Journal: Journal of Nanobiotechnology

Article Title: Therapies with CCL25 require controlled release via microparticles to avoid strong inflammatory reactions

doi: 10.1186/s12951-021-00830-7

Figure Lengend Snippet: Characteristic features of PLGA particles. PLGA particles were analyzed morphologically with SEM, evaluated for endotoxin contamination with the Limulus amebocyte lysate (LAL) test, and functionally assessed by their CCL25 release profile. Representative SEM images of the PLGA particles generated are shown in a i,ii with × 40 and 200 magnification at day one, iii, iv with × 40/ × 200 magnification after 14 days of degradation, v, vi with × 40/ × 200 magnification after 28 days of degradation and vii, viii with × 1000 magnification after 63 days of degradation. Scale bars represent 500 and 100 µm, respectively. b The results of the LAL test for the detection of endotoxins are shown for different stock solutions of CCL25 (10 and 500 nM) and the supernatant from PLGA particles (CL supernatant) compared to the test standards (0.1–10 nM). c The cumulative release in percent ± SD of CCL25 from PLGA particles over time until day 63 ( n = 3) was determined by ELISA. CL CCL25-loaded, PLGA Poly (lactic-co-glycolic acid)

Article Snippet: The amount of CCL25 released from the PLGA microparticles was measured using the human CCL25/TECK DuoSet® Enzyme linked immunosorbent assay (ELISA) kit (R&D Systems, Minneapolis, USA).

Techniques: Generated, Enzyme-linked Immunosorbent Assay

Journal: Frontiers in Immunology

Article Title: ACKR4 Recruits GRK3 Prior to β-Arrestins but Can Scavenge Chemokines in the Absence of β-Arrestins

doi: 10.3389/fimmu.2020.00720

Figure Lengend Snippet: General plasmids and primers.

Article Snippet: pSUMO hCCL25 , hCCL25 RC222128 (Origene) , GACTAGGTCTCCGGTGGGCAAGGTGTCTTTGAGGAC , GTGCTCGAGTTACAGTCCTGAATTAGCTGATATCAGGAGGG , -.

Techniques: Synthesized, Amplification, Plasmid Preparation

Journal: medRxiv

Article Title: CC- chemokine ligand 25 mediates inflammatory crosstalk between adipose and liver in non-alcoholic fatty liver disease

doi: 10.1101/2021.07.26.21261056

Figure Lengend Snippet: A serum concentration of CCL25 measured by ELISA showed a positive correlation with BMI (Pearson r 2 0.500, p<0.001). B measurement of protein levels of CCL25 measured by immunohistochemical staining showed an increase in CCL25 levels in obesity (* p<0.05 by one-way ANOVA). C Gene expression of CCL25 in adipose and liver tissue measured by rt-PCR showed greater expression in adipose tissue. D Protein levels of CCL25 were comparable between adipose and liver tissue.

Article Snippet: An ELISA kit from Cusabio (catalogue number CSB-E09189h) was used to measure concentration of CCL25 in protein lysates from whole adipose or liver tissue.

Techniques: Concentration Assay, Enzyme-linked Immunosorbent Assay, Immunohistochemical staining, Staining, Expressing, Reverse Transcription Polymerase Chain Reaction

Journal: medRxiv

Article Title: CC- chemokine ligand 25 mediates inflammatory crosstalk between adipose and liver in non-alcoholic fatty liver disease

doi: 10.1101/2021.07.26.21261056

Figure Lengend Snippet: A serum concentration of CCL25 measured by ELISA in lean and obese individuals **** p<0.001 by Mann Whitney test B lymphocyte trafficking in response to pre-treatment of hepatic endothelial cells with recombinant CCL25 ****p<0.001 by two-way ANOVA

Article Snippet: An ELISA kit from Cusabio (catalogue number CSB-E09189h) was used to measure concentration of CCL25 in protein lysates from whole adipose or liver tissue.

Techniques: Concentration Assay, Enzyme-linked Immunosorbent Assay, MANN-WHITNEY, Recombinant

Journal: medRxiv

Article Title: CC- chemokine ligand 25 mediates inflammatory crosstalk between adipose and liver in non-alcoholic fatty liver disease

doi: 10.1101/2021.07.26.21261056

Figure Lengend Snippet: A adherence of leukocytes to HSEC after pre-treatment with CCL25 (* one-way ANOVA p<0.05) B Total CCR9 + cells isolated from normal and NAFLD liver tissue (** student’s t-test p<0.01). C CCR9 expression on leukocyte subsets from normal and NAFLD liver tissue D CCR9 expression on liver-infiltrating monocytes in normal and NAFLD liver tissue

Article Snippet: An ELISA kit from Cusabio (catalogue number CSB-E09189h) was used to measure concentration of CCL25 in protein lysates from whole adipose or liver tissue.

Techniques: Isolation, Expressing

Journal: Frontiers in Immunology

Article Title: Rexinoids Modulate Effector T Cell Expression of Mucosal Homing Markers CCR9 and α4β7 Integrin and Direct Their Migration In Vitro

doi: 10.3389/fimmu.2022.746484

Figure Lengend Snippet:

Article Snippet: Recombinant mouse CCL25/TECK protein (R&D Systems) was reconstituted to 10 μg/mL in 1X PBS (GenClone) containing 0.1% FBS, resuspended in 235 μL chemotaxis buffer at a concentration of 250nM, and plated into the lower chamber.

Techniques: Modification, Ligand Binding Assay, Virus, Immunopeptidomics