cchfv Search Results


93
Addgene inc katrin rittinger
Katrin Rittinger, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/katrin rittinger/product/Addgene inc
Average 93 stars, based on 1 article reviews
katrin rittinger - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

90
TIB MOLBIOL cchfv s segment specific primers cchfsfw–tggacttgtggacaccttcac, cchfsre–caatgccagtggagctaacc
Cchfv S Segment Specific Primers Cchfsfw–Tggacttgtggacaccttcac, Cchfsre–Caatgccagtggagctaacc, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cchfv s segment specific primers cchfsfw–tggacttgtggacaccttcac, cchfsre–caatgccagtggagctaacc/product/TIB MOLBIOL
Average 90 stars, based on 1 article reviews
cchfv s segment specific primers cchfsfw–tggacttgtggacaccttcac, cchfsre–caatgccagtggagctaacc - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
IBT Bioservices cchfv anti-np
Cchfv Anti Np, supplied by IBT Bioservices, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cchfv anti-np/product/IBT Bioservices
Average 90 stars, based on 1 article reviews
cchfv anti-np - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
IBT Bioservices α-cchfv np (ibt bioservices #04-0011) antibody
α Cchfv Np (Ibt Bioservices #04 0011) Antibody, supplied by IBT Bioservices, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/α-cchfv np (ibt bioservices #04-0011) antibody/product/IBT Bioservices
Average 90 stars, based on 1 article reviews
α-cchfv np (ibt bioservices #04-0011) antibody - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
BEI Resources anti-g c 11e7 nr-40277
Anti G C 11e7 Nr 40277, supplied by BEI Resources, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti-g c 11e7 nr-40277/product/BEI Resources
Average 90 stars, based on 1 article reviews
anti-g c 11e7 nr-40277 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
AmpliSens Biotechnologies ® hcv-fl kit
Age-specific detection rates of <t>anti-HCV</t> and <t>HCV</t> <t>RNA</t> among indigenous populations of the Arctic zone of Yakutia. The 95% CI values are shown with vertical bars. Significant differences between the age cohorts are highlighted in colored brackets with the p -value indicated below (Fisher’s exact test).
® Hcv Fl Kit, supplied by AmpliSens Biotechnologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/® hcv-fl kit/product/AmpliSens Biotechnologies
Average 90 stars, based on 1 article reviews
® hcv-fl kit - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
EUROIMMUN cchfv-igg-ifa from euroimmun
Validation results of the indirect in-house <t> CCHFV-IgG-ELISA </t>
Cchfv Igg Ifa From Euroimmun, supplied by EUROIMMUN, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cchfv-igg-ifa from euroimmun/product/EUROIMMUN
Average 90 stars, based on 1 article reviews
cchfv-igg-ifa from euroimmun - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
IBT Bioservices α-cchfv np #04-0011 antibody
a. Schematic representation of the large (L), medium (M), and small (S) genome segments (antigenomic sense) of Crimean-Congo hemorrhagic fever virus <t>(CCHFV).</t> Arrows represent the viral protein coding sequences for RNA-dependent RNA polymerase (RdRp), glycoprotein precursor (GPC), and nucleoprotein (NP). CCHFV strain IbAr10200 S segment was modified by inserting the ZsGreen1 (ZsG) protein coding sequence fused to the P2A sequence (amino acid sequence shown) upstream of the NP coding region (rS). b. Western blot analysis of viral protein expression in Huh7 cells infected with CCHFV/ZsG at MOI 1. Cell lysates were harvested 72 h post infection (hpi) to determine cellular expression levels of NP and ZsG, using tubulin as a loading control. c. Cellular localization of virally expressed proteins. Huh7 cells were infected with either CCHFV or CCHFV/ZsG at MOI 1, and imaged 48 hpi. CCHFV NP was detected using immunofluorescence, and ZsG fluorescence was imaged using standard fluorescent microscopy. d. Viral growth curves in Huh7, SW13, and HAP1 cells infected with either CCHFV or CCHFV/ZsG at MOI 0.1. Titers (TCID50) were determined at 24, 48, and 72 hpi, with ZsG fluorescence determined concurrently at the same time points (RLU, relative light units). Representative fluorescent microscopy images of CCHFV/ZsG-infected cell monolayers at 72 hpi are presented.
α Cchfv Np #04 0011 Antibody, supplied by IBT Bioservices, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/α-cchfv np #04-0011 antibody/product/IBT Bioservices
Average 90 stars, based on 1 article reviews
α-cchfv np #04-0011 antibody - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation full-length s segment encoding the np gene from four crimean-congo hemorrhagic fever virus (cchfv) genotypes
a. Schematic representation of the large (L), medium (M), and small (S) genome segments (antigenomic sense) of Crimean-Congo hemorrhagic fever virus <t>(CCHFV).</t> Arrows represent the viral protein coding sequences for RNA-dependent RNA polymerase (RdRp), glycoprotein precursor (GPC), and nucleoprotein (NP). CCHFV strain IbAr10200 S segment was modified by inserting the ZsGreen1 (ZsG) protein coding sequence fused to the P2A sequence (amino acid sequence shown) upstream of the NP coding region (rS). b. Western blot analysis of viral protein expression in Huh7 cells infected with CCHFV/ZsG at MOI 1. Cell lysates were harvested 72 h post infection (hpi) to determine cellular expression levels of NP and ZsG, using tubulin as a loading control. c. Cellular localization of virally expressed proteins. Huh7 cells were infected with either CCHFV or CCHFV/ZsG at MOI 1, and imaged 48 hpi. CCHFV NP was detected using immunofluorescence, and ZsG fluorescence was imaged using standard fluorescent microscopy. d. Viral growth curves in Huh7, SW13, and HAP1 cells infected with either CCHFV or CCHFV/ZsG at MOI 0.1. Titers (TCID50) were determined at 24, 48, and 72 hpi, with ZsG fluorescence determined concurrently at the same time points (RLU, relative light units). Representative fluorescent microscopy images of CCHFV/ZsG-infected cell monolayers at 72 hpi are presented.
Full Length S Segment Encoding The Np Gene From Four Crimean Congo Hemorrhagic Fever Virus (Cchfv) Genotypes, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/full-length s segment encoding the np gene from four crimean-congo hemorrhagic fever virus (cchfv) genotypes/product/GenScript corporation
Average 90 stars, based on 1 article reviews
full-length s segment encoding the np gene from four crimean-congo hemorrhagic fever virus (cchfv) genotypes - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
EUROIMMUN igg cchfv iifa kits
Number of tested samples for <t> CCHFV </t> and <t> RVFV </t> antibody detection.
Igg Cchfv Iifa Kits, supplied by EUROIMMUN, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/igg cchfv iifa kits/product/EUROIMMUN
Average 90 stars, based on 1 article reviews
igg cchfv iifa kits - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation gene fragment encoding residues 1 to 515 of cchfv strain ibar 10200 gpc
Number of tested samples for <t> CCHFV </t> and <t> RVFV </t> antibody detection.
Gene Fragment Encoding Residues 1 To 515 Of Cchfv Strain Ibar 10200 Gpc, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene fragment encoding residues 1 to 515 of cchfv strain ibar 10200 gpc/product/GenScript corporation
Average 90 stars, based on 1 article reviews
gene fragment encoding residues 1 to 515 of cchfv strain ibar 10200 gpc - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
VECTOR-BEST cchfv elisa
Number of tested samples for <t> CCHFV </t> and <t> RVFV </t> antibody detection.
Cchfv Elisa, supplied by VECTOR-BEST, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cchfv elisa/product/VECTOR-BEST
Average 90 stars, based on 1 article reviews
cchfv elisa - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


Age-specific detection rates of anti-HCV and HCV RNA among indigenous populations of the Arctic zone of Yakutia. The 95% CI values are shown with vertical bars. Significant differences between the age cohorts are highlighted in colored brackets with the p -value indicated below (Fisher’s exact test).

Journal: Microorganisms

Article Title: Epidemiology of Viral Hepatitis in the Indigenous Populations of the Arctic Zone of the Republic of Sakha (Yakutia)

doi: 10.3390/microorganisms12030464

Figure Lengend Snippet: Age-specific detection rates of anti-HCV and HCV RNA among indigenous populations of the Arctic zone of Yakutia. The 95% CI values are shown with vertical bars. Significant differences between the age cohorts are highlighted in colored brackets with the p -value indicated below (Fisher’s exact test).

Article Snippet: All anti-HCV reactive samples were tested for HCV RNA using an AmpliSens ® HCV-FL kit (AmpliSense, Moscow, Russia).

Techniques:

Validation results of the indirect in-house  CCHFV-IgG-ELISA

Journal: The American Journal of Tropical Medicine and Hygiene

Article Title: Serosurvey of Crimean–Congo Hemorrhagic Fever Virus in Cattle, Mali, West Africa

doi: 10.4269/ajtmh.16-0818

Figure Lengend Snippet: Validation results of the indirect in-house CCHFV-IgG-ELISA

Article Snippet: The CCHFV-IgG-ELISA from Vector Best and the CCHFV-IgG-IFA from Euroimmun are commercially available kits for the detection of CCHFV-specific antibodies in human serum samples.

Techniques: Biomarker Discovery

a. Schematic representation of the large (L), medium (M), and small (S) genome segments (antigenomic sense) of Crimean-Congo hemorrhagic fever virus (CCHFV). Arrows represent the viral protein coding sequences for RNA-dependent RNA polymerase (RdRp), glycoprotein precursor (GPC), and nucleoprotein (NP). CCHFV strain IbAr10200 S segment was modified by inserting the ZsGreen1 (ZsG) protein coding sequence fused to the P2A sequence (amino acid sequence shown) upstream of the NP coding region (rS). b. Western blot analysis of viral protein expression in Huh7 cells infected with CCHFV/ZsG at MOI 1. Cell lysates were harvested 72 h post infection (hpi) to determine cellular expression levels of NP and ZsG, using tubulin as a loading control. c. Cellular localization of virally expressed proteins. Huh7 cells were infected with either CCHFV or CCHFV/ZsG at MOI 1, and imaged 48 hpi. CCHFV NP was detected using immunofluorescence, and ZsG fluorescence was imaged using standard fluorescent microscopy. d. Viral growth curves in Huh7, SW13, and HAP1 cells infected with either CCHFV or CCHFV/ZsG at MOI 0.1. Titers (TCID50) were determined at 24, 48, and 72 hpi, with ZsG fluorescence determined concurrently at the same time points (RLU, relative light units). Representative fluorescent microscopy images of CCHFV/ZsG-infected cell monolayers at 72 hpi are presented.

Journal: Antiviral research

Article Title: Identification of 2′-deoxy-2′-fluorocytidine as a potent inhibitor of Crimean-Congo hemorrhagic fever virus replication using a recombinant fluorescent reporter virus

doi: 10.1016/j.antiviral.2017.10.008

Figure Lengend Snippet: a. Schematic representation of the large (L), medium (M), and small (S) genome segments (antigenomic sense) of Crimean-Congo hemorrhagic fever virus (CCHFV). Arrows represent the viral protein coding sequences for RNA-dependent RNA polymerase (RdRp), glycoprotein precursor (GPC), and nucleoprotein (NP). CCHFV strain IbAr10200 S segment was modified by inserting the ZsGreen1 (ZsG) protein coding sequence fused to the P2A sequence (amino acid sequence shown) upstream of the NP coding region (rS). b. Western blot analysis of viral protein expression in Huh7 cells infected with CCHFV/ZsG at MOI 1. Cell lysates were harvested 72 h post infection (hpi) to determine cellular expression levels of NP and ZsG, using tubulin as a loading control. c. Cellular localization of virally expressed proteins. Huh7 cells were infected with either CCHFV or CCHFV/ZsG at MOI 1, and imaged 48 hpi. CCHFV NP was detected using immunofluorescence, and ZsG fluorescence was imaged using standard fluorescent microscopy. d. Viral growth curves in Huh7, SW13, and HAP1 cells infected with either CCHFV or CCHFV/ZsG at MOI 0.1. Titers (TCID50) were determined at 24, 48, and 72 hpi, with ZsG fluorescence determined concurrently at the same time points (RLU, relative light units). Representative fluorescent microscopy images of CCHFV/ZsG-infected cell monolayers at 72 hpi are presented.

Article Snippet: Primary antibodies used were: α-CCHFV NP (IBT Bioservices, #04-0011), α-ZsGreen1 (Clonetech, #632598), and anti-α-tubulin (Sigma-Aldrich, #T5168).

Techniques: Virus, Modification, Sequencing, Western Blot, Expressing, Infection, Control, Immunofluorescence, Fluorescence, Microscopy

a. Dose-response curves in Huh7 or SW13 cells treated with a 2-fold serial dilution of ribavirin before infection with CCHFV/ZsG at MOI 0.1. At 72 h post treatment, the reduction in ZsG fluorescence (green) was determined, and all values were normalized to those in mock-treated (DMSO only) cells. Cell viability was determined concurrently using the same serial-fold dilution of compound, with ATP content (blue) normalized to content in mock-treated cells. Each point represents the mean of quadruplicate wells, with error bars indicating standard deviation. Graphs are representative of 3 independent experiments. b. Representative concentration-response curves in Huh7 cells infected with CCHFV/ZsG and treated with T-705, 2′-deoxy-2′-fluorocytidine (2′-dFC), mycophenolic acid, or mycophenolate mofetil. Each point represents the mean of quadruplicate wells, with error bars indicating standard deviation. Graphs are representative of 3 independent experiments. c. Confirmatory counter-screen titer reduction assays were performed using wild-type CCHFV. Huh7 cells were treated with 4 dilutions of each compound centered around their calculated EC50 value 1 h prior to infection with CCHFV at MOI 0.1. At 48 hpi, virus-containing supernatants were harvested, and viral titers were determined by TCID50. Each point represents the mean of triplicate wells, with error bars indicating standard deviation. Dotted line represents the limit of detection for this assay (1.89 × 101 TCID50/mL). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Journal: Antiviral research

Article Title: Identification of 2′-deoxy-2′-fluorocytidine as a potent inhibitor of Crimean-Congo hemorrhagic fever virus replication using a recombinant fluorescent reporter virus

doi: 10.1016/j.antiviral.2017.10.008

Figure Lengend Snippet: a. Dose-response curves in Huh7 or SW13 cells treated with a 2-fold serial dilution of ribavirin before infection with CCHFV/ZsG at MOI 0.1. At 72 h post treatment, the reduction in ZsG fluorescence (green) was determined, and all values were normalized to those in mock-treated (DMSO only) cells. Cell viability was determined concurrently using the same serial-fold dilution of compound, with ATP content (blue) normalized to content in mock-treated cells. Each point represents the mean of quadruplicate wells, with error bars indicating standard deviation. Graphs are representative of 3 independent experiments. b. Representative concentration-response curves in Huh7 cells infected with CCHFV/ZsG and treated with T-705, 2′-deoxy-2′-fluorocytidine (2′-dFC), mycophenolic acid, or mycophenolate mofetil. Each point represents the mean of quadruplicate wells, with error bars indicating standard deviation. Graphs are representative of 3 independent experiments. c. Confirmatory counter-screen titer reduction assays were performed using wild-type CCHFV. Huh7 cells were treated with 4 dilutions of each compound centered around their calculated EC50 value 1 h prior to infection with CCHFV at MOI 0.1. At 48 hpi, virus-containing supernatants were harvested, and viral titers were determined by TCID50. Each point represents the mean of triplicate wells, with error bars indicating standard deviation. Dotted line represents the limit of detection for this assay (1.89 × 101 TCID50/mL). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Article Snippet: Primary antibodies used were: α-CCHFV NP (IBT Bioservices, #04-0011), α-ZsGreen1 (Clonetech, #632598), and anti-α-tubulin (Sigma-Aldrich, #T5168).

Techniques: Serial Dilution, Infection, Fluorescence, Standard Deviation, Concentration Assay, Virus

Compounds evaluated in the antiviral screening assay, showing the 50% effective concentrations (EC 50 ) and 50% cytotoxicity concentrations (CC 50 ) of each compound in Huh7 cells. All values are in μM; selectivity indices (SI) shown in parentheses. RdRp, RNA-dependent RNA polymerase; IMPDH, inosine monophosphate dehydrogenase.

Journal: Antiviral research

Article Title: Identification of 2′-deoxy-2′-fluorocytidine as a potent inhibitor of Crimean-Congo hemorrhagic fever virus replication using a recombinant fluorescent reporter virus

doi: 10.1016/j.antiviral.2017.10.008

Figure Lengend Snippet: Compounds evaluated in the antiviral screening assay, showing the 50% effective concentrations (EC 50 ) and 50% cytotoxicity concentrations (CC 50 ) of each compound in Huh7 cells. All values are in μM; selectivity indices (SI) shown in parentheses. RdRp, RNA-dependent RNA polymerase; IMPDH, inosine monophosphate dehydrogenase.

Article Snippet: Primary antibodies used were: α-CCHFV NP (IBT Bioservices, #04-0011), α-ZsGreen1 (Clonetech, #632598), and anti-α-tubulin (Sigma-Aldrich, #T5168).

Techniques: Screening Assay

Dose-response curve in SW13 cells treated with a 2-fold serial dilution of 2′-dFC before infection with CCHFV at MOI 0.1. At 48 hpi, cells were fixed and stained with anti-CCHFV polyclonal antibodies, CellMask Red, and Nuc-Blue to visualize viral proteins, cell cytoplasm, and cell nuclei, respectively. a. The percentage of infected cells at each concentration of compound was calculated by determining the proportion of cells expressing CCHFV proteins compared to total cell number (based on CellMask Red). b. Cell viability assessed by determining the number of Nuc-Blue-stained nuclei. c. Representative images at indicated 2′-dFC concentrations show the reduction in CCHFV protein production (green) in the absence of any cytotoxicity (Nuc-Blue-stained nuclei). CellMask Red staining was omitted from these images for clarity. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Journal: Antiviral research

Article Title: Identification of 2′-deoxy-2′-fluorocytidine as a potent inhibitor of Crimean-Congo hemorrhagic fever virus replication using a recombinant fluorescent reporter virus

doi: 10.1016/j.antiviral.2017.10.008

Figure Lengend Snippet: Dose-response curve in SW13 cells treated with a 2-fold serial dilution of 2′-dFC before infection with CCHFV at MOI 0.1. At 48 hpi, cells were fixed and stained with anti-CCHFV polyclonal antibodies, CellMask Red, and Nuc-Blue to visualize viral proteins, cell cytoplasm, and cell nuclei, respectively. a. The percentage of infected cells at each concentration of compound was calculated by determining the proportion of cells expressing CCHFV proteins compared to total cell number (based on CellMask Red). b. Cell viability assessed by determining the number of Nuc-Blue-stained nuclei. c. Representative images at indicated 2′-dFC concentrations show the reduction in CCHFV protein production (green) in the absence of any cytotoxicity (Nuc-Blue-stained nuclei). CellMask Red staining was omitted from these images for clarity. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Article Snippet: Primary antibodies used were: α-CCHFV NP (IBT Bioservices, #04-0011), α-ZsGreen1 (Clonetech, #632598), and anti-α-tubulin (Sigma-Aldrich, #T5168).

Techniques: Serial Dilution, Infection, Staining, Concentration Assay, Expressing

Huh7 cells were treated with a 6 × 6 compound combination matrix prior to infection with CCHFV/ZsG at MOI 0.1. At 72 h post treatment, the reduction in ZsG fluorescence was determined, and all values normalized to mock-treated (DMSO only) cells. The compound combinations evaluated were: a. T-705 with ribavirin; b. T-705 with 2′-dFC; and c. 2′-dFC with ribavirin. Dose-response surface curves were created for each combination (Bliss model), from which Bliss synergy and antagonism surface isograms were generated. Matrix tables indicate the maximum synergy value for each combination (% synergy effect observed over expected), with standard deviation indicated. Significance of synergy effect over expected results is indicated following a one-sample t-test (*p < 0.05; **p < 0.01, ***p < 0.001).

Journal: Antiviral research

Article Title: Identification of 2′-deoxy-2′-fluorocytidine as a potent inhibitor of Crimean-Congo hemorrhagic fever virus replication using a recombinant fluorescent reporter virus

doi: 10.1016/j.antiviral.2017.10.008

Figure Lengend Snippet: Huh7 cells were treated with a 6 × 6 compound combination matrix prior to infection with CCHFV/ZsG at MOI 0.1. At 72 h post treatment, the reduction in ZsG fluorescence was determined, and all values normalized to mock-treated (DMSO only) cells. The compound combinations evaluated were: a. T-705 with ribavirin; b. T-705 with 2′-dFC; and c. 2′-dFC with ribavirin. Dose-response surface curves were created for each combination (Bliss model), from which Bliss synergy and antagonism surface isograms were generated. Matrix tables indicate the maximum synergy value for each combination (% synergy effect observed over expected), with standard deviation indicated. Significance of synergy effect over expected results is indicated following a one-sample t-test (*p < 0.05; **p < 0.01, ***p < 0.001).

Article Snippet: Primary antibodies used were: α-CCHFV NP (IBT Bioservices, #04-0011), α-ZsGreen1 (Clonetech, #632598), and anti-α-tubulin (Sigma-Aldrich, #T5168).

Techniques: Infection, Fluorescence, Generated, Standard Deviation

a. Huh7 cells were treated with the indicated compounds either individually or in combination at the following concentrations: T-705, 2 μM; 2′-dFC, 200 nM; ribavirin, 10 μM. Cell were infected with wild-type CCHFV at MOI 0.1, and viral titers were determined at 48 hpi. Each point represents the mean of triplicate wells, with error bars indicating standard deviation. Dotted line represents the limit of detection for this assay (1.89 × 101 TCID50/mL). b. Cell viability (ATP content) was determined concurrently and normalized to ATP content in mock-treated (DMSO only) Huh7 cells.

Journal: Antiviral research

Article Title: Identification of 2′-deoxy-2′-fluorocytidine as a potent inhibitor of Crimean-Congo hemorrhagic fever virus replication using a recombinant fluorescent reporter virus

doi: 10.1016/j.antiviral.2017.10.008

Figure Lengend Snippet: a. Huh7 cells were treated with the indicated compounds either individually or in combination at the following concentrations: T-705, 2 μM; 2′-dFC, 200 nM; ribavirin, 10 μM. Cell were infected with wild-type CCHFV at MOI 0.1, and viral titers were determined at 48 hpi. Each point represents the mean of triplicate wells, with error bars indicating standard deviation. Dotted line represents the limit of detection for this assay (1.89 × 101 TCID50/mL). b. Cell viability (ATP content) was determined concurrently and normalized to ATP content in mock-treated (DMSO only) Huh7 cells.

Article Snippet: Primary antibodies used were: α-CCHFV NP (IBT Bioservices, #04-0011), α-ZsGreen1 (Clonetech, #632598), and anti-α-tubulin (Sigma-Aldrich, #T5168).

Techniques: Infection, Standard Deviation

Number of tested samples for  CCHFV  and  RVFV  antibody detection.

Journal: Pathogens

Article Title: First Serological Evidence of Crimean-Congo Hemorrhagic Fever Virus and Rift Valley Fever Virus in Ruminants in Tunisia

doi: 10.3390/pathogens10060769

Figure Lengend Snippet: Number of tested samples for CCHFV and RVFV antibody detection.

Article Snippet: All sera with positive or inconclusive results using IgG/IgM ELISA kits were analyzed by confirmatory modified commercial IgG CCHFV and RVFV IIFA kits (Euroimmun, Lübeck, Germany) according to the previously published protocol [ , , ].

Techniques:

Seroprevalence of  RVFV  and  CCHFV  in cattle, sheep and goats in the four bioclimatic zones.

Journal: Pathogens

Article Title: First Serological Evidence of Crimean-Congo Hemorrhagic Fever Virus and Rift Valley Fever Virus in Ruminants in Tunisia

doi: 10.3390/pathogens10060769

Figure Lengend Snippet: Seroprevalence of RVFV and CCHFV in cattle, sheep and goats in the four bioclimatic zones.

Article Snippet: All sera with positive or inconclusive results using IgG/IgM ELISA kits were analyzed by confirmatory modified commercial IgG CCHFV and RVFV IIFA kits (Euroimmun, Lübeck, Germany) according to the previously published protocol [ , , ].

Techniques: