-induced AdGFP- or Ad TRIM26 -transfected L02 cells was plotted against p -value by Student’ s t test (−log 10 transformed). Cutoff of P < 0.05 and 1.2-fold change were marked by black dotted lines, respectively. The figure shows the total number of proteins identified as well as the number of up- and downregulated proteins ( b ), principal component analysis (PCA) analysis ( c ), heatmap ( d ), KEGG pathway & wiki-pathway analysis ( e ), Sankey diagram enrichment ( f ) and GO biological process analysis; data was plotted against p -value by Student’ s t test (−log 10 transformed) with cutoff of P < 0.05 and 1.2-fold change ( g ) in AdGFP-transfected or Ad TRIM26 -transfected L02 cells with PAOA co-treatment showing that TRIM26 affects lipid metabolism and inflammatory responses. h Circle diagram analysed by GeneMANIA further showing <t>TRIM26-CEBPD</t> protein interaction network in Homo sapiens and Mus musculus .
C Ebpδ, supplied by Rockland Immunochemicals, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c ebpδ/product/Rockland Immunochemicals
Average 91 stars, based on 1 article reviews
c ebpδ - by Bioz Stars, 2026-05
91/100 stars
  Buy from Supplier
anti human cebpd  (Biorbyt)
91
Biorbyt anti human cebpd
a Schematic of the experimental procedure showing the genes expression in L02 cells <t>after</t> <t>adenovirus-mediated</t> TRIM26 overactivation (Ad TRIM26 ). b – g Volcano plot; average protein expression ratio of 3 replicates (log 2 transformed) between 0.5 mM palmitate+1.0 mM oleic acid (PAOA)-induced AdGFP- or Ad TRIM26 -transfected L02 cells was plotted against p -value by Student’ s t test (−log 10 transformed). Cutoff of P < 0.05 and 1.2-fold change were marked by black dotted lines, respectively. The figure shows the total number of proteins identified as well as the number of up- and downregulated proteins ( b ), principal component analysis (PCA) analysis ( c ), heatmap ( d ), KEGG pathway & wiki-pathway analysis ( e ), Sankey diagram enrichment ( f ) and GO biological process analysis; data was plotted against p -value by Student’ s t test (−log 10 transformed) with cutoff of P < 0.05 and 1.2-fold change ( g ) in AdGFP-transfected or Ad TRIM26 -transfected L02 cells with PAOA co-treatment showing that TRIM26 affects lipid metabolism and inflammatory responses. h Circle diagram analysed by GeneMANIA further showing <t>TRIM26-CEBPD</t> protein interaction network in Homo sapiens and Mus musculus .
Anti Human Cebpd, supplied by Biorbyt, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti human cebpd/product/Biorbyt
Average 91 stars, based on 1 article reviews
anti human cebpd - by Bioz Stars, 2026-05
91/100 stars
  Buy from Supplier
gene exp cebpd hs00997180 s1  (Thermo Fisher)
85
Thermo Fisher gene exp cebpd hs00997180 s1
a Schematic of the experimental procedure showing the genes expression in L02 cells <t>after</t> <t>adenovirus-mediated</t> TRIM26 overactivation (Ad TRIM26 ). b – g Volcano plot; average protein expression ratio of 3 replicates (log 2 transformed) between 0.5 mM palmitate+1.0 mM oleic acid (PAOA)-induced AdGFP- or Ad TRIM26 -transfected L02 cells was plotted against p -value by Student’ s t test (−log 10 transformed). Cutoff of P < 0.05 and 1.2-fold change were marked by black dotted lines, respectively. The figure shows the total number of proteins identified as well as the number of up- and downregulated proteins ( b ), principal component analysis (PCA) analysis ( c ), heatmap ( d ), KEGG pathway & wiki-pathway analysis ( e ), Sankey diagram enrichment ( f ) and GO biological process analysis; data was plotted against p -value by Student’ s t test (−log 10 transformed) with cutoff of P < 0.05 and 1.2-fold change ( g ) in AdGFP-transfected or Ad TRIM26 -transfected L02 cells with PAOA co-treatment showing that TRIM26 affects lipid metabolism and inflammatory responses. h Circle diagram analysed by GeneMANIA further showing <t>TRIM26-CEBPD</t> protein interaction network in Homo sapiens and Mus musculus .
Gene Exp Cebpd Hs00997180 S1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp cebpd hs00997180 s1/product/Thermo Fisher
Average 85 stars, based on 1 article reviews
gene exp cebpd hs00997180 s1 - by Bioz Stars, 2026-05
85/100 stars
  Buy from Supplier
anti cebpd  (ProSci Incorporated)
90
ProSci Incorporated anti cebpd
a Schematic of the experimental procedure showing the genes expression in L02 cells <t>after</t> <t>adenovirus-mediated</t> TRIM26 overactivation (Ad TRIM26 ). b – g Volcano plot; average protein expression ratio of 3 replicates (log 2 transformed) between 0.5 mM palmitate+1.0 mM oleic acid (PAOA)-induced AdGFP- or Ad TRIM26 -transfected L02 cells was plotted against p -value by Student’ s t test (−log 10 transformed). Cutoff of P < 0.05 and 1.2-fold change were marked by black dotted lines, respectively. The figure shows the total number of proteins identified as well as the number of up- and downregulated proteins ( b ), principal component analysis (PCA) analysis ( c ), heatmap ( d ), KEGG pathway & wiki-pathway analysis ( e ), Sankey diagram enrichment ( f ) and GO biological process analysis; data was plotted against p -value by Student’ s t test (−log 10 transformed) with cutoff of P < 0.05 and 1.2-fold change ( g ) in AdGFP-transfected or Ad TRIM26 -transfected L02 cells with PAOA co-treatment showing that TRIM26 affects lipid metabolism and inflammatory responses. h Circle diagram analysed by GeneMANIA further showing <t>TRIM26-CEBPD</t> protein interaction network in Homo sapiens and Mus musculus .
Anti Cebpd, supplied by ProSci Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti cebpd/product/ProSci Incorporated
Average 90 stars, based on 1 article reviews
anti cebpd - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier
human sirna oligo duplexes  (OriGene)
90
OriGene human sirna oligo duplexes
a Schematic of the experimental procedure showing the genes expression in L02 cells <t>after</t> <t>adenovirus-mediated</t> TRIM26 overactivation (Ad TRIM26 ). b – g Volcano plot; average protein expression ratio of 3 replicates (log 2 transformed) between 0.5 mM palmitate+1.0 mM oleic acid (PAOA)-induced AdGFP- or Ad TRIM26 -transfected L02 cells was plotted against p -value by Student’ s t test (−log 10 transformed). Cutoff of P < 0.05 and 1.2-fold change were marked by black dotted lines, respectively. The figure shows the total number of proteins identified as well as the number of up- and downregulated proteins ( b ), principal component analysis (PCA) analysis ( c ), heatmap ( d ), KEGG pathway & wiki-pathway analysis ( e ), Sankey diagram enrichment ( f ) and GO biological process analysis; data was plotted against p -value by Student’ s t test (−log 10 transformed) with cutoff of P < 0.05 and 1.2-fold change ( g ) in AdGFP-transfected or Ad TRIM26 -transfected L02 cells with PAOA co-treatment showing that TRIM26 affects lipid metabolism and inflammatory responses. h Circle diagram analysed by GeneMANIA further showing <t>TRIM26-CEBPD</t> protein interaction network in Homo sapiens and Mus musculus .
Human Sirna Oligo Duplexes, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human sirna oligo duplexes/product/OriGene
Average 90 stars, based on 1 article reviews
human sirna oligo duplexes - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier
anti cebpd  (OriGene)
91
OriGene anti cebpd
a Schematic of the experimental procedure showing the genes expression in L02 cells <t>after</t> <t>adenovirus-mediated</t> TRIM26 overactivation (Ad TRIM26 ). b – g Volcano plot; average protein expression ratio of 3 replicates (log 2 transformed) between 0.5 mM palmitate+1.0 mM oleic acid (PAOA)-induced AdGFP- or Ad TRIM26 -transfected L02 cells was plotted against p -value by Student’ s t test (−log 10 transformed). Cutoff of P < 0.05 and 1.2-fold change were marked by black dotted lines, respectively. The figure shows the total number of proteins identified as well as the number of up- and downregulated proteins ( b ), principal component analysis (PCA) analysis ( c ), heatmap ( d ), KEGG pathway & wiki-pathway analysis ( e ), Sankey diagram enrichment ( f ) and GO biological process analysis; data was plotted against p -value by Student’ s t test (−log 10 transformed) with cutoff of P < 0.05 and 1.2-fold change ( g ) in AdGFP-transfected or Ad TRIM26 -transfected L02 cells with PAOA co-treatment showing that TRIM26 affects lipid metabolism and inflammatory responses. h Circle diagram analysed by GeneMANIA further showing <t>TRIM26-CEBPD</t> protein interaction network in Homo sapiens and Mus musculus .
Anti Cebpd, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti cebpd/product/OriGene
Average 91 stars, based on 1 article reviews
anti cebpd - by Bioz Stars, 2026-05
91/100 stars
  Buy from Supplier
human c ebpd expression vector  (OriGene)
90
OriGene human c ebpd expression vector
a Schematic of the experimental procedure showing the genes expression in L02 cells <t>after</t> <t>adenovirus-mediated</t> TRIM26 overactivation (Ad TRIM26 ). b – g Volcano plot; average protein expression ratio of 3 replicates (log 2 transformed) between 0.5 mM palmitate+1.0 mM oleic acid (PAOA)-induced AdGFP- or Ad TRIM26 -transfected L02 cells was plotted against p -value by Student’ s t test (−log 10 transformed). Cutoff of P < 0.05 and 1.2-fold change were marked by black dotted lines, respectively. The figure shows the total number of proteins identified as well as the number of up- and downregulated proteins ( b ), principal component analysis (PCA) analysis ( c ), heatmap ( d ), KEGG pathway & wiki-pathway analysis ( e ), Sankey diagram enrichment ( f ) and GO biological process analysis; data was plotted against p -value by Student’ s t test (−log 10 transformed) with cutoff of P < 0.05 and 1.2-fold change ( g ) in AdGFP-transfected or Ad TRIM26 -transfected L02 cells with PAOA co-treatment showing that TRIM26 affects lipid metabolism and inflammatory responses. h Circle diagram analysed by GeneMANIA further showing <t>TRIM26-CEBPD</t> protein interaction network in Homo sapiens and Mus musculus .
Human C Ebpd Expression Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human c ebpd expression vector/product/OriGene
Average 90 stars, based on 1 article reviews
human c ebpd expression vector - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier
gene exp cebpd mm00514291 s1  (Thermo Fisher)
85
Thermo Fisher gene exp cebpd mm00514291 s1
Genes regulated in liver, skeletal muscle, heart, fat (retroperitoneal fat), and bone (vertebrae) in 7-month-old female control (n = 6) and LI-IGF-I -/- (n = 7) mice as determined by DNA microarray analyses.
Gene Exp Cebpd Mm00514291 S1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp cebpd mm00514291 s1/product/Thermo Fisher
Average 85 stars, based on 1 article reviews
gene exp cebpd mm00514291 s1 - by Bioz Stars, 2026-05
85/100 stars
  Buy from Supplier
shrna tf500346 cebpd  (OriGene)
90
OriGene shrna tf500346 cebpd
KEY RESOURCES TABLE
Shrna Tf500346 Cebpd, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrna tf500346 cebpd/product/OriGene
Average 90 stars, based on 1 article reviews
shrna tf500346 cebpd - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

Image Search Results


a Schematic of the experimental procedure showing the genes expression in L02 cells after adenovirus-mediated TRIM26 overactivation (Ad TRIM26 ). b – g Volcano plot; average protein expression ratio of 3 replicates (log 2 transformed) between 0.5 mM palmitate+1.0 mM oleic acid (PAOA)-induced AdGFP- or Ad TRIM26 -transfected L02 cells was plotted against p -value by Student’ s t test (−log 10 transformed). Cutoff of P < 0.05 and 1.2-fold change were marked by black dotted lines, respectively. The figure shows the total number of proteins identified as well as the number of up- and downregulated proteins ( b ), principal component analysis (PCA) analysis ( c ), heatmap ( d ), KEGG pathway & wiki-pathway analysis ( e ), Sankey diagram enrichment ( f ) and GO biological process analysis; data was plotted against p -value by Student’ s t test (−log 10 transformed) with cutoff of P < 0.05 and 1.2-fold change ( g ) in AdGFP-transfected or Ad TRIM26 -transfected L02 cells with PAOA co-treatment showing that TRIM26 affects lipid metabolism and inflammatory responses. h Circle diagram analysed by GeneMANIA further showing TRIM26-CEBPD protein interaction network in Homo sapiens and Mus musculus .

Journal: Nature Communications

Article Title: Tripartite motif containing 26 prevents steatohepatitis progression by suppressing C/EBPδ signalling activation

doi: 10.1038/s41467-023-42040-9

Figure Lengend Snippet: a Schematic of the experimental procedure showing the genes expression in L02 cells after adenovirus-mediated TRIM26 overactivation (Ad TRIM26 ). b – g Volcano plot; average protein expression ratio of 3 replicates (log 2 transformed) between 0.5 mM palmitate+1.0 mM oleic acid (PAOA)-induced AdGFP- or Ad TRIM26 -transfected L02 cells was plotted against p -value by Student’ s t test (−log 10 transformed). Cutoff of P < 0.05 and 1.2-fold change were marked by black dotted lines, respectively. The figure shows the total number of proteins identified as well as the number of up- and downregulated proteins ( b ), principal component analysis (PCA) analysis ( c ), heatmap ( d ), KEGG pathway & wiki-pathway analysis ( e ), Sankey diagram enrichment ( f ) and GO biological process analysis; data was plotted against p -value by Student’ s t test (−log 10 transformed) with cutoff of P < 0.05 and 1.2-fold change ( g ) in AdGFP-transfected or Ad TRIM26 -transfected L02 cells with PAOA co-treatment showing that TRIM26 affects lipid metabolism and inflammatory responses. h Circle diagram analysed by GeneMANIA further showing TRIM26-CEBPD protein interaction network in Homo sapiens and Mus musculus .

Article Snippet: Homo sapiens full-length TRIM26 sequences and designed short hairpin RNA (shRNA) targeting human TRIM26 (sh TRIM26 ) (shRNA sequences RNA-1: GATGGATATGACGACTGGGAA; RNA-2: GATGGATATGACGACTGGGAA), adenovirus expressing shRNA for silencing of Mus musculus Trim26 (Cat. No: shADV-274978, Vector Biolabs, Malvern, PA), human WT TRIM26 sequences with AXXA and AXXXXA motifs of RING domain mutation, Homo sapiens full-length CEBPD sequences, and adenovirus expressing shRNA for silencing of Mus musculus Cebpd (Cat. No: shADV-255245, Vector Biolabs, Malvern, PA) were respectively packaged into adenovirus by Adeno-XTM Adenoviral System 3 Kit (Cat: 632269, Takara Bio Inc.).

Techniques: Expressing, Transformation Assay, Transfection

Genes regulated in liver, skeletal muscle, heart, fat (retroperitoneal fat), and bone (vertebrae) in 7-month-old female control (n = 6) and LI-IGF-I -/- (n = 7) mice as determined by DNA microarray analyses.

Journal: PLoS ONE

Article Title: Liver-Derived IGF-I Regulates Mean Life Span in Mice

doi: 10.1371/journal.pone.0022640

Figure Lengend Snippet: Genes regulated in liver, skeletal muscle, heart, fat (retroperitoneal fat), and bone (vertebrae) in 7-month-old female control (n = 6) and LI-IGF-I -/- (n = 7) mice as determined by DNA microarray analyses.

Article Snippet: We used FAM-labeled probes specific for heat shock protein 1A (Mm01159846_s1) and 1B (Mm03038954_s1), connective tissue growth factor (Mm01192931_g1), CCAAT/enhancer protein delta (Mm00514291_s1), and IGF-I receptor (Mm00802831_m1).

Techniques: Control, Microarray

KEY RESOURCES TABLE

Journal: Cell reports

Article Title: Mapping Distinct Bone Marrow Niche Populations and Their Differentiation Paths

doi: 10.1016/j.celrep.2019.06.031

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: shRNA - TF500346 (Cebpd) , Origene , 4 unique shRNA.

Techniques: Recombinant, shRNA, Construct, Plasmid Preparation, Sequencing, Software