Journal: Cell

Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss

doi: 10.1016/j.cell.2019.12.002

Figure Lengend Snippet: Data and Software Availability

Article Snippet: NCBI GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse: Adrb2 flox G. Karsenty N/A Mouse: Arg1 flox Jackson Laboratory #008817 Mouse: Cx3cr1 GFP Mouse: Nestin GFP P. Frenette, G. Enikolopov N/A Mouse: Casp11 −/− Jackson Laboratory #024698 Mouse: R26-CAG-ASC-citrine Jackson Laboratory #030744 Mouse: NSG Jackson Laboratory #005557 Mouse: Phox2b cre Jackson Laboratory # 016223 #Mouse: Plp1 CreERT Jackson Laboratory # 005975 Mouse: Rosa26 DTA Jackson Laboratory # 009669 Mouse: R26-hM4Di/mCitrine Jackson Laboratory # 026219 Mouse: Sox10 CreERT2 B. Gulbransen, V. Pachnis N/A Mouse: SNS cre R. Kuhner N/A Mouse: Nlrp6 flox P. Rosenstiel N/A Mouse: Casp11 flox KOMP N/A Oligonucleotides Casp11 forward 5’-AGGCATATCTATAATCCCTTCACTG-3’ IDT N/A Casp11 reverse 5’-GAATATATCAAAGAGATGACAAGAGC- 3’ IDT N/A Arg1 forward 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ IDT N/A Arg1 reverse 5’-AGGAGCTGTCATTAGGGACATC-3’ IDT N/A Ym1 forward 5’-AGACTTGCGTGACTATGAAGCATT-3’ IDT N/A Ym1 reverse 5’-GCAGGTCCAAACTTCCATCCTC-3’ IDT N/A Rpl32 forward 5’-ACAATGTCAAGGAGCTGGAG-3’ IDT N/A Rpl32 reverse 5’-TTGGGATTGGTGACTCTGATG-3’ IDT N/A Nlrp6 E1 forward 5’-TTGACTGTCAGCAAGAGTCC-3’ IDT N/A Nlrp6 E1 reverse 5’-GGTGATCCTTTCTGGGCTAAA-3’ IDT N/A Nlrp6 E4 forward 5’-CAGACGCTGTGGACCTTGT-3’ IDT N/A Nlrp6 E4 reverse 5’- ACGTGCTCGCGGTACTTCTT-3’ IDT N/A Elavl4 forward 5’-GAT CAGGGATGCTAACCTGTATG-3’ IDT N/A Elavl4 reverse 5’- GGTGATGATGCGACCGTATT -3’ IDT N/A Recombinant DNA AAV9-hSyn-eGFP-WPRE-bGH Addgene #105539-AAV9 AAV9-hSyn-HI-eGFP-Cre-WPRE-SV40 Addgene #105540-AAV9 Software and Algorithms GraphPad Prism version 8 for MacOS Graphpad Software Inc. https://www.graphpad.com RStudio RStudio® https://www.rstudio.com DEseq2 Bioconstructor https://bioconductor.org/packages/release/bioc/html/DESeq2.html Imaris (v. 8.4) Bitplane Fiji ImageJ https://imagej.net/Welcome Microsoft Excel for MacOS Microsoft https://products.office.com/en-us/excel Other Salmonella Shigella Agar (SS Agar) BD Cat# 211597 Luria’s Broth base (LB) Thermo-Fisher Scientific Cat# 12795027 O.C.T.

Techniques: Software, Staining, Recombinant, Saline, DNA Extraction, RNAscope, Binding Assay, Enzyme-linked Immunosorbent Assay, Isolation, Generated, RNA Sequencing, Gene Expression

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: Neurodegeneration Enhances the Development of Arthritis.

doi: 10.4049/jimmunol.1601472

Figure Lengend Snippet: FIGURE 2. Tau-related neurodegeneration induces immune activation and a proinflammatory state. Flow cytometric analyses of isolated spleen, blood, and brain cells from untreated (control) and arthritic (CIA) tau-tg mice and wt littermates at day 50 after induction of CIA. (A) Percentage of splenic CCR2-expressing leukocytes (CD45+CCR2+), inflammatory monocytes (CD45+Ly6ChiCD11b+), granulocytes (CD45+Ly6CintCD11b+), and plasmablasts (CD45+B220lowCD138+) and mean fluorescence intensity (MFI) of Ly6C-expressing inflammatory monocytes and granulocytes. (B) Representative dot plots for splenic inflammatory monocytes (black) and granulocytes (blue), (C) representative dot blots for plasmablasts. (D) Per- centage of blood CCR2-expressing leukocytes (CD45+CCR2+), inflammatory monocytes (CD45+Ly6ChiCD11b+), granulocytes (CD45+Ly6CintCD11b+), and plasmablasts (CD45+B220lowCD138+) and MFI of Ly6C-expressing inflammatory monocytes and granulocytes. (E) Representative dot plots for splenic inflammatory monocytes (black), granulocytes (blue), (F) representative dot plots for plasmablasts. (G) Percentage of brain CD45hi leukocytes (forward scatter, CD45hi) and CCR2-expressing leukocytes (CD45hiCCR2+) and MFI of Ly6C-expressing leukocytes (CD45+Ly6C+). (H) Representative dot plots for brain CD45hi leukocytes. Pooled data from three independent experiments with n = 5–11 per experimental group. Data are mean 6 SEM. *p , 0.05, **p , 0.01, ***p , 0.001, Mann–Whitney U test.

Article Snippet: Flow cytometric analyses were performed using anti-mouse CD16/32 unconjugated clone 93 (rat) (dilution 1:200, cat. no. 101302, BioLegend), anti-mouse/human CD45R/B220 PE/Cy5 clone RA3-6B2 (rat) (dilution 1:2000, cat. no. 103210, BioLegend), anti-mouse CD45 Pacific Blue clone 30-F11 (rat) (dilution 1:1000, cat. no. 103126, BioLegend), anti-mouse CD138 PE/Cy7 clone 281-2 (rat) (dilution 1:1000, cat. no. 142514, BioLegend), anti-mouse Ly-6G/Ly-6C (Gr-1) PE clone RB6-8C5 (rat) (dilution 1:2000, cat. no. 108408, BioLegend), anti-mouse Ly-6C PE/Cy7 clone HK1.4 (rat) (dilution 1:3000, cat. no. 128017, BioLegend), antimouse CD45 allophycocyanin clone 30-F11 (rat) (dilution 1:500, cat. no. 17-0451-82, eBioscience), anti-mouse CD11b PerCP-Cyanine5.5 clone M1/70 (cat. no. 45-0112-82, eBioscience), and anti-mouse CCR2 DyLight 488 polyclonal (rabbit) (cat. no. NBP1-48338G, Novus).

Techniques: Activation Assay, Isolation, Control, Expressing, MANN-WHITNEY

Journal: JCI Insight

Article Title: A prometabolite strategy inhibits cardiometabolic disease in an ApoE –/– murine model of atherosclerosis

doi: 10.1172/jci.insight.191090

Figure Lengend Snippet: ( A ) Schema of female ApoE –/– mice on an HFD with 150 mM SerBut or NaBut on a butyrate basis, or water ad libitum for 6 weeks. ( B ) Oil Red O (ORO) staining of aortic root plaque. ( C ) CD68 + IHC staining of aortic root plaque. Original magnification, ×20. ( D ) Representative images of immunofluorescent staining of aortic root. ( E ) Quantification of ORO + aortic root valve area. ( F ) Histological Stary scoring of plaque severity, ( G ) quantified CD68 + area, and ( H ) necrotic core of CD68 + IHC staining. ( I ) Quantified DAPI + , ( J ) DAPI + per plaque area, ( K ) iNOS + , and ( L ) iNOS + cells per plaque area in immunofluorescence stain. ( M – O ) Flow cytometry of immune cells infiltrating the aorta: ( M ) CD45 + total leukocytes, ( N ) CD11b + monocytes, and ( O ) CCR2 + CD11b + monocytes. ( P ) Water consumed by cages for the first 19 days of experiment. Data represent mean water consumed between 2 cages (replicates) as weight change of bottle converted to water volume. Error bars represent SD. ( Q ) Plasma IL-6 and ( R ) IFN-γ. ( S ) Blood flow cytometry of Ly6G + CD11b + circulating neutrophils. n = 5/cage and n = 10 mice per group. Data points represent individual mice displayed with median ± SEM. Statistical analyses were performed using a 1-way ANOVA with Tukey’s, Welch’s (if SDs were significantly different by Bartlett and Brown-Forsyth tests), or Kruskal-Wallis (if data were not normally distributed determined by Shapiro-Wilk test) post hoc test. P values less than 0.10 are shown. Outliers were removed by ROUT testing at Q = 1% in I – L . Scoring in C was done blinded. Data in C and F – H represent 2 independent pooled experiments: n = 10 for water and SerBut groups and n = 10 for NaBut groups in a single experiment. “B6,NC” denotes age-matched C57BL/6 mice on normal diet as non-statistical comparison to visualize healthy examples. Scale bars: 200 μm.

Article Snippet: In this study, antibodies used included those against CD16/CD32 (BioLegend, clone 93, catalog 101302), CCR2 (PE; R&D Systems, catalog FAB5538P), CD11b (BV605; BioLegend, clone M1/70, catalog 101257), CD11c (PE-Cy7; BD Biosciences, clone HL3, catalog 558079, BD Biosciences), CD19 (APC; BioLegend, clone 1D3, catalog 152412), CD3e (BUV395; clone 145-2C11, catalog 563565), CD45 (BV786; BD Biosciences, clone 30-F11, catalog 564225), F4/80 (BUV496; BD Biosciences, clone T45-2342, catalog 750644), I-A/I-E (PerCP-Cy5.5; BioLegend, clone M5/114.15.2, catalog 107626), Ly-6C (APC-Cy7; BioLegend, clone HK1.4, catalog 128026), and Ly-6G (FITC; eBioscience, clone 1AB, catalog 11-9668-80).

Techniques: Staining, Immunohistochemistry, Immunofluorescence, Flow Cytometry, Clinical Proteomics, Comparison

Journal: Frontiers in Cellular and Infection Microbiology

Article Title: Long-Term Impact of Toxoplasma gondii Infection on Human Monocytes

doi: 10.3389/fcimb.2019.00235

Figure Lengend Snippet: Proportion of CD62L + , CD64 + , CCR2 + , HLA,A,B,C + or HLA,DR,DP,DQ + cells among peripheral blood monocytes from donors with or without chronic toxoplasmosis. Plastic-adherent PBMCs were isolated from blood samples and were fluorescently labeled using FITC-conjugated anti-CD14 or antibodies directed against the indicated surface markers or isotype control antibodies and PE-conjugated secondary antibodies. Blood donors were serologically classified as chronically T. gondii -infected or non-infected using plasma from the blood samples. (A) CD14 + monocytes (R1) were back-gated and identified (R2) among FSC/SSC-analyzed total cells. R2-gated cells were then analyzed for expression of cell surface markers as indicated, and positive cells were identified after specific (anti-CCR2 in (A) ; see for the other surface markers) and isotype control labeling. (B–F) Percentages of monocytes from T. gondii seropositive or seronegative individuals positive for cell surface markers as indicated. Solid and dashed lines in the box-whisker plots indicate median and mean values, respectively; circles indicate individual data points. Data are from 5 T. gondii seropositive and 16 seronegative blood donors; outlyers were excluded. * p < 0.05 (Student's t -test).

Article Snippet: Alternatively, they were labeled with 2 μg/mL of mouse monoclonal antibodies directed against human CD62L (clone DREG-56), human CD64 (clone 10.01.13), human HLA-A,B,C (clone G46-2.6), human HLA-DR,DP,DQ (clone Tu39; all antibodies from BD Biosciences), or directed against human CCR2 (R&D Systems, Wiesbaden-Nordenstadt, Germany), or they were incubated with appropriate isotype control antibodies (clones MOPC-21, 27-35 and G155-178; BD Biosciences) for 30 min at 4°C.

Techniques: Isolation, Labeling, Control, Infection, Clinical Proteomics, Expressing, Whisker Assay

Journal: Frontiers in Cellular and Infection Microbiology

Article Title: Long-Term Impact of Toxoplasma gondii Infection on Human Monocytes

doi: 10.3389/fcimb.2019.00235

Figure Lengend Snippet: Expression of cell surface receptors on monocytes from individuals with chronic toxoplasmosis and non-infected controls.

Article Snippet: Alternatively, they were labeled with 2 μg/mL of mouse monoclonal antibodies directed against human CD62L (clone DREG-56), human CD64 (clone 10.01.13), human HLA-A,B,C (clone G46-2.6), human HLA-DR,DP,DQ (clone Tu39; all antibodies from BD Biosciences), or directed against human CCR2 (R&D Systems, Wiesbaden-Nordenstadt, Germany), or they were incubated with appropriate isotype control antibodies (clones MOPC-21, 27-35 and G155-178; BD Biosciences) for 30 min at 4°C.

Techniques: Expressing

Journal: Frontiers in Cellular and Infection Microbiology

Article Title: Long-Term Impact of Toxoplasma gondii Infection on Human Monocytes

doi: 10.3389/fcimb.2019.00235

Figure Lengend Snippet: Impact of in vitro infection of monocyte-enriched PBMCs with T. gondii on expression of CD62L, CD64, CCR2, HLA-A,B,C, or HLA-DR,DP,DQ on monocytes from donors with or without chronic toxoplasmosis. Monocyte-enriched PBMCs were isolated from blood samples and were either directly FACS-analyzed (0 h) or were cultivated in vitro for 48 h and infected or not with T. gondii during the final 24 h as indicated and then FACS-analyzed. Expression of cell surface markers was determined for CD14-positive monocytes as outlined in . (A–E) Percentages of cells from T. gondii seropositive (gray bars) or seronegative (open bars) individuals with expression of surface markers above background staining. (F–J) Expression levels of surface markers as indicated on monocytes from T. gondii seropositive or seronegative blood donors. Data represent means ± S.E.M. from 5 T. gondii seropositive and from 13 out of 16 seronegative blood donors which had been randomly selected for in vitro infection assays; outlyers were excluded. Individual data points are also indicated. Significant differences between groups were identified by ANOVA [ *** p < 0.001; ** p < 0.01; * p < 0.05; a and b indicate dose-dependent increase or decrease, respectively, of HLA-DR,DP,DQ after parasite infection ( p < 0.01)].

Article Snippet: Alternatively, they were labeled with 2 μg/mL of mouse monoclonal antibodies directed against human CD62L (clone DREG-56), human CD64 (clone 10.01.13), human HLA-A,B,C (clone G46-2.6), human HLA-DR,DP,DQ (clone Tu39; all antibodies from BD Biosciences), or directed against human CCR2 (R&D Systems, Wiesbaden-Nordenstadt, Germany), or they were incubated with appropriate isotype control antibodies (clones MOPC-21, 27-35 and G155-178; BD Biosciences) for 30 min at 4°C.

Techniques: In Vitro, Infection, Expressing, Isolation, Staining

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: Cytokine-like 1 Chemoattracts Monocytes/Macrophages via CCR2.

doi: 10.4049/jimmunol.1501908

Figure Lengend Snippet: FIGURE 2. CYTL1 induces CCR2B internalization. (A) HEK293-CCR2B were treated with CCL2 (20 nM) or CYTL1 (10 or 50 nM) for 1 h. CCR2B internalization was analyzed by FACS using mouse anti-CCR2 Abs as primary Abs. (B) The average CCR2B internalization extent from three independent experiments is shown, and significant differences were calculated compared with the control. *p , 0.05, **p , 0.01, ***p , 0.001. (C) HEK293 cells overexpressing CCR2B-EGFP were treated with CCL2 (20 nM) or CYTL1 (10 or 50 nM) for 1 h. Cells were fixed and observed by confocal microscopy. Scale bars, 25 mm. All of the results above were representative of at least three independent experiments. (D) Human monocytes were treated with CCL2 (20 nM) or CYTL1 (10, 50, or 500 nM) for 15 min. CCR2B internalization was analyzed by FACS using mouse anti-CCR2 Abs as primary Abs. (E) The average CCR2B internalization extent from three independent experiments is shown, and significant differences were calculated compared with the control. *p , 0.05, **p , 0.01, ***p , 0.001.

Article Snippet: Mouse anti-CCR2 Abs were obtained from R&D Systems (Minneapolis, MN).

Techniques: Control, Confocal Microscopy

Journal: Molecular Cancer

Article Title: A MCP1 fusokine with CCR2-specific tumoricidal activity

doi: 10.1186/1476-4598-10-121

Figure Lengend Snippet: Phenotype analysis . A . The amino acid sequence of GMME1. B . GMME1 Mechanism of Action. GMME1 is capable of blocking CCR2 homodimerization and recruitment of β-arrestin. As a result, various biochemical responses take place such as an increase in p38 phosphorylation while p44/42, AKT, STAT3 are inhibited. In addition, a strong Ca 2+ influx s triggered leading to the activation of caspase 3 and apoptosis. C . The phenotype of expanded C57BL/6 MSCs was analyzed by flow cytometry for various cell surface markers. D . An RT-PCR analysis demonstrates that MSC do not express CCR2. E . MSC culture under adipogenic or osteogenic conditions leads to their differentiation. Photographs were taken under light microscopy using a Contax167MT camera (Kyocera) with a 400 ISO film attached to an Axiovert25 Zeiss microscope (Carl Zeiss) F . Following the retroviral transduction of MSC, the GFP expression levels was monitored by flow cytometry with GMME1 secretion level at 33 ng/10 6 cell/24 hrs as detected by ELISA (P < 0.05; n = 3/group).

Article Snippet: Mouse recombinant CCL2 protein (CCL2 1-76), ELISA kits for mouse CCL2 and human IL6, anti-human CCR2 antibody, CCR2 primers, and Annexin-V/PI detection kits were purchased from R&D systems (Minneapolis, USA).

Techniques: Sequencing, Blocking Assay, Phospho-proteomics, Activation Assay, Flow Cytometry, Reverse Transcription Polymerase Chain Reaction, Light Microscopy, Microscopy, Retroviral, Transduction, Expressing, Enzyme-linked Immunosorbent Assay

Journal: Molecular Cancer

Article Title: A MCP1 fusokine with CCR2-specific tumoricidal activity

doi: 10.1186/1476-4598-10-121

Figure Lengend Snippet: Pharmacological properties of GMME1 on EG7 tumor cells . A . Following the confirmation that EG7 cells express CCR2 by RT-PCR, 10 5 EG7 cells/well were cultured for 48 hrs in presence of increasing amounts of CCL2 5-76, CCL2 1-76 or GMME1 and the proliferative response measured by MTT. CCL2 5-76, and to a lesser extent, CCL2 1-76 were capable of inducing the proliferation of EG7 cells as opposed to GMME1 (P < 0.05; n = 6/group). B . Following the addition of 1.5 pmol of GMME1 on EG7 cells for 48 hrs (lower panel), a PI/Annexin-V co-staining demonstrates that GMME1 leads to apoptosis induction (32% dead cells). None of the B16 cells, which are CCR2 null, were affected by the addition of GMME1. C . EG7 cells cultured with GMME1 for 48 hrs induce de novo expression of the pro-apoptotic BAX protein. D . Following the stimulation of EG7 cells for different time points, cell lysate was analysis by a pSTAT3 ELISA (P < 0.05; n = 6/group). The experiments were repeated using the 5 min time point, then lysate was probed by WB. Total STAT3 was used as loading control. E . WT or CCR2 -/- monocytes were purified and cultured with 1.5 pmol of GMME1 for 48 hrs before a PI/Annexin-V co-staining. Even though 58% of WT monocytes died, no major cell death was detected with CCR2 -/- monocytes.

Article Snippet: Mouse recombinant CCL2 protein (CCL2 1-76), ELISA kits for mouse CCL2 and human IL6, anti-human CCR2 antibody, CCR2 primers, and Annexin-V/PI detection kits were purchased from R&D systems (Minneapolis, USA).

Techniques: Reverse Transcription Polymerase Chain Reaction, Cell Culture, Staining, Expressing, Enzyme-linked Immunosorbent Assay, Control, Purification

Journal: Molecular Cancer

Article Title: A MCP1 fusokine with CCR2-specific tumoricidal activity

doi: 10.1186/1476-4598-10-121

Figure Lengend Snippet: Pharmacological properties of GMME1 on human U266 tumor cells . A . U266 cells were analyzed by flow cytometry and were negative for the expression of CD19 while CD138 and CCR2 were detected. B . 10 5 U266 cells were cultured with increasing amounts of CCL2 5-76, CCL2 1-76 or GMME1 and the proliferative response measured by MTT. CCL2 5-76 was capable of inducing U266 proliferation whereas GMME1 completely suppressed the proliferative response (P < 0.05; n = 6/group). C . Using 1.5 pmol of GMME1 on U266 cells for 48 hrs, a PI/Annexin-V co-staining demonstrates that GMME1 leads to apoptosis (42% cell death). D . A similar set-up was used for the assessment of STAT3 activation on U266 cells. Following the stimulation of U266 cells using different time points, cell lysate was analysis by a pSTAT3 ELISA. Since STAT3 is inhibited as of 10 min following GMME1 addition on U266 cells, the experiment was repeated at this time point then the lysate was probed by WB. Total STAT3 was used as loading control. To further confirm the inhibitory effect of GMME1 on these cells, the U266 conditioned-media was collected following 48 hrs post-treatment with the different test conditions and analyzed using a human IL-6 ELISA kit. No detectable levels of human IL6 could be observed in the GMME1 group as opposed to the remaining test conditions (*P < 0.05; n = 6/group).

Article Snippet: Mouse recombinant CCL2 protein (CCL2 1-76), ELISA kits for mouse CCL2 and human IL6, anti-human CCR2 antibody, CCR2 primers, and Annexin-V/PI detection kits were purchased from R&D systems (Minneapolis, USA).

Techniques: Flow Cytometry, Expressing, Cell Culture, Staining, Activation Assay, Enzyme-linked Immunosorbent Assay, Control

Journal: Molecular Cancer

Article Title: A MCP1 fusokine with CCR2-specific tumoricidal activity

doi: 10.1186/1476-4598-10-121

Figure Lengend Snippet: Pharmacological properties of GMME1 on CCR2 + medulloblastoma cells . A . Confirmation of CCR2 expression on mouse medulloblastoma cell line PS125. B . PS125 cells were seeded in 6-well plates (10 4 cells/well) and cultured with CCL2 -/- or GMME1 CM. After 48 hrs, apoptosis was measured by Annexin-V/PI staining. C . To further see a dose-response effect, the same experiment was repeated using 3 different concentrations and cell death was analyzed (P < 0.05; n = 3/group). D . Human medulloblastoma cells (Daoy) were analyzed by WB to confirm the presence of CCR2 on cell surface. E . Human medulloblastoma cells were treated with GMME1 as described in B . Cell apoptosis was measured by Annexin-V/PI staining after 48 hrs culture. F . Human medulloblastoma cells were cultured in presence of GMME1 in condition medium or affinity-purified GMME1 protein. Cell growth was measured by MTT assay. (*P < 0.05; **P < 0.01; n = 3/group).

Article Snippet: Mouse recombinant CCL2 protein (CCL2 1-76), ELISA kits for mouse CCL2 and human IL6, anti-human CCR2 antibody, CCR2 primers, and Annexin-V/PI detection kits were purchased from R&D systems (Minneapolis, USA).

Techniques: Expressing, Cell Culture, Staining, Affinity Purification, MTT Assay

Journal: Molecular Cancer

Article Title: A MCP1 fusokine with CCR2-specific tumoricidal activity

doi: 10.1186/1476-4598-10-121

Figure Lengend Snippet: GMME1 induced apoptosis of primary myeloma cells from patients . A . White blood cells were isolated from bone marrow aspirates from patients with myeloma, and stained with anti-human CD38, CD45 and CD138 antibodies. CD38 + CD45 - CD138 + cells were considered as myeloma cells. B-C . CCR2 highly expressed on myeloma cells (black field is antibody isotype control). D-E . Isolated lymphocytes were cultured in absence ( D ) or presence ( E ) of GMME1, and the apoptotic myeloma cells were determined by annexin staining ( D and E ). F . Percentage of apoptotic myeloma cells from patients was presented as the mean+/-SD (*P < 0.05; n = 5).

Article Snippet: Mouse recombinant CCL2 protein (CCL2 1-76), ELISA kits for mouse CCL2 and human IL6, anti-human CCR2 antibody, CCR2 primers, and Annexin-V/PI detection kits were purchased from R&D systems (Minneapolis, USA).

Techniques: Isolation, Staining, Control, Cell Culture