Journal: Gene therapy

Article Title: Intercellular trafficking and enhanced in vivo antitumour activity of a non-virally delivered P27-VP22 fusion protein.

doi: 10.1038/sj.gt.3301904

Figure Lengend Snippet: Figure 6 No infiltration of NK or monocytes cells or massive induction of apoptosis were observed after treatment of the tumours by P27VP22. Tumours were excised from nude mice 24 h after the last intratumoural injection of 10 mg DNA vector encoding Luc, P27, P27VP22 or VP22 as in Figure 5. Five micrometer tumour slices were then immunostained with anti-CD11b antibody (a) or an anti-active form of caspase 3 (b) and nuclei were counterstained with haematoxylin staining. P27 stands for p27Kip1.

Article Snippet: After saturation with 5% BSA for 30 min, rabbit anti-human Caspase three Active (R&D Systems) at 1/ 5000 in BSA 1% was added overnight at 41C.

Techniques: Injection, Plasmid Preparation, Staining

Journal: Cell reports

Article Title: Endothelial p130cas confers resistance to anti-angiogenesis therapy.

doi: 10.1016/j.celrep.2022.110301

Figure Lengend Snippet: Figure 2. p130cas and VEGFR2 are internalized into autophagosomes and the nucleus, followed by caspase-10 cleavage, in ECs treated with Bev (A) Representative confocal images showing expression of VEGFR2 (green) in Bev-sensitive RF24-par and Bev-resistant RF24-Bev cells treated with VEGF only or VEGF + Bev. Scale bar, 50 mm; n = 3. (B) Expression of VEGFR2 pY1175 and pY1214 and total VEGFR2 in subcellular fractions of HPAECs. Only under VEGF-A (10 ng/mL) + Bev (5 mg/mL) treatment did the 100-kD fragment of VEGFR2 appear together with the phosphorylated and total matured VEGFR2 (220 kD). We used lamin A/C (LMNC) as a marker for the nuclear fraction (NER) and b-actin as a marker for whole-cell lysate (WCL) and cytoplasmic (Cyto) fractions. (C and D) Expression of Cyto p130cas and its 31-kDa nuclear fragment was observed in subcellular fractions from RF24-par cells but not from RF24-Bev cells (C). We used lamin B1 (LMNB1) as a marker for NER and b-actin as a marker for Cyto. When treated with VEGF + Bev, the 100-kDa nuclear fragment of VEGFR2 was observed only in subcellular fractions of RF24-par cells but not of RF24-Bev cells (D). Activated/cleaved caspase-10 was also observed in the Cyto and NER fractions of RF24-par cells treated with VEGF + Bev.

Article Snippet: Antibodies Mouse anti-human p130cas antibody Lab Vision/Neomarkers, Fremont, CA Cat# MS-855-P1ABX, RRID:AB_145261 Anti-human CD31 monoclonal antibody Dako, Carpinteria, CA Agilent Cat# GA610, RRID:AB_2892053 Anti-VEGF Receptor 2 antibody (ab39256), cytoplasmic portion Abcam Abcam Cat# ab39256, RRID:AB_883437 Anti-VEGF Receptor 2 antibody (ab45010), extracellular domain Abcam Abcam Cat# ab45010, RRID:AB_883436 Bevacizumab Genentech Inc N/A B20, anti-human/murine VEGF A antibody Genentech Inc N/A Recombinant DNA EGFP-LC3B Karla Kirkegaard (Addgene plasmid # 11546) RRID:Addgene_11546 MAP-LC3b2 CRISPR/Cas9 knockout plasmids (Human) Santa Cruz Biotechnology Cat# sc-417828, sc-417828-HDR CASP10 - human gene knockout kit via CRISPR/Cas9 (KN206379) Origene Cat# KN206379 VEGF Receptor 2 (KDR) (NM_002253) Human Tagged ORF Clone Origene Cat# NM_002253 Oligonucleotides Human-specific p130cas siRNA (CAGCATCACGCAGGGCAA) Sigma-Aldrich (St. Louis, MO) NM_014567 Murine-specific p130cas siRNA (TTGACTAATAGTCTACATTA) Sigma-Aldrich (St. Louis, MO) NM_009954 Control non-targeting siRNA (AATTCTCCGAACGTGTCACGT) Sigma-Aldrich (St. Louis, MO) SIC001 MISSION esiRNA human TNKS1BP1 (EHU090681) Sigma-Aldrich (St. Louis, MO) Cat# EHU090681 TNKS1BP1 – Human shRNA constructs in lentiviral vector (TL300907) Origene Cat# TL300907 Experimental models: Organisms/strains Mouse: C57BL/6-p130casflox/flox female and male Dr. Alex Kolodkin, Solomon H. Snyder Department of Neuroscience, Howard Hughes Medical Institute, The Johns Hopkins School of Medicine N/A Mouse: C57BL/6- Tie2-Cre+/- female and male Genetically Engineered Mouse Facility at MD Anderson Cancer Center https://www. mdanderson.org/research/research-resources/ core-facilities/genetically-engineered-mousefacility/mouse-resource-facility.html N/A Female athymic nude mice (NCr-nu) Taconic Model # NCRNU-F Female C57/BL6 mice Taconic Model # B6-F Software and algorithms GraphPad Prism 7.0 GraphPad Software, Inc., San Diego, CA GraphPad Prism, RRID:SCR_002798 Kaplan-Meier survival curves SPSS version 12 for Windows statistical software (SPSS, Inc., Chicago, IL) survival, RRID:SCR_021137 Cell Reports 38, 110301, January 25, 2022 e1 Article ll OPEN ACCESS

Techniques: Expressing, Marker

Journal: Cell reports

Article Title: Endothelial p130cas confers resistance to anti-angiogenesis therapy.

doi: 10.1016/j.celrep.2022.110301

Figure Lengend Snippet: Figure 4. TNKS1BP1 and nuclear VEGFR2 mediate AVA therapy-induced EC death (A) Nuclear TNKS1BP1 enrichment in RF24-par cells in response to Bev treatment. MOF, membranous fraction. b-Actin was used as Cyto CTL, p-cadherin as MOF CTL, and LMNB1 as NER CTL. (B) Expression of endothelial TNKS1BP1, shown by dual immunofluorescence staining for TNKS1BP1 (red) and CD31 (green), in ovarian tumor samples that were sensitive or resistant to AVA therapy (Bev). (C) Co-immunoprecipitation (coIP) of VEGFR2 and TNKS1BP1 in RF24-par cells under Bev treatment. The anti-VEGFR2 and anti-TNKS1BP1 immunoprecipitates were re-probed with an anti-p130cas antibody. (D) Representative confocal microscopy images showing TNKS1BP1 (green) and VEGFR2 (red) distributed into the NUs of RF24-par cells in response to Bev treatment (VEGF + Bev); this is distinctly different from the expression patterns in cells treated with CTL or VEGF only. Scale bar, 50 mm; n = 3. (E) Knockdown of TNKS1BP1 in RF24-par cells with shRNAs (A–D). (F and G) The graph shows mean numbers of SYTOX live cells for each treatment group (F; data are expressed as mean ± SD, n = 3, p < 0.001 or not significant [ns], two-tailed Student’s t test. Notably, in cells treated with scramble shRNA, the percentage of SYTOX viable cells was 36.3% under VEGF + Bev treatment; in cells transfected with shRNA A or C, the percentages of SYTOX live cells were 72.61% and 84.98%, respectively, under VEGF + Bev treatment. Also shown are representative plots of SYTOX populations from FACS analysis of RF24-par cells transfected with scramble shRNA, shRNA A, or shRNA C against TNKS1BP1 and treated with CTL, VEGF only, or VEGF + Bev (G). (H) Representative confocal images showing nuclear TNKS1BP1 and VEGFR2 in RF24-parscramble shRNA cells; VEGFR2 remained at the membrane in RF24- parshRNA-TNKS1BP1A cells under VEGF + Bev treatment. Scale bar, 50 mm; n = 3.

Article Snippet: Antibodies Mouse anti-human p130cas antibody Lab Vision/Neomarkers, Fremont, CA Cat# MS-855-P1ABX, RRID:AB_145261 Anti-human CD31 monoclonal antibody Dako, Carpinteria, CA Agilent Cat# GA610, RRID:AB_2892053 Anti-VEGF Receptor 2 antibody (ab39256), cytoplasmic portion Abcam Abcam Cat# ab39256, RRID:AB_883437 Anti-VEGF Receptor 2 antibody (ab45010), extracellular domain Abcam Abcam Cat# ab45010, RRID:AB_883436 Bevacizumab Genentech Inc N/A B20, anti-human/murine VEGF A antibody Genentech Inc N/A Recombinant DNA EGFP-LC3B Karla Kirkegaard (Addgene plasmid # 11546) RRID:Addgene_11546 MAP-LC3b2 CRISPR/Cas9 knockout plasmids (Human) Santa Cruz Biotechnology Cat# sc-417828, sc-417828-HDR CASP10 - human gene knockout kit via CRISPR/Cas9 (KN206379) Origene Cat# KN206379 VEGF Receptor 2 (KDR) (NM_002253) Human Tagged ORF Clone Origene Cat# NM_002253 Oligonucleotides Human-specific p130cas siRNA (CAGCATCACGCAGGGCAA) Sigma-Aldrich (St. Louis, MO) NM_014567 Murine-specific p130cas siRNA (TTGACTAATAGTCTACATTA) Sigma-Aldrich (St. Louis, MO) NM_009954 Control non-targeting siRNA (AATTCTCCGAACGTGTCACGT) Sigma-Aldrich (St. Louis, MO) SIC001 MISSION esiRNA human TNKS1BP1 (EHU090681) Sigma-Aldrich (St. Louis, MO) Cat# EHU090681 TNKS1BP1 – Human shRNA constructs in lentiviral vector (TL300907) Origene Cat# TL300907 Experimental models: Organisms/strains Mouse: C57BL/6-p130casflox/flox female and male Dr. Alex Kolodkin, Solomon H. Snyder Department of Neuroscience, Howard Hughes Medical Institute, The Johns Hopkins School of Medicine N/A Mouse: C57BL/6- Tie2-Cre+/- female and male Genetically Engineered Mouse Facility at MD Anderson Cancer Center https://www. mdanderson.org/research/research-resources/ core-facilities/genetically-engineered-mousefacility/mouse-resource-facility.html N/A Female athymic nude mice (NCr-nu) Taconic Model # NCRNU-F Female C57/BL6 mice Taconic Model # B6-F Software and algorithms GraphPad Prism 7.0 GraphPad Software, Inc., San Diego, CA GraphPad Prism, RRID:SCR_002798 Kaplan-Meier survival curves SPSS version 12 for Windows statistical software (SPSS, Inc., Chicago, IL) survival, RRID:SCR_021137 Cell Reports 38, 110301, January 25, 2022 e1 Article ll OPEN ACCESS

Techniques: Expressing, Staining, Immunoprecipitation, Confocal Microscopy, Knockdown, Two Tailed Test, shRNA, Transfection, Membrane

Journal: Cell reports

Article Title: Endothelial p130cas confers resistance to anti-angiogenesis therapy.

doi: 10.1016/j.celrep.2022.110301

Figure Lengend Snippet: Figure 5. Ablation of vascular p130cas delays progression of tumors with adaptive resistance to AVA therapy (A) Mouse models of adaptive resistance to the anti-VEGF antibody (B20) were established using an orthotopic model of OVCA432 cells labeled with luciferase (OVCA432-luc). Mice with adaptive resistance (e.g., after development of ‘‘breakthrough’’ disease) were randomized and treated with CH-NP-RGD-CTL siRNA or CH-NP-RGD-siRNA-mp130cas. (B–E) The (B) tumor weight, (C) number of tumor nodules, (D) volume of ascites, and (E) body weight of each mouse were recorded at necropsy. Data are ex- pressed as mean ± SD: (B) p < 0.001, (C) p = 0.005, (D) p = 0.05, and (E) p = 0.262, determined by two-tailed, nonparametric t test. (F) Schematic of the excision of exon 2 from the p130casflox/flox allele by Cre recombinase expressed in Tie2Cre mice to generate p130casflox/floxTie2Cre mice. (G) Schematic of the dosing and in vivo bioluminescence imaging regimen used to establish the syngeneic ID8 ovarian tumor mouse model with adaptive resistance to B20 treatment. (H and J) Representative gross images from C57/BL6 (H, on day 35) or p130casflox/floxTie2Cre (J, on day 98) mice. Syngeneic ID8 tumors, which were implanted surgically into the left ovary of each mouse, are labeled with yellow ovals (H). (I and K) ID8 tumor burden, demonstrated with bioluminescence in C57/BL6 or p130casflox/floxTie2Cre mice. (L) Kaplan-Meier survival plot of C57/BL6 and p130casflox/floxTie2Cre mice bearing intra-ovarian ID8 tumors and receiving B20 treatments; p < 0.001, log rank test.

Article Snippet: Antibodies Mouse anti-human p130cas antibody Lab Vision/Neomarkers, Fremont, CA Cat# MS-855-P1ABX, RRID:AB_145261 Anti-human CD31 monoclonal antibody Dako, Carpinteria, CA Agilent Cat# GA610, RRID:AB_2892053 Anti-VEGF Receptor 2 antibody (ab39256), cytoplasmic portion Abcam Abcam Cat# ab39256, RRID:AB_883437 Anti-VEGF Receptor 2 antibody (ab45010), extracellular domain Abcam Abcam Cat# ab45010, RRID:AB_883436 Bevacizumab Genentech Inc N/A B20, anti-human/murine VEGF A antibody Genentech Inc N/A Recombinant DNA EGFP-LC3B Karla Kirkegaard (Addgene plasmid # 11546) RRID:Addgene_11546 MAP-LC3b2 CRISPR/Cas9 knockout plasmids (Human) Santa Cruz Biotechnology Cat# sc-417828, sc-417828-HDR CASP10 - human gene knockout kit via CRISPR/Cas9 (KN206379) Origene Cat# KN206379 VEGF Receptor 2 (KDR) (NM_002253) Human Tagged ORF Clone Origene Cat# NM_002253 Oligonucleotides Human-specific p130cas siRNA (CAGCATCACGCAGGGCAA) Sigma-Aldrich (St. Louis, MO) NM_014567 Murine-specific p130cas siRNA (TTGACTAATAGTCTACATTA) Sigma-Aldrich (St. Louis, MO) NM_009954 Control non-targeting siRNA (AATTCTCCGAACGTGTCACGT) Sigma-Aldrich (St. Louis, MO) SIC001 MISSION esiRNA human TNKS1BP1 (EHU090681) Sigma-Aldrich (St. Louis, MO) Cat# EHU090681 TNKS1BP1 – Human shRNA constructs in lentiviral vector (TL300907) Origene Cat# TL300907 Experimental models: Organisms/strains Mouse: C57BL/6-p130casflox/flox female and male Dr. Alex Kolodkin, Solomon H. Snyder Department of Neuroscience, Howard Hughes Medical Institute, The Johns Hopkins School of Medicine N/A Mouse: C57BL/6- Tie2-Cre+/- female and male Genetically Engineered Mouse Facility at MD Anderson Cancer Center https://www. mdanderson.org/research/research-resources/ core-facilities/genetically-engineered-mousefacility/mouse-resource-facility.html N/A Female athymic nude mice (NCr-nu) Taconic Model # NCRNU-F Female C57/BL6 mice Taconic Model # B6-F Software and algorithms GraphPad Prism 7.0 GraphPad Software, Inc., San Diego, CA GraphPad Prism, RRID:SCR_002798 Kaplan-Meier survival curves SPSS version 12 for Windows statistical software (SPSS, Inc., Chicago, IL) survival, RRID:SCR_021137 Cell Reports 38, 110301, January 25, 2022 e1 Article ll OPEN ACCESS

Techniques: Labeling, Luciferase, Two Tailed Test, In Vivo, Imaging