cdkn2c Search Results


86
Thermo Fisher snp cdkn2c c 8847082 10
SNPs Analyzed [Note]
Snp Cdkn2c C 8847082 10, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdkn2c/SNP+CDKN2C%2C+C___8847082_10/pmc01224528-150-6--1
Average 86 stars, based on 1 article reviews
snp cdkn2c c 8847082 10 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

94
Genecopoeia orf expression clone for cdkn2c
SNPs Analyzed [Note]
Orf Expression Clone For Cdkn2c, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdkn2c/ORF+expression+clone+for+CDKN2C/custom%40ex-b0138-m35%4026350239
Average 94 stars, based on 1 article reviews
orf expression clone for cdkn2c - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

90
Novus Biologicals cdkn2c
Selected deregulated genes with their respective fold changes
Cdkn2c, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdkn2c/p18INK4c%2FCDKN2C+Antibody+(18P118+(DCS-118))/pmc04102954-61-22-28
Average 90 stars, based on 1 article reviews
cdkn2c - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
OriGene lentivirus vector carrying p18 cdna
Selected deregulated genes with their respective fold changes
Lentivirus Vector Carrying P18 Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdkn2c/p18+INK4c+(CDKN2C)+(NM_078626)+Human+Tagged+ORF+Clone+Lentiviral+Particle/pm40597397-88-1-6
Average 93 stars, based on 1 article reviews
lentivirus vector carrying p18 cdna - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

87
Thermo Fisher gene exp cdkn2c mm00483243 m1
Selected deregulated genes with their respective fold changes
Gene Exp Cdkn2c Mm00483243 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdkn2c/Gene+Exp%2E+Cdkn2c%2C+Mm00483243_m1/pm23183167-70-30--1
Average 87 stars, based on 1 article reviews
gene exp cdkn2c mm00483243 m1 - by Bioz Stars, 2026-09
87/100 stars
  Buy from Supplier

90
Thermo Fisher gene exp cdkn2c hs00176227 m1
Assay Kit Identification Number of Validated Genes.
Gene Exp Cdkn2c Hs00176227 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdkn2c/Gene+Exp%2E+CDKN2C%2C+Hs00176227_m1/pmc10467207-13-2--1
Average 90 stars, based on 1 article reviews
gene exp cdkn2c hs00176227 m1 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
OriGene rc213083
Assay Kit Identification Number of Validated Genes.
Rc213083, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdkn2c/p18+INK4c+(CDKN2C)+(NM_001262)+Human+Tagged+ORF+Clone/10__1158_slash_1535___7163__mct___18___0755-44-13-6
Average 90 stars, based on 1 article reviews
rc213083 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

92
Boster Bio p18
FIGURE 8 The effect of SUZ12 on CKIs, p53, and Rb expression was tested by qRT-PCR and western blotting. sh-SUZ12 decreased p57 mRNA expression (A) and <t>p18/p19/p-p53</t> protein expression (B) and (D), while increased p57/Rb/pRb protein expression (B) and (D), without significantly effected the p53 and Rb mRNA expression (C). *p < 0.05, **p < 0.001.
P18, supplied by Boster Bio, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdkn2c/Anti-CDKN2C+Rabbit+Monoclonal+Antibody/pm39400513-45-60-62
Average 92 stars, based on 1 article reviews
p18 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

90
Shanghai GenePharma cdkn2c overexpression plasmid
miR‐21‐5p was negatively associated with <t>CDKN2C</t> mRNA expression in melanoma tissues. (A) Quantitative real‐time PCR analysis of miR‐21‐5p levels in 20 melanoma tissues and matched adjacent tissues showing that miR‐21‐5p expression was increased in melanoma tissues. (B) Quantitative real‐time PCR analysis of CDKN2C mRNA levels in 20 melanoma tissues and matched adjacent tissues showing that CDKN2C expression was decreased in melanoma tissues. (C) Spearman’s correlation analysis for the association between miR‐21‐5p levels and CDKN2C mRNA levels in melanoma tissues.
Cdkn2c Overexpression Plasmid, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdkn2c/cdkn2c+overexpression+plasmid/pmc07193168-21-1-15
Average 90 stars, based on 1 article reviews
cdkn2c overexpression plasmid - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Oxford Gene Technology dual-color cks1b/cdkn2c probe
miR‐21‐5p was negatively associated with <t>CDKN2C</t> mRNA expression in melanoma tissues. (A) Quantitative real‐time PCR analysis of miR‐21‐5p levels in 20 melanoma tissues and matched adjacent tissues showing that miR‐21‐5p expression was increased in melanoma tissues. (B) Quantitative real‐time PCR analysis of CDKN2C mRNA levels in 20 melanoma tissues and matched adjacent tissues showing that CDKN2C expression was decreased in melanoma tissues. (C) Spearman’s correlation analysis for the association between miR‐21‐5p levels and CDKN2C mRNA levels in melanoma tissues.
Dual Color Cks1b/Cdkn2c Probe, supplied by Oxford Gene Technology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdkn2c/cytocell+dual+color+cks1b+cdkn2c+probe/pm38609496-55-3-6
Average 90 stars, based on 1 article reviews
dual-color cks1b/cdkn2c probe - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
VectorBuilder GmbH lentiviral vectors containing cdkn2c -targeting shrna
a Heatmap of candidate validation. Huh-106 cells were transduced with the indicated ORF and infected with HBV. HBV infection was assessed at 10 dpi by CLIA quantification of secreted HBeAg and HBsAg. Results are expressed as means concentration of secreted HBeAg or HBsAg from 1 experiment ( n = 2). Genes in italic ( KRT80 and CPA1 ) correspond to negative controls, which were not identified as candidates from the primary screen. Mock#1 and Mock#2: uninfected HepG2-NTCP cells. HBV ctrl: non-transduced HBV-infected HepG2-cells. GFP: GFP-transduced HBV-infected HepG2-NTCP cells. b , c Microarray for comparison of gene expression in HepG2-NTCP and Huh-106 cells. Analysis of differentially expressed pathways ( b ) and candidate host factors from the primary screen through Z score transformation ( c ) are presented. d , e <t>CDKN2C</t> is upregulated in HepG2-NTCP compared to Huh-106 cells. d CDKN2C mRNA expression in HepG2-NTCP and Huh-106 cells quantified by qRT-PCR. Results are expressed as means +/− SEM CDKN2C relative expression compared to HepG2-NTCP (set to 1) from 3 independent experiments ( n = 6). e Endogenous <t>CDKN2C</t> <t>protein</t> expression in HepG2-NTCP and Huh-106 cells detected by western blot. One representative experiment is shown. ** p < 0.01 (two-tailed Mann–Whitney U test). Source data are provided as a Source Data file.
Lentiviral Vectors Containing Cdkn2c Targeting Shrna, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdkn2c/lentiviral+vectors+containing+cdkn2c++targeting+shrna/pmc07264273-364-14-30
Average 90 stars, based on 1 article reviews
lentiviral vectors containing cdkn2c -targeting shrna - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

95
Genecopoeia cdkn2c/p18-ink4c rabbit mab
a Heatmap of candidate validation. Huh-106 cells were transduced with the indicated ORF and infected with HBV. HBV infection was assessed at 10 dpi by CLIA quantification of secreted HBeAg and HBsAg. Results are expressed as means concentration of secreted HBeAg or HBsAg from 1 experiment ( n = 2). Genes in italic ( KRT80 and CPA1 ) correspond to negative controls, which were not identified as candidates from the primary screen. Mock#1 and Mock#2: uninfected HepG2-NTCP cells. HBV ctrl: non-transduced HBV-infected HepG2-cells. GFP: GFP-transduced HBV-infected HepG2-NTCP cells. b , c Microarray for comparison of gene expression in HepG2-NTCP and Huh-106 cells. Analysis of differentially expressed pathways ( b ) and candidate host factors from the primary screen through Z score transformation ( c ) are presented. d , e <t>CDKN2C</t> is upregulated in HepG2-NTCP compared to Huh-106 cells. d CDKN2C mRNA expression in HepG2-NTCP and Huh-106 cells quantified by qRT-PCR. Results are expressed as means +/− SEM CDKN2C relative expression compared to HepG2-NTCP (set to 1) from 3 independent experiments ( n = 6). e Endogenous <t>CDKN2C</t> <t>protein</t> expression in HepG2-NTCP and Huh-106 cells detected by western blot. One representative experiment is shown. ** p < 0.01 (two-tailed Mann–Whitney U test). Source data are provided as a Source Data file.
Cdkn2c/P18 Ink4c Rabbit Mab, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdkn2c/CDKN2C%2Fp18-INK4C+Rabbit+mAb/custom%40mab-02182%4026350239
Average 95 stars, based on 1 article reviews
cdkn2c/p18-ink4c rabbit mab - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

Image Search Results


SNPs Analyzed [Note]

Journal:

Article Title: Identification of Risk and Age-at-Onset Genes on Chromosome 1p in Parkinson Disease

doi:

Figure Lengend Snippet: SNPs Analyzed [Note]

Article Snippet: 151 , rs12855 , CDKN2C , C__8847082_10 , 49726604 , 50810011 , 10.0 , .438 , .708.

Techniques:

Selected deregulated genes with their respective fold changes

Journal: British Journal of Cancer

Article Title: Key Roles for MYC , KIT and RET signaling in secondary angiosarcomas

doi: 10.1038/bjc.2014.359

Figure Lengend Snippet: Selected deregulated genes with their respective fold changes

Article Snippet: The antibodies used were KIT (A4502, Dilution 1 : 400, Dako), RET (MA1-26379, Dilution 1 : 25, Thermo Scientific, Waltham, MA, USA), CDKN2C (NB120-3216, Dilution 1 : 25, Novus Biologicals, Cambridge, UK) and KDR (Clone 55B11, Dilution 1 : 100, Cell Signaling, Danvers, MA, USA).

Techniques:

Scatterplots demonstrating the RT–qPCR expression ratios (Y-axis) in primary and secondary angiosarcomas (X-axis) in relation to the pooled reference genes. In secondary angiosarcoma upregulation affects ( A ) MYC and ( B ) RET, whereas downregulation is demonstrated for ( C ) CDKN2C.

Journal: British Journal of Cancer

Article Title: Key Roles for MYC , KIT and RET signaling in secondary angiosarcomas

doi: 10.1038/bjc.2014.359

Figure Lengend Snippet: Scatterplots demonstrating the RT–qPCR expression ratios (Y-axis) in primary and secondary angiosarcomas (X-axis) in relation to the pooled reference genes. In secondary angiosarcoma upregulation affects ( A ) MYC and ( B ) RET, whereas downregulation is demonstrated for ( C ) CDKN2C.

Article Snippet: The antibodies used were KIT (A4502, Dilution 1 : 400, Dako), RET (MA1-26379, Dilution 1 : 25, Thermo Scientific, Waltham, MA, USA), CDKN2C (NB120-3216, Dilution 1 : 25, Novus Biologicals, Cambridge, UK) and KDR (Clone 55B11, Dilution 1 : 100, Cell Signaling, Danvers, MA, USA).

Techniques: Quantitative RT-PCR, Expressing

Assay Kit Identification Number of Validated Genes.

Journal: Dose-Response

Article Title: Exposure to Cadmium Telluride Quantum Dots and Gene Expression Profile of Huh-7 Hepatocellular Carcinoma Cell Line

doi: 10.1177/15593258231185457

Figure Lengend Snippet: Assay Kit Identification Number of Validated Genes.

Article Snippet: CDKN2C , Hs00176227_m1.

Techniques:

FIGURE 8 The effect of SUZ12 on CKIs, p53, and Rb expression was tested by qRT-PCR and western blotting. sh-SUZ12 decreased p57 mRNA expression (A) and p18/p19/p-p53 protein expression (B) and (D), while increased p57/Rb/pRb protein expression (B) and (D), without significantly effected the p53 and Rb mRNA expression (C). *p < 0.05, **p < 0.001.

Journal: Cancer medicine

Article Title: The expression and role of SUZ12 in lung adenocarcinoma.

doi: 10.1002/cam4.70190

Figure Lengend Snippet: FIGURE 8 The effect of SUZ12 on CKIs, p53, and Rb expression was tested by qRT-PCR and western blotting. sh-SUZ12 decreased p57 mRNA expression (A) and p18/p19/p-p53 protein expression (B) and (D), while increased p57/Rb/pRb protein expression (B) and (D), without significantly effected the p53 and Rb mRNA expression (C). *p < 0.05, **p < 0.001.

Article Snippet: The list of primary antibodies: SUZ12 (1 μg/mL, Abcam Cambridge, cat no: ab12073), CDK2 (1:1000; Proteintech, USA, cat. no. 10122- 1- AP), CDK3 (1:2000; Proteintech, USA, cat. no. 55103- 1- AP), CDK6 (1:2000; Proteintech, USA, cat. no. 14052- 1- AP), cyclin D1 (1:5000; Proteintech, USA, cat. no. 26939- 1- AP), cyclin E1 (1:1000; Proteintech, USA, cat. no. 11554- 1- AP), p18 (1:1000, BOSTER China, cat. no. M03299- 1), p19 (1:1000, BOSTER China, cat. no. MA1075), p53 (1:5000; Proteintech, USA, cat. no. 60283- 2- Ig), p- p53 (1:2000; Proteintech, USA, cat. no. 28961- 1- AP), p57 (1:1000, BOSTER China, cat. no. BM4129), Rb (1:1000, BOSTER China, cat. no. BM4500), pRb (1:1000, BOSTER China, cat. no. BM4338), Bcl- 2 (1:1000; Proteintech, USA, cat. no. 26593- 1- AP), Bax (1:2000; Proteintech, USA, cat. no. 50599- 2- lg), Ecadherin (1:5000; Proteintech, USA, cat. no. 20874- 1- AP), N- cadherin (1:3000; Proteintech, USA, cat. no. 22018- 1- AP), vimentin (1:4000; Proteintech, USA, cat. no. 10366- 1- AP), MMP1 (1:1000, BOSTER China, cat. no. A00733- 1), MMP2 (1:500, BOSTER China, cat. no. BM4075), MMP9 (1:1000, BOSTER China, cat. no. PB0709), MMP14 (1:1000, BOSTER China, cat. no. BM4119), TIMP1 (1:1000, Bioss China, cat. no. bs0415R), TIMP2 (1:1000, Bioss China, cat. no. bs- 10395R), TIMP3 (1:1000; Proteintech, USA, cat. no. 10858- 1- AP), ITGB1 (1:1000, BOSTER China, cat. no. BM4308), ITGB3 (1:1000, BOSTER China, cat. no. BA1670), ITGB5 (1:1000, BOSTER China, cat. no. A04201- 1), nm23 (1:1000, BOSTER China, cat. no. BA3787), PD- L1 (1:3000; Proteintech, USA, cat. no. 66248- 1- Ig), and βactin (1:5000; Proteintech, USA, cat. no. 66009- 1- Ig).

Techniques: Expressing, Quantitative RT-PCR, Western Blot

miR‐21‐5p was negatively associated with CDKN2C mRNA expression in melanoma tissues. (A) Quantitative real‐time PCR analysis of miR‐21‐5p levels in 20 melanoma tissues and matched adjacent tissues showing that miR‐21‐5p expression was increased in melanoma tissues. (B) Quantitative real‐time PCR analysis of CDKN2C mRNA levels in 20 melanoma tissues and matched adjacent tissues showing that CDKN2C expression was decreased in melanoma tissues. (C) Spearman’s correlation analysis for the association between miR‐21‐5p levels and CDKN2C mRNA levels in melanoma tissues.

Journal: FEBS Open Bio

Article Title: miR‐21‐5p promotes cell proliferation and G1/S transition in melanoma by targeting CDKN2C

doi: 10.1002/2211-5463.12819

Figure Lengend Snippet: miR‐21‐5p was negatively associated with CDKN2C mRNA expression in melanoma tissues. (A) Quantitative real‐time PCR analysis of miR‐21‐5p levels in 20 melanoma tissues and matched adjacent tissues showing that miR‐21‐5p expression was increased in melanoma tissues. (B) Quantitative real‐time PCR analysis of CDKN2C mRNA levels in 20 melanoma tissues and matched adjacent tissues showing that CDKN2C expression was decreased in melanoma tissues. (C) Spearman’s correlation analysis for the association between miR‐21‐5p levels and CDKN2C mRNA levels in melanoma tissues.

Article Snippet: The CDKN2C overexpression plasmid was constructed by inserting CDKN2C cDNA into a pcDNA3.1 vector by GenePharma Co. Ltd. For transfection, A375 or M14 cells were seeded at a density of 2 × 10 5 cells per well in a six‐well culture dish, and transfection was performed when 80% confluence was achieved.

Techniques: Expressing, Real-time Polymerase Chain Reaction

CDKN2C may be a direct target of miR‐21‐5p. (A) The potential binding sequences of CDKN2C 3ʹ UTR and miR‐21‐5p based on bioinformatics analysis. The WT and mutated binding sequences are shown. (B) Relative luciferase activity in HEK293T cells transfected with reporter vector containing WT CDKN2C binding sequence or mutated binding sequence (MUT CDKN2C), along with miR‐21‐5p mimic and NC. Quantitative real‐time PCR analysis (C) and western blot analysis (D, E) of CDKN2C mRNA and protein in A375 and M14 cells transfected with miR‐21‐5p mimic, inhibitor and NC; each sample was analyzed three times. Data were expressed as mean ± SD. Differences were evaluated using one‐way ANOVA, followed by Dunnett’s test. ** P < 0.01, *** P < 0.001, compared with NC.

Journal: FEBS Open Bio

Article Title: miR‐21‐5p promotes cell proliferation and G1/S transition in melanoma by targeting CDKN2C

doi: 10.1002/2211-5463.12819

Figure Lengend Snippet: CDKN2C may be a direct target of miR‐21‐5p. (A) The potential binding sequences of CDKN2C 3ʹ UTR and miR‐21‐5p based on bioinformatics analysis. The WT and mutated binding sequences are shown. (B) Relative luciferase activity in HEK293T cells transfected with reporter vector containing WT CDKN2C binding sequence or mutated binding sequence (MUT CDKN2C), along with miR‐21‐5p mimic and NC. Quantitative real‐time PCR analysis (C) and western blot analysis (D, E) of CDKN2C mRNA and protein in A375 and M14 cells transfected with miR‐21‐5p mimic, inhibitor and NC; each sample was analyzed three times. Data were expressed as mean ± SD. Differences were evaluated using one‐way ANOVA, followed by Dunnett’s test. ** P < 0.01, *** P < 0.001, compared with NC.

Article Snippet: The CDKN2C overexpression plasmid was constructed by inserting CDKN2C cDNA into a pcDNA3.1 vector by GenePharma Co. Ltd. For transfection, A375 or M14 cells were seeded at a density of 2 × 10 5 cells per well in a six‐well culture dish, and transfection was performed when 80% confluence was achieved.

Techniques: Binding Assay, Luciferase, Activity Assay, Transfection, Plasmid Preparation, Sequencing, Real-time Polymerase Chain Reaction, Western Blot

Addition of CDKN2C could attenuate the effects of miR‐21‐5p overexpression on melanoma cells. A375 cells were transfected with miR‐21‐5p mimic together with empty vector or pcDNA‐CDKN2C. (A) Cell proliferation was measured by the CCK‐8 assay. The CCK‐8 assay was performed every 24 h for 4 days. (B, C) Flow cytometry was performed to detect cell‐cycle distribution. Each sample was analyzed at least three times. Data were expressed as mean ± SD. Differences were evaluated using one‐way ANOVA, followed by Tukey’s test. * P < 0.05, *** P < 0.001, compared with NC + vector; # P < 0.05, ## P < 0.01, ### P < 0.001, compared with mimic + vector.

Journal: FEBS Open Bio

Article Title: miR‐21‐5p promotes cell proliferation and G1/S transition in melanoma by targeting CDKN2C

doi: 10.1002/2211-5463.12819

Figure Lengend Snippet: Addition of CDKN2C could attenuate the effects of miR‐21‐5p overexpression on melanoma cells. A375 cells were transfected with miR‐21‐5p mimic together with empty vector or pcDNA‐CDKN2C. (A) Cell proliferation was measured by the CCK‐8 assay. The CCK‐8 assay was performed every 24 h for 4 days. (B, C) Flow cytometry was performed to detect cell‐cycle distribution. Each sample was analyzed at least three times. Data were expressed as mean ± SD. Differences were evaluated using one‐way ANOVA, followed by Tukey’s test. * P < 0.05, *** P < 0.001, compared with NC + vector; # P < 0.05, ## P < 0.01, ### P < 0.001, compared with mimic + vector.

Article Snippet: The CDKN2C overexpression plasmid was constructed by inserting CDKN2C cDNA into a pcDNA3.1 vector by GenePharma Co. Ltd. For transfection, A375 or M14 cells were seeded at a density of 2 × 10 5 cells per well in a six‐well culture dish, and transfection was performed when 80% confluence was achieved.

Techniques: Over Expression, Transfection, Plasmid Preparation, CCK-8 Assay, Flow Cytometry

Knockdown of CDKN2C could abolish the effects of miR‐21‐5p down‐regulation on melanoma cells. A375 cells were transfected with miR‐21‐5p inhibitor together with si‐NC or si‐CDKN2C. (A) Cell proliferation was measured by the CCK‐8 assay. The CCK‐8 assay was performed every 24 h for 4 days. (B, C) Flow cytometry was performed to detect cell‐cycle distribution. Each sample was analyzed at least three times. Data were expressed as mean ± SD. Differences were evaluated using one‐way ANOVA, followed by Tukey’s test. * P < 0.05, ** P < 0.01, *** P < 0.001, compared with NC + si‐NC; # P < 0.05, ## P < 0.01, ### P < 0.001, compared with inhibitor + si‐NC.

Journal: FEBS Open Bio

Article Title: miR‐21‐5p promotes cell proliferation and G1/S transition in melanoma by targeting CDKN2C

doi: 10.1002/2211-5463.12819

Figure Lengend Snippet: Knockdown of CDKN2C could abolish the effects of miR‐21‐5p down‐regulation on melanoma cells. A375 cells were transfected with miR‐21‐5p inhibitor together with si‐NC or si‐CDKN2C. (A) Cell proliferation was measured by the CCK‐8 assay. The CCK‐8 assay was performed every 24 h for 4 days. (B, C) Flow cytometry was performed to detect cell‐cycle distribution. Each sample was analyzed at least three times. Data were expressed as mean ± SD. Differences were evaluated using one‐way ANOVA, followed by Tukey’s test. * P < 0.05, ** P < 0.01, *** P < 0.001, compared with NC + si‐NC; # P < 0.05, ## P < 0.01, ### P < 0.001, compared with inhibitor + si‐NC.

Article Snippet: The CDKN2C overexpression plasmid was constructed by inserting CDKN2C cDNA into a pcDNA3.1 vector by GenePharma Co. Ltd. For transfection, A375 or M14 cells were seeded at a density of 2 × 10 5 cells per well in a six‐well culture dish, and transfection was performed when 80% confluence was achieved.

Techniques: Transfection, CCK-8 Assay, Flow Cytometry

a Heatmap of candidate validation. Huh-106 cells were transduced with the indicated ORF and infected with HBV. HBV infection was assessed at 10 dpi by CLIA quantification of secreted HBeAg and HBsAg. Results are expressed as means concentration of secreted HBeAg or HBsAg from 1 experiment ( n = 2). Genes in italic ( KRT80 and CPA1 ) correspond to negative controls, which were not identified as candidates from the primary screen. Mock#1 and Mock#2: uninfected HepG2-NTCP cells. HBV ctrl: non-transduced HBV-infected HepG2-cells. GFP: GFP-transduced HBV-infected HepG2-NTCP cells. b , c Microarray for comparison of gene expression in HepG2-NTCP and Huh-106 cells. Analysis of differentially expressed pathways ( b ) and candidate host factors from the primary screen through Z score transformation ( c ) are presented. d , e CDKN2C is upregulated in HepG2-NTCP compared to Huh-106 cells. d CDKN2C mRNA expression in HepG2-NTCP and Huh-106 cells quantified by qRT-PCR. Results are expressed as means +/− SEM CDKN2C relative expression compared to HepG2-NTCP (set to 1) from 3 independent experiments ( n = 6). e Endogenous CDKN2C protein expression in HepG2-NTCP and Huh-106 cells detected by western blot. One representative experiment is shown. ** p < 0.01 (two-tailed Mann–Whitney U test). Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: A genome-wide gain-of-function screen identifies CDKN2C as a HBV host factor

doi: 10.1038/s41467-020-16517-w

Figure Lengend Snippet: a Heatmap of candidate validation. Huh-106 cells were transduced with the indicated ORF and infected with HBV. HBV infection was assessed at 10 dpi by CLIA quantification of secreted HBeAg and HBsAg. Results are expressed as means concentration of secreted HBeAg or HBsAg from 1 experiment ( n = 2). Genes in italic ( KRT80 and CPA1 ) correspond to negative controls, which were not identified as candidates from the primary screen. Mock#1 and Mock#2: uninfected HepG2-NTCP cells. HBV ctrl: non-transduced HBV-infected HepG2-cells. GFP: GFP-transduced HBV-infected HepG2-NTCP cells. b , c Microarray for comparison of gene expression in HepG2-NTCP and Huh-106 cells. Analysis of differentially expressed pathways ( b ) and candidate host factors from the primary screen through Z score transformation ( c ) are presented. d , e CDKN2C is upregulated in HepG2-NTCP compared to Huh-106 cells. d CDKN2C mRNA expression in HepG2-NTCP and Huh-106 cells quantified by qRT-PCR. Results are expressed as means +/− SEM CDKN2C relative expression compared to HepG2-NTCP (set to 1) from 3 independent experiments ( n = 6). e Endogenous CDKN2C protein expression in HepG2-NTCP and Huh-106 cells detected by western blot. One representative experiment is shown. ** p < 0.01 (two-tailed Mann–Whitney U test). Source data are provided as a Source Data file.

Article Snippet: For silencing of CDKN2C expression in PHHs, PHHs were transduced with lentiviral vectors containing CDKN2C -targeting shRNA (target sequence: GATGTTAACATCGAGGATAAT) or a scrambled shRNA control (target sequence: CCTAAGGTTAAGTCGCCCTCG) obtained from VectorBuilder.

Techniques: Biomarker Discovery, Transduction, Infection, Concentration Assay, Microarray, Comparison, Gene Expression, Transformation Assay, Expressing, Quantitative RT-PCR, Western Blot, Two Tailed Test, MANN-WHITNEY

a Individual ORF overexpression in Huh-106 and HBV infection 3 days after transduction. Detection of HBV pgRNA by qRT-PCR 10 dpi. Results are expressed as means +/− SEM relative pgRNA expression (%) compared to ctrl (set as 100%) from 8 independent experiments ( n = 21). b , c siRNA transfection of HepG2-NTCP cells. b mRNA. Results are expressed as means +/− SEM relative expression compared to si ctrl (set to 1) from 4 independent experiments ( n = 8). c HBV infection after silencing was detected by IF 10 dpi. Scale bars: 100 µm. d Production of CDKN2C knockout cell lines. CDKN2C expression was controlled by western blot for in HepG2-NTCP (ctrl) and KO-CDKN2C clones. e HBV infection of HepG2-NTCP, KO-CDKN2C clones, and Huh-106. HBV infection was assessed at 10 dpi by pgRNA qRT-PCR (black) and quantification of secreted HBeAg (white). Results are expressed as means +/− SEM % HBV infection compared to HepG2-NTCP (set as 100%) from 3 independent experiments ( n = 9 for pgRNA and n = 12 for HBe CLIA). f Detection of endogenous CDKN2C expression in PHH from 7 donors. One experiment is shown. g Validation studies in PHH from 3 different donors transduced with ORF lentivirus for 3 days and infected with HBV. HBV markers (pgRNA, black; HBeAg, white) were detected 10 dpi. Results are expressed as means +/− SEM % HBV infection compared to ctrl (GFP) (set to 100%) from 3 independent experiments ( n = 12 for pgRNA; n = 6 for HBeAg). h PHH from 3 donors were transduced with lentiviruses containing CDKN2C-targeting shRNA or non-targeting shRNA control (sh ctrl). Silencing efficacy was assessed by qRT-PCR. Results are expressed as means +/− SEM % gene expression compared to sh ctrl (set to 100%) from 3 independent experiments ( n = 9). PHH were then infected with HBV and HBV infection was assessed by pgRNA qRT-PCR 8 dpi. Results are expressed as means +/− SEM relative pgRNA expression compared to sh ctrl (set to 100%) from 3 independent experiments ( n = 9). ** p < 0.01; *** p < 0.001 (two-tailed Mann–Whitney U test). Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: A genome-wide gain-of-function screen identifies CDKN2C as a HBV host factor

doi: 10.1038/s41467-020-16517-w

Figure Lengend Snippet: a Individual ORF overexpression in Huh-106 and HBV infection 3 days after transduction. Detection of HBV pgRNA by qRT-PCR 10 dpi. Results are expressed as means +/− SEM relative pgRNA expression (%) compared to ctrl (set as 100%) from 8 independent experiments ( n = 21). b , c siRNA transfection of HepG2-NTCP cells. b mRNA. Results are expressed as means +/− SEM relative expression compared to si ctrl (set to 1) from 4 independent experiments ( n = 8). c HBV infection after silencing was detected by IF 10 dpi. Scale bars: 100 µm. d Production of CDKN2C knockout cell lines. CDKN2C expression was controlled by western blot for in HepG2-NTCP (ctrl) and KO-CDKN2C clones. e HBV infection of HepG2-NTCP, KO-CDKN2C clones, and Huh-106. HBV infection was assessed at 10 dpi by pgRNA qRT-PCR (black) and quantification of secreted HBeAg (white). Results are expressed as means +/− SEM % HBV infection compared to HepG2-NTCP (set as 100%) from 3 independent experiments ( n = 9 for pgRNA and n = 12 for HBe CLIA). f Detection of endogenous CDKN2C expression in PHH from 7 donors. One experiment is shown. g Validation studies in PHH from 3 different donors transduced with ORF lentivirus for 3 days and infected with HBV. HBV markers (pgRNA, black; HBeAg, white) were detected 10 dpi. Results are expressed as means +/− SEM % HBV infection compared to ctrl (GFP) (set to 100%) from 3 independent experiments ( n = 12 for pgRNA; n = 6 for HBeAg). h PHH from 3 donors were transduced with lentiviruses containing CDKN2C-targeting shRNA or non-targeting shRNA control (sh ctrl). Silencing efficacy was assessed by qRT-PCR. Results are expressed as means +/− SEM % gene expression compared to sh ctrl (set to 100%) from 3 independent experiments ( n = 9). PHH were then infected with HBV and HBV infection was assessed by pgRNA qRT-PCR 8 dpi. Results are expressed as means +/− SEM relative pgRNA expression compared to sh ctrl (set to 100%) from 3 independent experiments ( n = 9). ** p < 0.01; *** p < 0.001 (two-tailed Mann–Whitney U test). Source data are provided as a Source Data file.

Article Snippet: For silencing of CDKN2C expression in PHHs, PHHs were transduced with lentiviral vectors containing CDKN2C -targeting shRNA (target sequence: GATGTTAACATCGAGGATAAT) or a scrambled shRNA control (target sequence: CCTAAGGTTAAGTCGCCCTCG) obtained from VectorBuilder.

Techniques: Over Expression, Infection, Transduction, Quantitative RT-PCR, Expressing, Transfection, Knock-Out, Western Blot, Clone Assay, Biomarker Discovery, shRNA, Control, Gene Expression, Two Tailed Test, MANN-WHITNEY

a , b , d – g Validation studies in Huh-106 overexpressing individual ORFs and infected with HBV for 10 days. a Detection of HBsAg by IF. Scale bars: 100 µm. b Flow cytometric analysis for quantification of HBsAg-positive cells. Results are expressed as means +/− SEM % HBsAg-positive cells compared to GFP from 5 independent experiments ( n = 13, n = 11 for HNF4A) and 3 independent experiments ( n = 8) for CDKN2C + ESRP1 c Flow cytometric analysis for quantification of HBsAg-positive cells in HBV-infected HepG2-NTCP cells. Results are expressed as means +/− SEM % HBsAg-positive cells from 4 independent experiments ( n = 4). d , e Detection of HBV DNAs by Southern blot in transduced and HBV-infected Huh-106 4 dpi. d Southern blot with the indicated bands of HBV pf-rcDNA, dsl HBV DNA, and HBV cccDNA. One representative experiment is shown. e Quantification of cccDNA. Results are expressed as means +/− SEM % band intensity compared to GFP (set to 100%) from 3 independent experiments ( n = 2). f Detection of HBV RNAs by northern blot. The pgRNA (3.5 kb) and surface mRNAs of 2.1 to 2.4 kb (2.1 kb) are detected. One representative experiment is shown. g Quantification of HBV RNA band intensity. Results are expressed as means +/− SEM % band intensity compared to GFP (set to 100%) from 4 independent experiments. h Analysis of nascent HBV RNA synthesis. Quantification of total HBV RNAs (4 dpi) and nascent HBV RNAs (d4pi, 120 min) in Huh-106 cells overexpressing CDKN2C using labeled uridine (EU). Actinomycin D (ActD) was used as negative control. Results are expressed as means +/− SEM % relative HBV RNAs compared to HBV Ctrl (Huh-106 GFP+ set to 1) from 2 independent experiments ( n = 6). i HNF4a , HLF and PPARα mRNA expression in CDKN2C-overexpressing Huh-106 quantified by qRT-PCR. Results are expressed as means +/− SEM % relative HNF4a or HLF or PPARα expression compared to Mock (set to 100%) from 3 independent experiments ( n = 9) * p < 0.05; ** p < 0.01; *** p < 0.001 (two-tailed Mann–Whitney U test). MM molecular marker. Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: A genome-wide gain-of-function screen identifies CDKN2C as a HBV host factor

doi: 10.1038/s41467-020-16517-w

Figure Lengend Snippet: a , b , d – g Validation studies in Huh-106 overexpressing individual ORFs and infected with HBV for 10 days. a Detection of HBsAg by IF. Scale bars: 100 µm. b Flow cytometric analysis for quantification of HBsAg-positive cells. Results are expressed as means +/− SEM % HBsAg-positive cells compared to GFP from 5 independent experiments ( n = 13, n = 11 for HNF4A) and 3 independent experiments ( n = 8) for CDKN2C + ESRP1 c Flow cytometric analysis for quantification of HBsAg-positive cells in HBV-infected HepG2-NTCP cells. Results are expressed as means +/− SEM % HBsAg-positive cells from 4 independent experiments ( n = 4). d , e Detection of HBV DNAs by Southern blot in transduced and HBV-infected Huh-106 4 dpi. d Southern blot with the indicated bands of HBV pf-rcDNA, dsl HBV DNA, and HBV cccDNA. One representative experiment is shown. e Quantification of cccDNA. Results are expressed as means +/− SEM % band intensity compared to GFP (set to 100%) from 3 independent experiments ( n = 2). f Detection of HBV RNAs by northern blot. The pgRNA (3.5 kb) and surface mRNAs of 2.1 to 2.4 kb (2.1 kb) are detected. One representative experiment is shown. g Quantification of HBV RNA band intensity. Results are expressed as means +/− SEM % band intensity compared to GFP (set to 100%) from 4 independent experiments. h Analysis of nascent HBV RNA synthesis. Quantification of total HBV RNAs (4 dpi) and nascent HBV RNAs (d4pi, 120 min) in Huh-106 cells overexpressing CDKN2C using labeled uridine (EU). Actinomycin D (ActD) was used as negative control. Results are expressed as means +/− SEM % relative HBV RNAs compared to HBV Ctrl (Huh-106 GFP+ set to 1) from 2 independent experiments ( n = 6). i HNF4a , HLF and PPARα mRNA expression in CDKN2C-overexpressing Huh-106 quantified by qRT-PCR. Results are expressed as means +/− SEM % relative HNF4a or HLF or PPARα expression compared to Mock (set to 100%) from 3 independent experiments ( n = 9) * p < 0.05; ** p < 0.01; *** p < 0.001 (two-tailed Mann–Whitney U test). MM molecular marker. Source data are provided as a Source Data file.

Article Snippet: For silencing of CDKN2C expression in PHHs, PHHs were transduced with lentiviral vectors containing CDKN2C -targeting shRNA (target sequence: GATGTTAACATCGAGGATAAT) or a scrambled shRNA control (target sequence: CCTAAGGTTAAGTCGCCCTCG) obtained from VectorBuilder.

Techniques: Biomarker Discovery, Infection, Southern Blot, Northern Blot, Labeling, Negative Control, Expressing, Quantitative RT-PCR, Two Tailed Test, MANN-WHITNEY, Marker

CDKN2C and Palbociclib inhibit the CDK4/6 and Cyclin D-mediated phosphorylation of Rb protein, leading to an accumulation of Rb protein in its unphosphorylated state. Unphosphorylated Rb protein induces a cell cycle G1 arrest resulting in increased HBV infection rates. Illustrative HBV infection pictures come from Fig. . Scale bars: 100 µm.

Journal: Nature Communications

Article Title: A genome-wide gain-of-function screen identifies CDKN2C as a HBV host factor

doi: 10.1038/s41467-020-16517-w

Figure Lengend Snippet: CDKN2C and Palbociclib inhibit the CDK4/6 and Cyclin D-mediated phosphorylation of Rb protein, leading to an accumulation of Rb protein in its unphosphorylated state. Unphosphorylated Rb protein induces a cell cycle G1 arrest resulting in increased HBV infection rates. Illustrative HBV infection pictures come from Fig. . Scale bars: 100 µm.

Article Snippet: For silencing of CDKN2C expression in PHHs, PHHs were transduced with lentiviral vectors containing CDKN2C -targeting shRNA (target sequence: GATGTTAACATCGAGGATAAT) or a scrambled shRNA control (target sequence: CCTAAGGTTAAGTCGCCCTCG) obtained from VectorBuilder.

Techniques: Phospho-proteomics, Infection

a CDKN2C mRNA expression in HBV-infected PHH from 3 different donors quantified by qRT-PCR. Results are expressed as means +/− SEM % relative CDKN2C expression compared to Mock (set to 100%) from 3 independent experiments ( n = 9). b CDKN2C expression in HBV-infected patients with undetectable (HBV DNA(−), n = 32) or detectable (HBV DNA(+), n = 90) HBV DNA compared to healthy patients ( n = 6) (cohorts described in “Methods”). c CDKN2C expression in HBV-infected patients depending on the stage of virus infection (cohorts described in “Methods”). Tolerance: n = 22; Clearance: n = 50; Inactive: n = 11. d CDKN2C expression in tumor and adjacent tissues in HCC patients from two independent cohorts (see “Methods”). Non-tumor: n = 198; Tumor: n = 98 (left panel). Non-tumor: n = 5; Tumor: n = 50 (right panel). e CDKN2C expression in tumor and non-tumor (normal) liver tissue from patients with alcoholic liver disease (Alc, Tumor: n = 70; Non-tumor: n = 8), HBV-infected patients (Tumor: n = 76; Non-tumor: n = 7), HCV-infected patients (Tumor: n = 34; Non-tumor: n = 5), and patients with non-alcoholic fatty liver disease (NAFLD, Tumor: n = 11; Non-tumor: n = 2) extracted from TCGA database as described in “Methods.” f Survival analysis for HCC patients with low or high CDKN2C expression (for cohort, see “Methods”). * p < 0.05; ** p < 0.01; *** p < 0.001 ( b , c : Kruskal–Wallis H test adjusted for multiple comparisons; d , e : two-tailed Mann–Whitney U test). The details of the plots are presented in Supplementary Tables and . Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: A genome-wide gain-of-function screen identifies CDKN2C as a HBV host factor

doi: 10.1038/s41467-020-16517-w

Figure Lengend Snippet: a CDKN2C mRNA expression in HBV-infected PHH from 3 different donors quantified by qRT-PCR. Results are expressed as means +/− SEM % relative CDKN2C expression compared to Mock (set to 100%) from 3 independent experiments ( n = 9). b CDKN2C expression in HBV-infected patients with undetectable (HBV DNA(−), n = 32) or detectable (HBV DNA(+), n = 90) HBV DNA compared to healthy patients ( n = 6) (cohorts described in “Methods”). c CDKN2C expression in HBV-infected patients depending on the stage of virus infection (cohorts described in “Methods”). Tolerance: n = 22; Clearance: n = 50; Inactive: n = 11. d CDKN2C expression in tumor and adjacent tissues in HCC patients from two independent cohorts (see “Methods”). Non-tumor: n = 198; Tumor: n = 98 (left panel). Non-tumor: n = 5; Tumor: n = 50 (right panel). e CDKN2C expression in tumor and non-tumor (normal) liver tissue from patients with alcoholic liver disease (Alc, Tumor: n = 70; Non-tumor: n = 8), HBV-infected patients (Tumor: n = 76; Non-tumor: n = 7), HCV-infected patients (Tumor: n = 34; Non-tumor: n = 5), and patients with non-alcoholic fatty liver disease (NAFLD, Tumor: n = 11; Non-tumor: n = 2) extracted from TCGA database as described in “Methods.” f Survival analysis for HCC patients with low or high CDKN2C expression (for cohort, see “Methods”). * p < 0.05; ** p < 0.01; *** p < 0.001 ( b , c : Kruskal–Wallis H test adjusted for multiple comparisons; d , e : two-tailed Mann–Whitney U test). The details of the plots are presented in Supplementary Tables and . Source data are provided as a Source Data file.

Article Snippet: For silencing of CDKN2C expression in PHHs, PHHs were transduced with lentiviral vectors containing CDKN2C -targeting shRNA (target sequence: GATGTTAACATCGAGGATAAT) or a scrambled shRNA control (target sequence: CCTAAGGTTAAGTCGCCCTCG) obtained from VectorBuilder.

Techniques: Expressing, Infection, Quantitative RT-PCR, Virus, Two Tailed Test, MANN-WHITNEY