|
Sangon Biotech
tggtgtttgagcatgtagacc sangon biotech n a cdk4 reverse Tggtgtttgagcatgtagacc Sangon Biotech N A Cdk4 Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdk4/a+biotech+cdk4+n+reverse+sangon+tggtgtttgagcatgtagacc/pm40449480-254-194-195 Average 86 stars, based on 1 article reviews
tggtgtttgagcatgtagacc sangon biotech n a cdk4 reverse - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
OriGene
sirna transfection ![]() Sirna Transfection, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdk4/CDK4+(NM_000075)+Human+Mutant+ORF+Clone/pmc05690820-85-2-7 Average 90 stars, based on 1 article reviews
sirna transfection - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Addgene inc
cdk4 ![]() Cdk4, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdk4/Cdk4+(Plasmid+%231874)/10__1158_slash_0008___5472__can___10___0628-46-18-25 Average 93 stars, based on 1 article reviews
cdk4 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
human anti rabbit monoclonal cdk4 antibody ![]() Human Anti Rabbit Monoclonal Cdk4 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdk4/CDK4+Rabbit+mAb/pm25663864-52-30-35 Average 96 stars, based on 1 article reviews
human anti rabbit monoclonal cdk4 antibody - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
rabbit anti cdk4 antibody ![]() Rabbit Anti Cdk4 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdk4/CDK4+Rabbit+mAb+%5C/pmc06813528-48-17-25 Average 94 stars, based on 1 article reviews
rabbit anti cdk4 antibody - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Biorbyt
cdk4 ![]() Cdk4, supplied by Biorbyt, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdk4/CDK4+antibody/pmc07751651-165-6-5 Average 93 stars, based on 1 article reviews
cdk4 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Proteintech
cdk4 pab ![]() Cdk4 Pab, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdk4/CDK4+Antibody/pm39090819-54-3-13 Average 96 stars, based on 1 article reviews
cdk4 pab - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
Proteintech
10883 1 ap ![]() 10883 1 Ap, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdk4/P16-INK4A+Antibody/pmc12912745-67-49-50 Average 96 stars, based on 1 article reviews
10883 1 ap - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
cdk4 ![]() Cdk4, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdk4/Cdk4+Antibody/10__1074_slash_jbc__m312822200-68-30-31 Average 96 stars, based on 1 article reviews
cdk4 - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
Novus Biologicals
cdk4 ![]() Cdk4, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdk4/CDK4+Antibody/pmc05224456-258-150-151 Average 92 stars, based on 1 article reviews
cdk4 - by Bioz Stars,
2026-09
92/100 stars
|
Buy from Supplier |
|
Addgene inc
p53dd p2a cdk4 r24c t2a bcl2 ![]() P53dd P2a Cdk4 R24c T2a Bcl2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdk4/P53dd-p2A-CDK4_R24C-t2A-BCL2+(Plasmid+%23135308)/bio_rxiv__618835-161-47-55 Average 91 stars, based on 1 article reviews
p53dd p2a cdk4 r24c t2a bcl2 - by Bioz Stars,
2026-09
91/100 stars
|
Buy from Supplier |
|
Proteintech
rabbit anti sertad1 ![]() Rabbit Anti Sertad1, supplied by Proteintech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdk4/SERTAD1+Antibody/pmc09001148-41-33-43 Average 90 stars, based on 1 article reviews
rabbit anti sertad1 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Clinical cancer research : an official journal of the American Association for Cancer Research
Article Title: Combined CDK4/6 mTOR inhibition is synergistic against glioblastoma via multiple mechanisms
doi: 10.1158/1078-0432.CCR-17-0803
Figure Lengend Snippet: (A) Enrichment analysis showing increased sensitivity of cancer lines with mutations in RB1 to an mTOR inhibitor, sirolimus. (B) Synergy scores of the combination of CDK4/6 and mTOR inhibition in two GIC lines calculated with both the Bliss and the Chou-Talalay methods. (C) 10 and 100 GICs were cultured in 24-well plates over two weeks to compare sphere formation upon treatment with vehicle, palbociclib (1 μM), everolimus (4 μM), and the combination of palbociclib and everolimus (*P < 0.05; **P < 0.001; ***P < 0.0001; one-way analysis of variance (ANOVA) with post-hoc Tukey analysis). (D) The combination of a different mTOR inhibitor temsirolimus (4 μM) and a different CDK4/6 inhibitor ribociclib (4 μM) is also synergistic against GICs (***P < 0.0001; one-way ANOVA with post-hoc Tukey analysis). (E) The combinations of palbociclib (4 μM) with mTOR siRNA and everolimus (5 μM) with CDK4/6 siRNA are also synergistic against GICs (each treatment line received either DMSO or the indicated drug and either control siRNA or a specific siRNA) (**P < 0.001; ***P < 0.0001; one-way ANOVA with post-hoc Tukey analysis). (F) Constitutively-active CDK4 and mTOR plasmids partially rescued from the effects of the combination treatment (each treatment line received either a control plasmid or the indicated active plasmid and either DMSO or the combination treatment) (*P < 0.05; two-tailed t-test). (G and H) Combined CDK4/6 and mTOR inhibition induces significant apoptosis. Shown is an immunoblot using antibodies specific for Bcl-2 and PARP. Caspase-3/7 level is increased with the three days of combined treatment. (*P < 0.05; ***P < 0.0001; one-way ANOVA with post-hoc Tukey analysis).
Article Snippet: Plasmid and
Techniques: Inhibition, Cell Culture, Control, Plasmid Preparation, Two Tailed Test, Western Blot
Journal: Cancer Research
Article Title: Cyclin-Dependent Kinase–Mediated Phosphorylation Plays a Critical Role in the Oncogenic Functions of PELP1
doi: 10.1158/0008-5472.can-10-0628
Figure Lengend Snippet: Figure 1. PELP1 is a novel substrate of interphase CDKs. A, expression status of PELP1 in the cell cycle was analyzed in IMR-90 cells (left) and NIH3T3 cells (right). Cells synchronized at G0-G1 phase were released into the cell cycle, and lysates from different time intervals were used in Western blot analysis with the 220B2 PELP1 antibody. B, total lysates from MCF7 cells grown in 10% serum were subjected to immunoprecipitation (IP) using the PELP1 antibody (left), and the CDK4 interaction was verified by Western blotting. Middle, T7-tagged PELP1-overexpressing MCF7 cells were treated with 10−8 mol/L estrogen for various periods of time, PELP1 was immunoprecipitated, and the CDK4 interaction was verified by Western blotting. Right, in vitro kinase assays for the CDK4/cyclin D complex using baculovirus-expressed, GST-tagged, full-length PELP1 as a substrate, and phosphorylation was measured by the amount of 32P incorporation. C, left, total lysates from MCF7 cells grown in 10% serum were subjected to immunoprecipitation using the PELP1 antibody and the CDK2 interaction was verified by Western blot analysis. Middle, MCF7 cells were treated with E2 for various periods of time, and the PELP1 interaction with CDK2 was analyzed by using immunoprecipitation. Right, in vitro kinase assays using CDK2/cyclin E (CyE) complex and CDK2/ cyclin A2 (CyA) complex using full-length PELP1 as a substrate.
Article Snippet: The plaslutathione S-transferase (GST)–PELP1 deletions (16), uc (17), and GFP-PELP1 (16) were described previously. sion vectors for p16INK4A,
Techniques: Expressing, Western Blot, Immunoprecipitation, In Vitro, Phospho-proteomics
Journal: Cancer Research
Article Title: Cyclin-Dependent Kinase–Mediated Phosphorylation Plays a Critical Role in the Oncogenic Functions of PELP1
doi: 10.1158/0008-5472.can-10-0628
Figure Lengend Snippet: Figure 2. Identification of phosphorylation sites and generation of phospho-specific antibody. A, bacterially expressed GST-PELP1 deletions were used as substrates for an in vitro kinase assay using CDK4/cyclin D1 (left), CDK2/cyclin E (middle), and CDK2/cyclin A2 (right), and PELP1 domains phosphorylated by each kinase complex were identified by using autoradiography. B, identification of CDK phosphorylation sites using site-directed mutagenesis (serine to alanine). Various single MTs in the region of interest were used along with respective PELP1-WT deletion fragments. Loss of 32P incorporation revealed the successful identification of phosphorylation sites. C, Western blot analysis of native, WT-tagged PELP1 and tagged phospho-PELP1-MT with the Ser991 phospho-PELP1 antibody in the presence or absence of the phosphopeptide. D, MCF7 cells were either arrested and released by E2 stimulation (left) or synchronized into the G1-S boundary by double-thymidine block and released into the cell cycle by addition of thymidine-free medium (right), and phosphorylation status of PELP1 was analyzed by using the phospho-Ser991 antibody.
Article Snippet: The plaslutathione S-transferase (GST)–PELP1 deletions (16), uc (17), and GFP-PELP1 (16) were described previously. sion vectors for p16INK4A,
Techniques: Phospho-proteomics, In Vitro, Kinase Assay, Autoradiography, Mutagenesis, Western Blot, Blocking Assay
Journal: Oncology letters
Article Title: P16 INK4A is required for cisplatin resistance in cervical carcinoma SiHa cells.
doi: 10.3892/ol.2014.2814
Figure Lengend Snippet: Figure 2. P16INK4A‑CDK4 interaction is upregulated in SiHa‑DDP cells with pRb inactivation. (A) Western blot analysis revealed the changes in P16, cyclin D1 and pRb protein expression, indicating an inverse cor relation with P16 and cyclin D1, pRb in DDP‑resistant SiHa‑DPP cells. (B) Co‑immunoprecipitation was conducted to evaluate the enhanced interaction between P16 and CDK4 in SiHa‑DDP cells when compared with SiHa cells. DDP, cisplatin; Rb, retinoblastoma protein; pRb, phosphorylated retinoblastoma protein; CDK, cyclin‑dependent kinase.
Article Snippet: The membranes were then incubated with human anti-mouse monoclonal p16 antibody (Sigma-Aldrich, St. Louis, MO, USA), human anti-mouse polyclonal pRb and β-actin antibodies (Cell Signaling Technology Inc., Danvers, MA, USA),
Techniques: Western Blot, Expressing
Journal: Journal of Biomedical Research
Article Title: Activation of p38/HSP27 pathway counters melatonin-induced inhibitory effect on proliferation of human gastric cancer cells
doi: 10.7555/JBR.33.20180066
Figure Lengend Snippet: A: Cell proliferation was evaluated by MTT assays after melatonin treatment for the indicated doses and time. Values were determined by three independent experiments. * italic P /italic 0.05, ** italic P /italic 0.01. B: BGC-823 cells were stimulated with 1 mmol/L melatonin for 48 hours, and cell cycle was measured by flow cytometry analysis. C: The expression of cyclin D1 and CDK4 were determined by immunobloting analysis. -Actin was used as a loading control. * italic P /italic 0.05, ** italic P /italic 0.01. D: Melatonin-induced apoptosis was measured by flow cytometry analysis.
Article Snippet: The following antibodies were used: rabbit anti-p38 antibody, rabbit anti-p-p38 antibody, mouse anti-HSP27 antibody, rabbit anti-p-HSP27 antibody,
Techniques: Flow Cytometry, Expressing, Western Blot, Control
Journal: Journal of Biological Chemistry
Article Title: Activation of the CKI-CDK-Rb-E2F Pathway in Full Genome Hepatitis C Virus-expressing Cells
doi: 10.1074/jbc.m312822200
Figure Lengend Snippet: FIG. 5. Activation of E2F and CDK occurs in RzM6 cells after 44 days of passage. A, DHFR promoter activity in RzM6, Fse-Hep, and Age-Hep cells. Each reaction was standardized using the Renilla luciferase reporter plasmid (relative luciferase activity). The ratio of the -fold increase was calculated by the division of each relative luciferase activity in cells prior to HCV expression. -Fold activation of relative luciferase activity is given as a ratio. The results represent the average of 3 wells in two independent experiments. B, CDK2 and CDK4/6 activities in Rz2-18 and RzM6 cells on days 0, 8, and 44. NRS, immunoglobulin derived from normal rabbit serum; NMS, immunoglobulin derived from normal mouse serum. The percentage of each kinase activity relative to day 0 as quantitated using a phospho-imager plate is shown. tr.Rb, truncated Rb. C, stability of the p21WAF1/CIP1 and Rb proteins characterized by Western blotting after cycloheximide treatment for the indicated times.
Article Snippet: Antibodies against p53 (Novo Castra); p21WAF1/CIP1 and EB1 (Transduction Laboratories); RhoA, interferon (IFN) regulatory factor-1, Rho guanine nucleotide dissociation inhibitor, p27KIP1, p16INK, cyclin A, cyclin D1, cyclin E, CDK2, and
Techniques: Activation Assay, Activity Assay, Luciferase, Plasmid Preparation, Expressing, Derivative Assay, Western Blot
Journal: Cell Cycle
Article Title: Cell cycle S phase markers are expressed in cerebral neuron nuclei of cats infected by the Feline Panleukopenia Virus
doi: 10.1080/15384101.2016.1249546
Figure Lengend Snippet: Specificity in the feline species of the antibodies used. Western blot using proteins from HEK293T cells (A, positive control) and Crandel Feline kidney cells (B, CrFK). Anti-cyclinA, anti-Cdk2, anti Cdk4 antibodies label a single band at the expected molecular weight.
Article Snippet: Histology and immunohistochemistry The following primary antibodies were used with different dilutions for light (L) or fluorescence (F) microscopy, without or with amplification (A), and, for some antibodies, after pretreatment with citrate buffer (C) or TRIS EDTA buffer (T); dilutions for western blot (WB) were also different: mouse anti canine parvovirus (Santa Cruz sc-57961, L 1/50); rabbit anti calbindin (Swant, L 1/5000); rabbit anti MAP2 (Abcam ab32454, L 1/500, F 1/100 A, C or T); mouse anti MAP2 (Sigma Aldrich, clone HM-2, M4403, L 1/500, F 1/100 A, C); mouse anti PCNA (Abcam clone PC10, Ab29, L 1/1000, F 1/100, C); rabbit anti PCNA (Santa Cruz, sc-7907, L 1/500); rabbit anti cyclin D1 (Bios bs-0623, L 1/2000, C); rabbit anti cyclin A (Santa Cruz, sc-751, L 1/100, F 1/100 A, C; WB 1/1000); rabbit anti cdk2 (Spring Bioscience, clone SP80, L 1/100, F 1/50 A, C; WB 1/1000); rabbit anti
Techniques: Western Blot, Positive Control, Molecular Weight
Journal: Cell Cycle
Article Title: Cell cycle S phase markers are expressed in cerebral neuron nuclei of cats infected by the Feline Panleukopenia Virus
doi: 10.1080/15384101.2016.1249546
Figure Lengend Snippet: Immunohistochemical validation in the feline species of the antibodies used. Immunostainings on a feline mammary adenocarcinoma. (a and h) representative examples of negative controls (no primary antibody); (B) anti-cyclin D, (C) anti-cyclin A, (D) anti-PCNA, (E) anti-Cdk4, (F) anti-Cdk2, (G) anti- H2A1. Some tumor cell nuclei are immunostained. Bar = 100µm.
Article Snippet: Histology and immunohistochemistry The following primary antibodies were used with different dilutions for light (L) or fluorescence (F) microscopy, without or with amplification (A), and, for some antibodies, after pretreatment with citrate buffer (C) or TRIS EDTA buffer (T); dilutions for western blot (WB) were also different: mouse anti canine parvovirus (Santa Cruz sc-57961, L 1/50); rabbit anti calbindin (Swant, L 1/5000); rabbit anti MAP2 (Abcam ab32454, L 1/500, F 1/100 A, C or T); mouse anti MAP2 (Sigma Aldrich, clone HM-2, M4403, L 1/500, F 1/100 A, C); mouse anti PCNA (Abcam clone PC10, Ab29, L 1/1000, F 1/100, C); rabbit anti PCNA (Santa Cruz, sc-7907, L 1/500); rabbit anti cyclin D1 (Bios bs-0623, L 1/2000, C); rabbit anti cyclin A (Santa Cruz, sc-751, L 1/100, F 1/100 A, C; WB 1/1000); rabbit anti cdk2 (Spring Bioscience, clone SP80, L 1/100, F 1/50 A, C; WB 1/1000); rabbit anti
Techniques: Immunohistochemical staining, Biomarker Discovery